Imperial College London

Department of Chemical Engineering

and Chemical Technology

Biomolecular Approach to the study of

microbial dynamics during biodegradation of

halogenated compounds

A thesis Submitted for the Degree of Doctor of Philosophy of the

University of London and the Diploma of Imperial College

by

Ines Isabel Rodrigues Baptists

January 2008

ABSTRACT

The work presented in this thesis investigates the microbial dynamics of specific bacterial

strains involved in the continuous biodegradation of halogenated compounds under dynamic

substrate loading conditions. The overall aim was the understanding and characterisation of

microbial communities, in terms of their stability, activity and resilience, through the

application of biomolecular techniques.

Initially, the substrates and specific bacterial strains to be studied were selected, and the

biomolecular techniques to monitor the microbial communities were also established. Before

analysing the effect of environmental disturbances on the specific strains and associated

communities, it was considered crucial to firstly describe the evolution of these communities

under constant environmental conditions. These experiments, carried out under non-sterile

conditions, showed that one bacterial strain was stable, even when submitted to a large and

deliberate contamination, while another bacterial strain was out-competed by a better-

adapted strain. This contrasting result was attributed to the way the specific biodegrading

capacity was stored in each strain. Following this initial study under constant conditions, the

previous strains were applied to the treatment of a waste-gas stream contaminated with

halogenated compounds under different dynamic loading conditions. A bioscrubber system

coupled with an oil-absorber column was used as a strategy to buffer sudden changes to inlet

concentration. The outcome benefit of this strategy was the minimisation of pollutant

discharged into the environment. Microbial analysis showed that the oil-absorber had a

positive effect on the community by enhancing its microbial activity, thus improving its

resilience to sudden substrate changes and starvation periods. In addition, these microbial

analyses also revealed that the oil-absorber system maintained a more stable community,

with less changes occurring during the different operating periods.

Overall, the biomolecular characterisation of the bacterial strains studied in this work

contributed to a thorough understanding of the biodegradation processes involving

halogenated compounds, under dynamic feeding scenarios. Ultimately, the information

compiled in this dissertation could provide a basis for the design of more efficient and

reliable biological treatment technologies for the treatment of waste streams with alternating

composition.

This thesis is dedicated to my dear family

For being so supportive and encouraging throughout my PhD

ACKOWLEDGEMENTS

Firstly, I would like to thank my supervisor Prof. Andrew Livingston for the

opportunity he gave me to join his research group, and for his passionate and

rigorous approach to research, which has guided and inspired me throughout my

PhD.

I would also like to acknowledge my co-supervisor Dr. Sakis Mantalaris for his

valuable advice, critical discussions and positive approach towards all my PhD

adversities.

I have enjoyed working with Emma, Michalis, Ludmila and Andrea, and really

appreciated all their help and advice during my experiments. I am also thankful to all

the people at Imperial (Chem Eng and Biochemistry) that helped me with my

research in one-way or another, and to all the guys around the labs for the friendly

environment. I would also like to thank the BIOSAP group for suggestions and

useful discussions regarding my work.

My biggest thank you goes to my dear parents and siblings for their encouragement

and continuous support through all the highs and lows of my PhD. I couldn't have

done it without you!! A big thank you also goes to my friends for always being there

supporting me, even from miles away!

Finally, I would like to acknowledge Fundagao para a Ciencia e Tecnologia and the

European Young Researcher Network - BIOSAP for financial support.

LIST OF PUBLICATIONS

Strain stability in biological systems treating recalcitrant organic compounds.

Emanuelsson EAC, Baptista IIR, Mantalaris A, Livingston AG. 2005. Biotechnology

and Bioengineering 92:843-849.

Stability and performance of Xanthobacter autotrophicus GJIO during 1,2-

dichloroethane biodegradation. Baptista IIR, Peeva L, Zhou N-Y, Leak DJ,

Mantalaris A, Livingston AG. 2006. Applied and Environmental Microbiology

72:4411-4418.

The use of an oil absorber as a strategy to overcome starvation periods in

degrading 1,2-dichloroethane in waste gas. Koutinas M, Baptista IIR, Peeva LG,

Ferreira Jorge RM, Livingston AG. 2007. Biotechnology and Bioengineering

96:673-686.

Evidence of species succession during chlorobenzene biodegradation. Baptista

IIR, Zhou N-Y, Emanuelsson EAC, Peeva LG, Leak DJ, Mantalaris A, Livingston

AG. 2008. Biotechnology and Bioengineering (Spotlight) 99:68-74.

