Gu

JPT

a

ARRAA

KCGRIB

1

wWRDhasCrrp2a

c

h0

Industrial Crops and Products 95 (2017) 235–243

Contents lists available at ScienceDirect

Industrial Crops and Products

jo ur nal home p age: www.elsev ier .com/ locate / indcrop

enetic diversity study amongst Cymbopogon species from NE-Indiasing RAPD and ISSR markers

. Baruah, B. Gogoi, K. Das, N.M. Ahmed, D.K. Sarmah, M. Lal, B.S. Bhau ∗

lant Genomics Laboratory, Medicinal Aromatic & Economic Plants Group, Biological Sciences & Technology Division, CSIR-Northeast Institute of Science &echnology, Jorhat 785 006, Assam, India

r t i c l e i n f o

rticle history:eceived 8 June 2016eceived in revised form 10 October 2016ccepted 13 October 2016vailable online 5 November 2016

eywords:ymbopogon speciesenetic diversityAPD

a b s t r a c t

Cymbopogon, an important genus of the family Poaceae, cultivated mainly for its essential oil, is a valuablemedicinal and aromatic plant. Essential oils from this crop found a wide range of application includingmedicine, perfumery, ornamental, flavouring and therapeutic uses in pharmaceuticals and is emergingcrop for bio fuel production. Many species of Cymbopogon cultivated worldwide but their identification issomewhat difficult since they do not have suitable genomic diversity information. Assessment of geneticdiversity is therefore essential for conservation and management of this species. A total of 20 RandomlyAmplified Polymorphic DNA (RAPD) and 15 Inter Simple Sequence Repeats (ISSR) primers were examined,of which 26 primers (13 RAPD and 13 ISSR) showed amplification and were used for further study.Unweighted Pair Group Method of Arithmetic Mean (UPGMA) derived dendrogram in both the analysis

SSRio-fuel

was more or less similar and cluster analysis (CA) based on RAPD, ISSR and their combined data clearlydiscriminated the genotypes into different clusters. Result of principal component analysis (PCA) was inagreement with cluster analysis with a few exceptions. DNA based markers (RAPD and ISSR) could beeffectively used for genetic diversity evaluation among Cymbopogon species. Results of this study willhelp in the conservation and Cymbopogon improvement/breeding programe.

© 2016 Elsevier B.V. All rights reserved.

. Introduction

Cymbopogon, an important member of the grass family Poaceae,hich includes plant like lemongrass (C. flexuosus Nees ex Steud)ats; citronella (C. winterianus Jowitt) and palmarosa (C. martini

oxb.) Wats has been grown to produce essential oils for industries.ifferent species of Cymbopogon are used in beverages, foodstuffs,ousehold products; as pesticide, fungicide, insect repellent ands ingredient in medicine (Akhila et al., 2009). Among five mainpecies of Cymbopogon that yield oils of commercial importance,. flexuosus (East Indian lemongrass) and C. winterianus (Java cit-onella) are worth mentioning. Lemongrass oil has found a wideange of applications; as flavouring agents, in pharmaceutical anderfumery industries and in synthesis of Vitamin A (Ganjewala,008). Citronella oil is commonly used in mosquito repellent lotions

nd in sanitary preparations (Shasany et al., 2000).

Recently C. flexousus has been studied as a potential bio energyrop (Joyce et al., 2015). Replacing petroleum as a natural resource

∗ Corresponding author.E-mail addresses: bsbhau@gmail.com, bhaubs@rrljorhat.res.in (B.S. Bhau).

ttp://dx.doi.org/10.1016/j.indcrop.2016.10.022926-6690/© 2016 Elsevier B.V. All rights reserved.

extends beyond producing renewable liquid fuels. Liquid fuels arecurrently indispensable to maintain modern transportation andindustrial infrastructure. Like other bio energy crops such as Jat-ropha curcas (Makkar and Becker, 2009), Miscanthus (Yook et al.,2014), Pongamia (Kesari and Rangan, 2010) interest in C. flexuo-sus as a source of oil for producing biodiesel has arise due to itsability to grow in arid and semi-arid regions with low nutrientrequirements and little care. In addition to advantages as bio fuel,terpenoid hydrocarbons (a major constituent of lemongrass) havebeen identified as a potential ready advanced bio fuel chemical(Joyce et al., 2015). Alagumalai (2015) reported that the lemongrassoil combustion characteristics disclose that, in general, they canonly represent alternative to conventional fuel combustion. Copro-duction of high-value commodities from lignocellulosic sources hasrecently become a major focus of research for these reasons. More-over the biomass left after extraction of oil is used as fodder forcattle, in paper making and as fuel in distillation (Akhila et al.,2009).

Being a highly industrial and aromatic plant, the worldwidedemand of Cymbopogon species is increasing day by day. The genuscomprises of 180 species, subspecies and varieties (Akhila et al.,2009). These species are geographically distributed in tropical and

dx.doi.org/10.1016/j.indcrop.2016.10.022http://www.sciencedirect.com/science/journal/09266690http://www.elsevier.com/locate/indcrophttp://crossmark.crossref.org/dialog/?doi=10.1016/j.indcrop.2016.10.022&domain=pdfmailto:bsbhau@gmail.commailto:bhaubs@rrljorhat.res.indx.doi.org/10.1016/j.indcrop.2016.10.022

2 ps and

slChwlbacotbgolnc

alstadmc1debghaagtZ

oA2eacFms(ssd2sgEo

2

2

tIg

36 J. Baruah et al. / Industrial Cro

ub-tropical regions of the world, varying from mountains, grass-ands to arid zones. In recent years there has been a decline in theymbopogon oil production due to lack of adequate rainfall, overarvesting, frequent use of fires to stimulate grass growth, lack ofater and fuel wood needed for distillation and loss of interest of

ocal people in lemon grass oil production. In general, perennialio fuel crops are superior to the annual crops in terms of sustain-bility. So there is an urgent need to raise high quality lemongrassultivars to fulfil the demand of the people and aid in enrichmentf the species. Because of the content of its high-value essential oil,he cost for production of biomass for bio fuel may be low, since theiomass would be a by-product of essential oil production. Lemon-rass may prove to be a high value speciality crop and a good sourcef bio fuel in different parts of the world. The essential oil fromemongrass may rectify the current problems of economic, agro-omic, and environmental effects of large production of bio-fuelrops (Maughan et al., 1996; Zheljazkov et al., 2011).

Cymbopogon species displays wide variation in morphologicalttributes and essential oil composition at inter and intra specificevels (Rao, 1997). The plant material is largely propagated throughlips (vegetative part), except a few accessions that were raisedhrough seeds. In order to conserve, develop high quality cultivarsnd select effective parental lines, knowledge of the germplasmiversity is most essential. Compared with morphological data,olecular tools provide abundant information and are highly effi-

ient and insensitive to environmental factors (Lee and Rasmussen,999). Molecular markers has proved to be an effective tool iniversity study (Jain et al., 2003; Bhau, 2012), estimation of relat-dness between different genotypes (Hazarika et al., 2014) and haseen identified as an important tool in crop improvement pro-ramme (Kesawat and Das, 2009). DNA based molecular markersave been used in the recent past to assess the genetic diversityvailable (Kumar et al., 2007). RAPD and ISSR marker techniquesre widely used as they do not require the prior knowledge ofenome sequences and its protocol is relatively simple, cost effec-ive, rapid and highly reproducible in nature (Williams et al., 1990;ietkiewicz et al., 1994).

Earlier several studies were carried out on genetic diversityf Cymbopogon species using RAPD (Bishoyi et al., 2016; Lal andwasthi, 2015; Saikia et al., 2015; Ganjewala, 2008; Shasany et al.,000), ISSR (Bishoyi et al., 2016; Saikia et al., 2015), SSR (Kumart al., 2009) and AFLP markers (Lal and Awasthi, 2015). Despite ofll these reports the population size taken into study was signifi-antly small, which is not reliable for evaluation of genetic diversity.or genetic diversity study, sample size considered is one of theost crucial factors that affect the accuracy of the work. Small

ample sizes often give skewed result, leading to significant errorsBashalkhanov et al., 2009; Khanlou et al., 2011). In the presenttudy population size is comparatively higher (100 of C. flexuo-us and 27 of C. winterianus). Moreover the Indo Burma regionescribed as native of Cymbopogon species (Tripathi and Singh,014), NE-India being within the bounds of this region can be con-idered as a home of this genus. So emphasis has been given onenetic diversity study on C. flexuosus and C. winterianus from Northast India using ISSR and RAPD markers to have a better knowledgen the prevailing genus and aid in enrichment of the species.

. Materials and methods

.1. Plant materials

Different genotypes belonging to C. flexousus (100) and C. win-erianus (27) were collected from different regions of North Eastndia (Fig. 1). These plants were maintained in fields of Cymbopogonermplasm at CSIR-NEIST experimental farm, Jorhat, Assam, India.

Products 95 (2017) 235–243

2.2. Genetic diversity using RAPD and ISSR marker

2.2.1. DNA extractionThe young leaf samples were collected and cleaned with sterile

distilled water. The external moisture from the leaves was allowedto dry and kept at −80 ◦C for overnight. The leaves were thenallowed to lyophilise for 48 h at −110 ◦C and then kept in air tightzip-lock bags till DNA extraction. Genomic DNA was isolated usingCTAB method described by Doyle and Doyle (1990) with some mod-ifications appropriate for Cymbopogon. The quantity and purity ofthe extracted DNA was evaluated by using Bio spectrophotometer(Eppendorf, Germany) using an aliquot of 3 �l of DNA sample fromthe stock. The purity of the DNA was also confirmed by gel elec-trophoresis system using 0.8% agarose and the DNA was observedusing a gel documented system (G: BOX, Syngene, U.K.).