The use of an oil-absorber-bioscrubber system during biodegradation of

sequentially alternating loadings of 1,2-dichloroethane and fluorobenzene in a

waste gas. Koutinas M, Baptista IIR, Meniconi A, Peeva LG, Mantalaris A, Castro

PL, Livingston AG. 2007. Chemical Engineering Science 62:5989-6001.

TABLE OF CONTENTS

ABSTRACT 2

ACKNOWLEDGEMENTS 4

LIST OF PUBLICATIONS 5

TABLE OF CONTENTS 6

LIST OF TABLES 9

LIST OF FIGURES 10

NOMENCLATURE 13

CHAPTER 1 - Introduction

1.1 Background 15

1.1.1 Halogenated organic compounds 15

1.1.2 Treatment technologies 16

1.1.3 Industrial treatment conditions 20

1.1.4 Microbial biodegradation of xenobiotic compounds 22

1.1.5 Biomolecular techniques 23

1.2 Objectives 28

1.3 Research strategy 28

1.4 Thesis structure 29

CHAPTER 2 - Stability and performance of strain Xanthobacter autotrophicus

GJIO degrading 1,2-dichloroethane

2.1 Summary 31

2.2 Introduction 32

2.2.1 Strain stability 32

2.2.2 Fluorescence in situ hybridization: application 34

2.2.3 Denaturing gradient gel electrophoresis: application 38

2.2.4 Model system 42

2.2.5 Objectives 42

2.3 Materials and Methods 43

2.4 Results and Discussion 50

2.4.1 Reactor functional performance 51

2.4.2 Bioreactor microbial dynamics: In situ hybridisation 53

2.4.3 Bioreactor microbial dynamics: Flow Cytometry 57

2.4.4 Bioreactor microbial dynamics: DGGE and sequencing 58

2.5 Conclusions 63

CHAPTER 3 - Species succession during chlorobenzene biodegradation

3.1 Summary 65

3.2 Introduction 66

3.2.1 Species succession 66

3.2.2 FISH: Probe Design 67

3.2.3 Microbial Growth Kinetics 69

3.2.4 Model System 71

3.2.5 Pandoraea Genus 71

3.2.6 Objectives 72

3.3 Materials and Methods 72

3.4 Results and Discussion 77

3.4.1 Reactor functional operation 78

3.4.2 Isolation and identification of a new MCB degrading strain 78

3.4.3 Strain MCB032 detection and quantification by FISH 80

3.4.4 Strain MCB032 identification with DGGE 82

3.4.5 Growth kinetics of strain MCB032 85

3.5 Conclusions 88

CHAPTER 4 - Microbial dynamics during the treatment of waste gas under

sequentially alternating pollutant conditions

4.1 Summary 89

4.2 Introduction 90

4.2.1 Sequentially Alternating Pollutant 90

4.2.2 Oil-Absorber bioscrubber 92

4.2.3 Model system 94

4.2.4 Objectives 96

4.3 Materials and Methods 96

4.4 Results and Discussion 101

4.4.1 FISH optimisation 101

4.4.2 Bioscrubber operation 108

4.4.3 Microbial community analysis 116

4.5 Conclusions 122

CHAPTER 5 - Performance and microbial dynamics of an oil-absorber

bioscrubber degrading chlorobenzene and fluorobenzene

5.1 Summary 124

5.2 Introduction 125

5.2.1 Model System 125

5.2.2 Objectives 125

5.3 Materials and Methods 125

5.4 Results and Discussion 127

5.4.1 Bioscrubber Only performance 129

5.4.2 Oil-Absorber Bioscrubber Performance 132

5.4.3 Comparison between the BO and OAB operation 136

5.4.4 Microbial Dynamics 139

5.5 Conclusions 144

CHAPTER 6 - Conclusions and Future Work

6.1 Summary 145

6.2 Project Overview 145

6.2.1 Stability of strain % autotrophicus sp. GJIO 145

6.2.2 Species succession during MCB biodegradation 146

6.2.3 Study of Sequentially Alternating Pollutant 147

6.3 Project Significance 148

6.3.1 Strain stability and species succession 148

6.3.2 Oil-absorber bioscrubber under SAP 149

6.3.3 Biomolecular techniques 150

6.4 Future Work Directions 151

6.4.1 Microbial Dynamics 151

6.4.2 Biomolecular techniques 151

6.4.3 OAB Applicability 154

REFERENCES 155

APPENDIX A - DNA extraction and sampling optimisation 172

APPENDIX B - Metabolic pathways 174

APPENDIX C - Probe design 177

LIST OF TABLES

CHAPTER 1

Table 1.1 Major advantages and disadvantages of 16S rRNA based

biomolecular techniques

CHAPTER 2

Table 2.1 Examples of common fluorochromes and DNA stains (Thermo Electron Corporation)

Table 2.2 Probes used in Chapter 1

Table 2.3 Schedule of the changes performed during the operation of

the CSTB

Table 2.4 Dice similarity coefficients between DGGE lanes determined

intra and inter stages.