2.2.2. RAPD and ISSR analysisGenetic variation among 127 genotypes of Cymbopogon was per-

formed employing 13 RAPD and ISSR primers, namely RPi-1, 2, 3, 4,5, 6, 7, 8, 10, 11, 12, 14, 16 (Genei, Bangalore) and 807, 808, 809, 812,814, 815, 816, 817, 818, 841, 842, 853, 855 respectively. The DNAstock was diluted to10 ng/�l. The PCR reaction mixture for RAPDand ISSR was standardised to a total volume of 20 �l containing 10XTaq Buffer A with 15 mM MgCl2 (Thermo Scientific, US), 2.5 mMdNTP (Thermo Scientific, US), 1 �l Primer for both RAPD and ISSR(Bangalore Genei, India), 1U/�l Taq DNA Polymerase, and the finalvolume was adjusted by adding autoclaved water (double distilled).

The reaction programmes for RAPD was set at 94 ◦C for 3 minfollowed by 35 cycles of 94 ◦C for 54 s, 45 ◦C for 45 s, 2 min elon-gation at 72 ◦C and a final extension at 72 ◦C for 10 min and ISSRat 94 ◦C for 4 min followed by 35 cycles of 94 ◦C for 30 s, 90 s atannealing temperature 45–50 ◦C, according to primer’s Tm (melt-ing temperature) then 2 min elongation at 72 ◦C and a 10 min finalextension at 72 ◦C. The amplified DNA product was analysed on 1.5%agarose gel and visualized under UV light and documented using aGel Documentation System (Syngene G-Box, U.K).

2.2.3. Statistical analysisThe observed amplicons were scored on the basis of the pres-

ence as 1 and absence as 0. From each gel of RAPD and ISSR, numberof polymorphic bands, total number of bands and percentage ofpolymorphic bands were calculated. Polymorphism InformationContent (PIC), Marker Index (MI) and Resolving power (Rp) werecalculated to differentiate the effectiveness of different primers. PICwas calculated by the formula of Botstein et al. (1980) as:

PIC = 1 − �f i2

Where, f is the frequency of ith allele. Marker index (MI) wascalculated as product of PIC and effective multiplex ratio (EMR),where EMR is the product of the fraction of polymorphic loci andthe number of polymorphic loci (Milbourne et al., 1997; Prevost andWilkinson, 1999). Resolving power (Rp) which shows the capacityof a primer to distinguish among different genotypes was assessedaccording to the formula: Rp = � Ib where Ib is the band infor-mativeness of the primers with Ib = 1 − [2 × |.5 − p|], ‘p’ being theproportion of clones containing the band (Prevost and Wilkinson,1999).

To determine genetic parameters such as- number of alleles perlocus (Na), effective number of alleles (Ne), Nei’s gene diversity(He), Shannon’s diversity index (I), diversity within population (Hs),total gene diversity (Ht) and gene flow (Nm), POPGENE software

version 1.32 written by Yeh et al. (2000) was used. The analysisof molecular variance (AMOVA) was also carried out within andbetween populations by Arlequin software ver. 3.11 (Excoffier et al.,2005).

J. Baruah et al. / Industrial Crops and Products 95 (2017) 235–243 237

on spe

ai2A(ty

3

3

w7pt8SootmstfRo

Fig. 1. Distribution map of collected Cymbopog

For genetic similarity among all possible pairs, the data werenalysed with the SIMQUAL option, on the basis of Jaccard’s sim-larity coefficient using NTSYS-pc program Version 2.1 (Rohlf,000). Different groups were analysed using SAHN (Sequentialgglomerative Hierarchical Nested cluster analysis) and UPGMA

Unweighted Pair Group Method Analysis) module to generate aree. To further differentiate the groups, principal coordinate anal-sis (PCO) was performed using Rohlf’s (2000) NTSYS software.

. Results

.1. Polymorphism revealed by ISSR and RAPD primers

Overall 13 ISSR primers amplified a total of 93 bands, out ofhich 91 were polymorphic for the entire data set. An average of

.15 bands per primer was generated. The total number of polymor-hic bands produced per primer ranged from 4 (ISSR 814 and 817)o a maximum of 11 (ISSR 807), while all other primers except ISSR53 and 855 resulted in 100% polymorphism (Tables 1A and 1B).imilarly 13 RAPD primers yielded a total of 101 bands (an averagef 7.77 bands per primer), of which 91 were polymorphic. Numberf polymorphic bands produced per primer ranged from 3 (RPi 12)o 11 (RPi 11) and primers RPi 2, 3, 4, 11 and 16 showed 100% poly-

orphism (Tables 1A and 1B). Overall percentage polymorphismhown by ISSR and RAPD primers was 90.68% and 88.62% respec-

ively. PIC values obtained for both the primers ranged from 0.57or ISSR817 and 0.51 for RPi12 to 0.81 (ISSR814, RPi16). Averagep values of both ISSR (4.50) and RAPD primers (4.57) were morer less similar, showing equal effectiveness of the primers. How-

cies from different places of North-East India.

ever the average MI of ISSR markers (4.65) was slightly higher thanthose of RAPD primers (4.39).