Table 2.5 Assignment of identities to band sequences extracted from

the DGGE gel

CHAPTER 3

Table 3.1 Probes used in chapter 3

Table 3.2 similarity coefficients between DGGE lanes

CHAPTER 4

Table 4.1 Probes used in chapter 4

Table 4.2 Pre-treatments used in the hybridisation of strain GPl

CHAPTER 5

Table 5.1 Experimental schedule

Table 5.2 Similarity matrix with the Dice similarity coefficients

APPENDIX

Table A1 Description of the lyses methods tested for DNA extraction

LIST OF FIGURES

CHAPTER 1

Figure 1.1 Schemes of Biofilter, Biotrickling filter and Bioscrubber

waste gas treatment configurations (Adapted firom Edwards

and Nirmalakhandan, 1996)

CHAPTER 2

Figure 2.1 Fluorescent in situ hybridisation procedure steps (adapted

from Sanz and Kochling, 2007)

Figure 2.2 Denaturing gradient gel electrophoresis procedure steps

(modified from Sanz and Kochling, 2007)

Figure 2.3 Scheme of the CSTR set-up

Figure 2.4 Bioreactor functional performance

Figure 2.5 Bioreactor microbial dynamics

Figure 2.6 Micrographs of FISH-hybridized bacteria

Figure 2.7 DGGE profile of bacterial samples collected throughout the

different stages of operation.

CHAPTER 3

Figure 3.1 Scheme of the CSTR set-up

Figure 3.2 Chloride balance observed in the MCB degrading bioreactor

Figure 3.3 Phylogenetic tree with Pandoraea pnomenusa strain MCB032

and its closest relatives

Figure 3.4 FISH protocol optimisation for strain MCB032

Figure 3.5 FISH analysis in samples collected from the MCB bioreactor

Figure 3.6 DGGE analysis in samples collected from the MCB bioreactor

Figure 3.7 A typical growth curve for strain MCB032 at a MCB

10

concentration of 32 mg L'̂

Figure 3.8 Linear regression of the exponential area highlighted in figure

3.7.

Figure 3.9 Growth kinetics of strains MCB032 and JS150 on MCB

CHAPTER 4

Figure 4.1 Schematic of the oil-absorber bioscrubber set-up

Figure 4.2 HCl pre-treatment of GPl cells

Figure 4.3 Lysozyme pre-treatment of GPl cells.

Figure 4.4 Lipase and proteinase k pre-treatment of GP1 cells

Figure 4.5 Lipase and proteinase k pre-treatment of GJIO cells.

Figure 4.6 Evolution of the FB and DCE loadings during OAB (left

column) and BO operation (right column).

Figure 4.7 Evolution of the fluoride and chloride release during BO

operation.

Figure 4.8 Evolution of the fluoride and chloride release during OAB

operation.

Figure 4.9 Evolution of the total organic mass discharged (TOD) during

the different periods under both configurations.

Figure 4.10 Evolution of strains GJIO and F11 during the different periods

of operation.

Figure 4.11 FISH analysis of the microbial community in the bioscrubber.

Figure 4.12 Evolution of the community activity during the different

periods of operation.

CHAPTER 5

Figure 5.1 Evolution of the MCB and FB loads during BO operation

Figure 5.2 Evolution of the carbon dioxide released during the operation

under both configurations

Figure 5.3 Evolution of the fluoride and chloride release during BO

operation.

Figure 5.4 Evolution of the MCB and FB loads during OAB operation

Figure 5.5 Evolution of the fluoride and chloride release during OAB

11

operation

Figure 5.6 Evolution of the TOC released during operation under BO and

OAB configurations

Figure 5.7 Evolution of the TOD released of each substrate during the

operation under both configurations

Figure 5.8 DGGE profile of the PCR-amplified 16S rDNA gene

extracted from the bacterial community throughout the

different periods of operation

Figure 5.9 Comparative dissimilarity (1-Dc) between operating periods

with OAB and BO configurations

Figure 5.10 Evolution of active cells during the different periods with

OAB and BO configurations

APPENDIX

A1 Comparative DGGE analysis of the different DNA-extraction

methods

A2 Analysis of duplicate samples collected firom bioreactors

B1 Degradation pathway of 1,2-dichloroethane by X.

autotrophicus sp. strain GJIO (Ploeg et al., 1994)

B2 Metabolic pathway of 1,2-dibromoethane by strain

Mycobacterium sp. strain GPl (Poelarens et al., 2000)

B3 Metabolic pathway of monochlorobenzene by Burkholderia

sp. strain JS150 (Nishino et al., 1992)

B4 Metabolic pathway of fiuorobenzene by Rhyzobiales sp. strain

F l l (Carvalho et al., 2006b).