3.2. Genetic diversity in Cymbopogon

Genetic parameters viz- observed number of alleles (Na), effec-tive number of alleles (Ne), Nei’s gene diversity (He), Shannon’sdiversity index (I), diversity within population (Hs), total speciesdiversity (Ht) and gene flow (Nm) were shown in Table 2 and Table 3respectively. All parameters revealed by ISSR primers were foundto be higher (1.98, 1.70, 0.39, 0.57 for C. flexuosus and 1.72, 1.44,0.27, 0.37 for C. winterianus) than RAPD primers (1.90, 1.64, 0.36,0.52 for C. flexuosus and 1.83, 1.43, 0.25, 0.31 for C. winterianus)genotypes.

Similarly the values for total species diversity among population(Ht), diversity within population (Hs) and gene flow (Nm) were highfor ISSR marker (0.37, 0.31, 2.58) than RAPD marker (0.36, 0.29,2.20) but the value for coefficient of gene differentiation (Gst) wasmore for RAPD marker (0.19) than ISSR marker (0.16).

3.3. AMOVA (analysis of molecular variance) analysis

A highly significant contribution of variance within popula-tion was shown by RAPD markers (80%) than ISSR markers (79%)(Table 4). No significant genetic variation was observed among pop-

ulation, only 21% for ISSR and 20% for RAPD markers. RAPD and ISSRanalysis showed that the variance within the population was 17.51and 17.26 which was much higher than the variance among thetwo populations (4.26 and 4.46).

238 J. Baruah et al. / Industrial Crops and Products 95 (2017) 235–243

Table 1ACharcteristics of primer sequences, amplified bands, polymorphic bands, percentage polymorphism and Polymorphism Information Content (PIC) for ISSR primers inCymbopogon species.

ISSR Primers Primersequence

Number ofpolymorphicbands

Total number ofbands

Percentagepolymorphism

Polymorphisminformationcontent (PIC)

Marker Index(MI)

Resolvingpower (Rp)

ISSR807ISSR808ISSR809ISSR812ISSR814ISSR815ISSR816ISSR817ISSR818ISSR841ISSR842ISSR853ISSR855

(AG)16T(AG)16C(AG)16G(GA)16A(CT)16A(CT)16G(CA)16T(CA)16A(CA)16G(GA)16YC(GA)16YG(TC)16RT(AC)16YT

11668476477889

116684764778910

10010010010010010010010010010010088.990

0.610.650.760.720.810.700.720.570.770.670.580.790.59

6.693.904.555.713.224.904.302.265.364.674.615.544.76

6.463.624.654.273.123.954.792.115.024.964.944.855.78

average 91 93 90.68 0.68 4.65 4.50

Table 1BCharcteristics of primer sequences, amplified bands, polymorphic bands percentage polymorphism and Polymorphism Information Content (PIC) for RAPD primers inCymbopogon species.

RAPD Primers Primer sequence(5′-3′)

Number ofpolymorphicbands

Total number ofbands

Percentagepolymorphism

Polymorphisminformationcontent (PIC)

Marker Index(MI)

ResolvingPower (Rp)

RPI 1RPI 2RPI 3RPI 4RPI 5RPI 6RPI 7RPI 8RPI 10RPI 11RPI 12RPI 14RPI 16

AAAGCTGCGGAACGCGTCGGAAGCGACCTGAATCGCGCTGAATCGGGCTGACACACGCTGACATCGCCCAACCACCCACCACGATGAGCGACGGAAGTGGACGGCAACCTACTTCGCCACAGGCGGCAAG

461066787611398

6610678987115108

66.710010010085.787.588.987.585.71006090100

0.690.600.720.640.670.650.680.570.670.800.510.650.81

1.843.637.183.843.464.014.843.463.448.760.915.236.44

1.944.467.364.164.013.515.974.034.466.901.095.845.69

average 91 101 88.62 0.67 4.39 4.57

Table 2Genetic parameters based on ISSR and RAPD analysis of two species of Cymbopogon.

Species Marker Mean Na (Observednumber of alleles)

Mean Ne (Effectivenumber of alleles)

Mean He (Nei’sgene Diversity)

Mean I (Shanon’sdiversity index)

C. flexuosus ISSR 1.98 1.70 0.39 0.57C. winterianus 1.72 1.44 0.27 0.37C. flexuosus RAPD 1.90 1.64 0.36 0.52C. winterianus 1.83 1.43 0.25 0.31

Table 3Estimate of total species diversity (Ht); Diversity within population (Hs); Coefficient of gene differentiation (Gst) and Gene flow (Nm) within the Cymbopogon species understudy.

Marker Total speciesdiversity (Ht)

Diversity withinpopulation (Hs)

Coefficient of genedifferentiation(Gst)

Gene flow (Nm)

ISSR 0.37 0.31 0.16 2.58RAPD 0.36 0.29 0.19 2.20

Table 4Analysis of molecular variance (AMOVA) based on ISSR and RAPD markers in Cymbopogon species.

Marker Source of variation Degrees of freedom (df) Sum of squares (SS) Variance component % of total variance P value

ISSR Among Population 2 239.60 4.46 21 0.21Within Population 124 2139.78 17.26 79 0.00Total 126 2379.39 21.72 100

RAPD Among Population 2 230.92 4.26 20 0.20Within Population 124 2171.66 17.51 80 0.00Total 126 240.58 21.77 100

Significant level based on 9999 permutations; P value = probability of obtaining a more extreme component by chance alone.

ps and

3a

d(flf8(fl

Rgmwa92flfl

1daflo

twc

J. Baruah et al. / Industrial Cro

.4. Genetic similarity, cluster analysis and principal coordinatenalysis

Jaccard’s similarity coefficient calculated for both ISSR and RAPData showed that similarity value for ISSR data ranged from 0.33C. winterianus 122 vs C. flexuosus 41) to 0.93 (C. flexuosus 46 vs C.exuosus 45). Similarly genetic similarity (GS) for RAPD data variedrom 0.40 (C. winterianus 101 vs C. flexuosus 8) to 0.94 (C. flexuosus2 vs C. flexuosus 81) and their combined data varied from 0.39C. flexuosus 84 vs C. flexuosus 83) to 0.93 (C. winterianus 105 vs C.exuosus 41).

Dendrogram generated from UPGMA cluster analysis of ISSR,APD and combined data are shown in Fig. 2(A)–(C). Dendogramenerated from ISSR data clearly separated the genotypes into threeain clusters. Cluster 1 comprises of two sub clusters (a and b)here sub cluster ‘a’ comprises all the 27C. winterianus genotypes

nd sub cluster ‘b’ contains 10 genotypes of C. flexuosus (CF 99, CF8, CF 97, CF 91, CF 90, CF 95, CF 96, CF 94, CF 93, CF 92). Cluster

includes three sub clusters (a, b and c) all of which contains C.exuosus species. Similarly cluster 3 contains 29 genotypes of C.exuosus.

Cluster analysis based on RAPD data resulted into three clusters-–3. Cluster 1 comprises of all C. flexuosus genotypes. Cluster 2 isivided into 3 sub clusters-a–c, where sub cluster ‘a’ comprises ofll C. winterianus genotypes and sub cluster ‘b’ and ‘c’ comprises of C.exuosus genotypes. Cluster 3 with no further sub clusters containsnly C. flexuosus genotypes.

Dendrogram obtained from combined ISSR-RAPD data showedhat the genotypes clustered differently showing little resemblanceith ISSR and RAPD results. Cluster 1 comprises of three sub

lusters (a–c), all containing genotypes of C. flexuosus. Cluster 2

Fig. 2. Dendrogram of 127 genotypes of Cymbopogon sp. gen

Products 95 (2017) 235–243 239

comprises of two sub clusters- ‘a’ and ‘b’; sub ‘a’ containing allgenotypes of C. winterianus and sub ‘b’ comprising of C. flexuosusgenotypes along with two out-group’s containing two genotypesof C. flexuosus (CF 100 and CF 99). As in RAPD, cluster 3 have nofurther sub clusters and contains genotypes of C. flexuosus.

Principal coordinate analysis (PCA) was carried out for furtherdifferentiation of these two species [Fig. 3(A)–(C)]. PCA plot ofISSR data showed clear separation of genotypes among popula-tions (between C. flexuosus and C. winterianus), which was far betterthan conclusion drawn from cluster analysis. Within populationtwo distinct groups were formed, which fully supports the resultsof cluster analysis. In RAPD-PCA plot there is a clear separationbetween C. flexuosus and C. winterianus genotypes. However unlikecluster analysis, within population no clear separation of genotypeswas observed. Similar conclusion can be drawn for combined PCAplot. Within population no clear separation of genotypes can benoticed like that of cluster analysis. Overall the PCA results were infavour of the conclusion drawn from cluster analysis.

4. Discussion

In order to go for a proper conservation, management and selec-tion of parental lines for large scale cultivation, a prior knowledgeon the existing genetic diversity is most important. For improve-ment of crop genetic resource, it is necessary to have continuousmixing of wild relatives and use of effective breeding methods. Con-sidering the need of molecular characterisation of the crop, studies

were undertaken on DNA fingerprinting using ISSR and RAPD mark-ers. Earlier works done on Cymbopogon species using differentmolecular markers cannot be reliable as the population sample sizetaken into consideration was very less. Lower the number of sam-

erated from (A) ISSR, (B) RAPD and (C) combined data.

240 J. Baruah et al. / Industrial Crops and Products 95 (2017) 235–243

(Cont

pehc

Fig. 2.

le size, it gives skewed results (Bashalkhanov et al., 2009; Khanlout al., 2011). In the present study the sample size is considerablyigh. The results also showed that both the markers were suc-essful in discriminating Cymbopogon species (Tables 1A and 1B

inued)

and Table 2). According to Botstein et al. (1980), PIC value greaterthan 0.5 indicates highly informative marker. The obtained PICvalues were greater than 0.56 for both the markers respectively,indicating the effectiveness of both the markers in segregating Cym-

ps and

btmebeAepsamipt

J. Baruah et al. / Industrial Cro

opogon species. Previously RAPD and ISSR markers have been usedo fingerprint Cymbopogon germplasm. For example-using RAPD

arkers, Saikia et al. (2015) reported 75.11% polymorphism; Kumart al. (2009) reported the presence of 122 (81.1%) polymorphicands in different Cymbopogon species using 20 SSR primers gen-rated from rice genome. Similar results were reported by Lal andwasthi in 2015 (81.33% polymorphic) using RAPD primers. Bishoyit al. (2016) reported 69% and 62.93% polymorphism in Cymbo-ogon using ISSR and RAPD primers respectively. In the presenttudy a high level of polymorphism was revealed by ISSR (90.68%)nd RAPD markers (88.62%), showing high effectiveness of both the

arkers. However ISSR markers were found to be more effective

n diversity study than RAPD markers (Fang and Roose, 1997). Theresent study clearly supports the view. Average Rp value of bothhe markers is more or less similar but average MI value (4.65)

Fig. 3. 3-D PCA analysis of Cymbopogon genotypes bas

Products 95 (2017) 235–243 241

of ISSR primers was more than RAPD primers (4.39). Such varia-tion shown by ISSR and RAPD markers was due to the fact that ISSRmarkers are selective in their amplification. They amplify conservedregions present between the microsatellite repeat sequences, butRAPD markers are not selective, rather they amplify any regionswithin the entire genome (Zietkiewicz et al., 1994).

In the present study genetic structure of both the species ofCymbopogon was determined using different parameters, wherethe values were found to be highest for ISSR markers, with a highgene flow than RAPD markers (Table 3). According to Slatkin (1987),between any populations, a value of gene flow (Nm)

242 J. Baruah et al. / Industrial Crops and Products 95 (2017) 235–243

(Cont

me

outptbp(wvir

siitissbaWdIwiws

5

tft

Fig. 3.

arkers taken into study, RAPD (Nm = 2.20) was more effective invaluating gene flow compared to ISSR (Nm = 2.58).

AMOVA analysis result showed that the genetic variationccurred mainly within the population than among the two speciesnder study. AMOVA result for RAPD marker showed that 80% of theotal variance was attributed within the population and 20% amongopulation. Similarly AMOVA for ISSR revealed 79% variance withinhe population and 21% variance among the population. In Sorghumicolor (Satish et al., 2015), reported vast genetic differences withinopulations (95%) than among populations (5%). Similarly Xia et al.2007), found 77.3% variation among population compared to 22.7%ithin population. The results were supported by the fact that the

alue of gene flow (Nm) was much higher than the threshold limit,ndicating that gene exchange within the population was higher,esulting in greater variation.

Cluster analysis based on ISSR, RAPD and their combined datahowed a clear separation in the two species of Cymbopogon;ncluding all genotypes from same population together. The firstncludes population of C. winterianus and second of C. flexuosus;hus highlighting the efficiency of both the markers in discrim-nating the two Cymbopogon species. These results were furtherupported by the PCA plot generated based on Jaccard’s (1908)imilarity coefficient. PCA plot generated for ISSR, RAPD and com-ined data revealed that genotypes of C. winterianus are distinctnd well separated from the remaining genotypes of C. flexuosus.ithin population no major differences were observed between

endrogram and PCA plot, except for ten genotypes of C. flexuosus.SSR dendrogram revealed the genotypes having close association

ith C. winterianus but appeared far apart in PCA plot. Similarlyn RAPD- PCA plot genotype 99 showed close associations with C.interianus. Overall the 2-D principal coordinate analysis was in

upport of the conclusion drawn from cluster analysis.

. Conclusion

Cymbopogon is a highly important crop valued for its essen-ial oil in different industries. In addition, its importance as a biouel crop, like that of Jatropha, Miscanthus, Pongamia for produc-ion of bio fuel and the future scope of Cymbopogon as a source of

inued)

biodiesel will heavily depend on unlimited feed stock supply. Toenrich the genetic pool of the species, screening and selection ofgenotypes is essential which can be achieved only through propergenetic diversity study. The present study revealed a high levelof genetic diversity among different genotypes (C. flexuosus andC. winterianus); which might be due to the origin and geograph-ical distribution of these genotypes. The findings will be certainlyhelpful for the breeders in selection of genotypes for future breed-ing/improvement programmes to increase oil yield content and aidin enrichment of the species.

Acknowledgement

This research work is a part of CSIR Network (BSC- 0110) Project,Government of India. Authors are thankful to the Director, CSIR-NEIST, Jorhat, for his consistent support to undertake this researchwork.

References

Akhila, A., Bertea, C.M., Bigheli, A., Casanova, J., Khunkitti, W., Maffei, M.E., Mathur,A.K., Moyler, D.A., Pandey, A.K., Sumi, H., Tiwari, R., Yatagai, C., 2009. EssentialOil- Bearing Grasses: The Genus Cymbopogon. Taylor & Francis Group, NewYork.

Alagumalai, A., 2015. Combustion characteristics of lemongrass (Cymbopogonflexuosus) oil in a partial premixed charge compression ignition engine. Alexa.Engin. J. 54, 405–413.

Bashalkhanov, S., Pandey, M., Rajora, O.M., 2009. A simple method for estimatinggenetic diversity in large populations from finite sample sizes. Bio. Med.Central Genet., http://dx.doi.org/10.1186/1471-2156-10-84.

Bhau, B.S., 2012. Molecular markers in the improvement of the medicinal plants.Med. Aromat. Plants 1, 2–3.

Bishoyi, A.K., Sharma, A., Kavane, A., Geetha, K.A., 2016. Varietal discrimination andgenetic variability analysis of cymbopogon using RAPD and ISSR markersanalysis. Appl. Biochem. Biotechnol., http://dx.doi.org/10.1007/s12010-016-2022-y.

Botstein, D., White, R.L., Skolnick, M., Davis, R.W., 1980. Construction of a geneticlinkage map in man using restriction fragment length polymorphisms. Am. J.Hum. Genet. 32, 314–331.

Doyle, J.J., Doyle, J.J., 1990. Isolation of plant DNA from fresh tissue. Focus 12,

13–15.

Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin 3.0: an integrated softwarepackage for population genetics data analysis. Evol. Bioinf. Online 1, 47–50.

Fang, D.Q., Roose, M.L., 1997. Identification of closely related citrus cultivars withinter-simple sequence repeat markers. Theor. Appl. Genet. 95, 408–417.

http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0005http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0010dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84dx.doi.org/10.1186/1471-2156-10-84http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0020dx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-ydx.doi.org/10.1007/s12010-016-2022-yhttp://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0030http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0035http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0040http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0045

ps and

G

H

J

J

K

K

K

K

K

L

L

M

M

M

J. Baruah et al. / Industrial Cro

anjewala, D., 2008. RAPD characterisation of three selected cultivars OD- 19, GRL-1 and Krishna of east Indian lemongrass (Cymbopogon flexuosus nees ex steud)wats. Am. Eu. J. Bot. 1, 53–57.

azarika, T.K., Hazarika, B.N., Shukla, A.C., 2014. Genetic variability andphylogenetic relationships studies of genus Citrus L. with the application ofmolecular markers. Genet. Resour. Crop Evol. 61, 1441–1451.

ain, N., Shasany, A.K., Velusamy, S., Subramani, R., Darokar, M., Bagchi, G.D., 2003.Molecular diversity in Phyllanthus amarus assessed through RAPD analysis.Curr. Sci. 85, 1454–1458.

oyce, B.L., Zheljazkov, V.D., Sykes, R., Cantrell, C.l., Hamilton, C., Mann, D.G.J.,Rodriguez, M., Mielenz, J.R., Astatkie, T., Stewart, C.N., 2015. Ethanol and high-value terpene Co- production from lignocellulosic biomass of Cymbopogonflexuosus and Cymbopogon martinii. PLoS One 10, e0139195, http://dx.doi.org/10.1371/journal.pone.0139195.

esari, V., Rangan, L., 2010. Development of Pongamia pinnata as an alternativebiofuel crop—current status and scope of plantations in India. J. Crop Sci.Biotechnol. 13, 127–137.

esawat, M.S., Das, B.K., 2009. Review on molecular marker: its application in cropimprovement. J. Crop Sci. Biotechnol. 12, 168–178.

hanlou, K.M., Vandepitte, K., Asl, L.K., Bockstaele, E.V., 2011. Towards an optimalsampling strategy for assessing genetic variation within and among whiteclover (Trifolium repens L.) cultivars using AFLP. Genet. Mol. Biol. 34, 252–258.

umar, J., Verma, V., Qazi, G.N., Gupta, P.K., 2007. Genetic diversity in Cymbopogonspecies using PCR-based functional markers. J. Plant Biochem. Biotechnol. 16,119–122.

umar, J., Verma, V., Goyal, A., Shahi, A., Sparoo, R., Sangwan, R.S., Qazi, G.N., 2009.Genetic diversity analysis in Cymbopogon species using DNA markers. PlantOmics J. 2, 20–29.

al, N., Awasthi, S.K., 2015. A comparative assessment of molecular marker assays(AFLP and RAPD) for Cymbopogon germplasm characterization. World J. Pharm.Res. 4, 1019–1041.

ee, S.B., Rasmussen, S.K., 1999. Molecular markers in some medicinal plants of theApiaceae family. Euphytica 114, 87–91.

akkar, H.P.S., Becker, K., 2009. Jatropha curcus, a promising crop for thegeneration of biodiesel and value added coproducts. Eur. J. Lipid Sci. Technol.111, 773–787.

aughan, P.J., Saqhai Maroof, M.A., Buss, G.R., Huestis, G.M., 1996. Amplified

fragment length polymorphism (AFLP) in soybean: species diversity,inheritance, and near- isogenic line analysis. Theor. Appl. Genet. 93, 392–401.

ilbourne, D., Meyer, R., Bradshaw, J.E., Baird, E., Bonar, N., Provan, J., Powell, W.,Robbie, W., 1997. Comparison of PCR-based marker systems for the analysis ofgenetic relationships in cultivated potato. Mol. Breed. 3, 127–136.

Products 95 (2017) 235–243 243

Prevost, A., Wilkinson, M.J., 1999. A new system of comparing PCR primers appliedto ISSR fingerprinting of potato cultivars. Theor. Appl. Genet 98, 107–112.

Rao, B.L., 1997. Scope for development of new cultivars of Cymbopogons as a sourceof terpene chemicals. In: Handa, S.S., Kaul, M.K. (Eds.), Supplement toCultivation and Utilization of Aromatic Plants. National Institute of ScienceCommunication, Dr. KS. Krishnan Marg, New Delhi, India, pp. 71–83.

Rohlf, F.J., 2000. NTSYS-pc: Numerical Taxonomy and Multivariate Analysis SystemVersion 2.1. Exeter Software, Setauket, NY.

Saikia, D., Sukriti, D., Sneha, G., Mohan, L., Bhau, B.S., 2015. RAPD and ISSR basedintra-specific molecular genetic diversity analysis of Cymbopogon flexuosus L.Stapf with a distinct correlation of morpho-chemical observations. Res. J.Biotechol. 10, 105–113.

Satish, L., Shilpha, J., Pandian, S., Rency, A.S., Rathinapriya, P., Ceasar, S.A., Largia,M.J.V., Kumar, A.A., Ramesh, M., 2015. Analysis of genetic variation in sorghum(Sorghum bicolour L. Moench) genotypes with various agronomical traits usingSPAR methods. Gene 576, 581–585.

Shasany, A.K., Lal, R.K., Patra, N.K., Darokar, M.P., Garg, A., Kumar, S., Khanuja, S.P.S.,2000. Phenotypic and RAPD diversity among Cymbopogon winterianus Jowittaccession in relation to Cymbopogon nardus Rendle. Genrt. Resour. Crop Evol.47, 553–559.

Slatkin, M., 1987. Gene flow and geographic structure of natural populations.Science 236, 787–792.

Tripathi, P., Singh, A., 2014. Identification of Cymbopogon species by using RAPDtechnique. World J. Pharm. Res. 3, 2004–2012.

Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990. DNApolymorphisms amplified by arbitrary primers are useful as genetic markers.Nucleic Acids Res. 18, 6531–6535.

Xia, T., Chen, S., Chen, S., Zhang, D., Zhang, D., Gao, Q., Ge, X., 2007. ISSR analysis ofgenetic diversity of the Qinghai-Tibet Plateau endemic Rhodiolachrysanthemifolia (Crassulaceae). Biochem. Syst. Ecol. 35, 209–214.

Yeh, F.C., Yang, R.C., Boyle, T., 2000. POPGENE 1.32: A Free Program for the Analysisof Genetic Variation Among and within Populations Using Co-Dominant andDominant Markers. Dept. of Ren. Res, Uni., Alberta, Canada.

Yook, M.J., Lim, S.H., Song, J.S., Kim, J.W., Zhang, C.J., Lee, E.J., Ibaragi, Y., Lee, G.J.,Nah, G., Kim, D.S., 2014. Assessment of genetic diversity of Korean Miscanthususing morphological traits and molecular markers. Biomed. Bioeng. 66, 81–92.

Zheljazkov, V.D., Cantrell, C.L., Astatkie, T., Canon, J.B., 2011. Lemongrass

productivity, oil content and composition as a function of nitrogen sulfur, andharvest time. Agron. J. 103, 805–812.

Zietkiewicz, E., Rafalski, A., Labuda, D., 1994. Genome fingerprinting by simplesequence repeat (SSR)-anchored polymerase chain reaction amplification.Genomics 20, 176–783.

http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0050http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0055http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0060dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195dx.doi.org/10.1371/journal.pone.0139195http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0070http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0075http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0080http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0085http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0090http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0095http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0100http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0105http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0110http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0115http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0120http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0125http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0130http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0135http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0140http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0145http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0150http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0155http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0160http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0165http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0170http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0175http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0180http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185http://refhub.elsevier.com/S0926-6690(16)30702-6/sbref0185

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具

http://www.xuebalib.com/cloud/http://www.xuebalib.com/http://www.xuebalib.com/cloud/http://www.xuebalib.com/http://www.xuebalib.com/vip.htmlhttp://www.xuebalib.com/db.phphttp://www.xuebalib.com/zixun/2014-08-15/44.htmlhttp://www.xuebalib.com/

Genetic diversity study amongst Cymbopogon species from NE-India using RAPD and ISSR markers1 Introduction2 Materials and methods2.1 Plant materials2.2 Genetic diversity using RAPD and ISSR marker2.2.1 DNA extraction2.2.2 RAPD and ISSR analysis2.2.3 Statistical analysis

3 Results3.1 Polymorphism revealed by ISSR and RAPD primers3.2 Genetic diversity in Cymbopogon3.3 AMOVA (analysis of molecular variance) analysis3.4 Genetic similarity, cluster analysis and principal coordinate analysis

4 Discussion5 ConclusionAcknowledgementReferences

学霸图书馆link:学霸图书馆