12

NOMENCLATURE

Abbreviations

3CB 3-chlorobenzoate

4FC 4-fluorocatechol

A Adenine

bp Base pairs

BTT Biological treatment technologies

C Cytosine

ARDRA Amplified ribosomal DNA restriction analysis

BTT Biological treatment technologies

BO Bioscrubber only

CSTR Continuous stirred tank reactor

Cy3 bis-succinimidyl-ester

DAPI 4',6-diamidino-2-phenylindole

DBE 1,2-dibromoethane

Dc Dice similarity coefficient

DCE 1,2-dichloroethane

DGGE Denaturing gradient gel electrophoresis

DNA Deoxyribonucleic acid

Ds Dissimilarity

FC Flow cytometry

FISH Fluorescence in situ hybridization

FITC Fluorescein isothiocyanate

FB Fluorobenzene

G Guanine

HOC Halogenated organic compound

Ks Substrate saturation constant

MCB Monochlorobenzene

NCBI National center for biotechnology information

OAB Oil-absorber bioscrubber

OD Optical Density

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PI Propidium iodide

RDP-II Ribosomal database project II

RE Removal efficiency

RISA rDNA interspace spacer analysis

13

rRNA Ribosomal ribonucleic acid

S Substrate concentration

Sm Substrate inhibitory concentration

SAP Sequentially alternating pollutants

Ss Specific staining

SSCP Single strand conformation polymorphism

t Time

T Thiamine

TOC Total organic carbon

TOD Total organic discharge

T-RFLP Terminal restriction firagment length polymorphism

Ts Total staining

V Viability

VOC Volatile organic compounds

X Biomass concentration

Greek letters

fJ'max

Specific growth rate Maximum specific growth rate

14

Chapter 1

CHAPTER 1

Introduction

1.1 BACKGROUND

1.1.1 Halogenated organic compounds

The halogenated organic compounds (HOC) represent an important class of

chemicals used extensively in industry to produce everyday commodities. More than

3700 HOC have been released from natural sources, such as oceans, volcanoes,

plants, fungi and microrganisms. These mainly contain chlorine and bromine, and a

few contain fluorine and iodine (Gribble, 2003). During the past 75 years a wide

range of HOC were synthesised and their industrial production has intensified

(Eurochlor, 2004). The main applications of HOC are as solvents, pesticides, fuel

additives, plastics, degreasers, and as precursors of many chemicals (Chaudhry and

Chapalamadugu, 1991). Within HOC, 1,2-dichloroethane (DCE) is the most highly

produced, with latest reports indicating a production of over 9 million tons in 2001 in

the USA alone (Anonymous, 2002), making it the fourth largest chemical produced

in the world.

HOC can be divided into three main groups:

• Aliphatics - This group contains short chain substituted organics such as 1,2-

dichloroethane (DCE) and chlorofluorcarbons (CFC's);

• Polycyclics - This group includes cyclic organics such as polychlorinated

biphenyls (PCBs);

• Aromatics - This group contains substituted benzenes such as chlorobenzene

(MCB) and Dichloro-Diphenyl-Trichloroethane (DDT).

Regardless of their application, a fraction of these chemicals is eventually discharged

into the environment. Currently, HOC are among the most common pollutants found

in water and soils (De Wildeman and Verstraete, 2003). The unique chemical and

physical properties of these compounds, such as persistency and toxicity, raise

15

Chapter 1

serious environmental and health concerns. Most of these compounds are classified

as xenobiotic, meaning that they are of synthetic origin and thus foreign to living

organisms (lUPAC, 2007). This can prevent the natural biodegradation of HOC from

occurring rapidly, resulting in adverse effects to the environment that can last for

decades. Classical examples of these long-term effects are: the ozone layer depletion

caused by CFC's released into the atmosphere; poisoning of wild life through

biological magnification, and an increased risk of cancer caused by the pesticide

DDT. Many HOC are suspected carcinogens and several of these figure in the

Priority List of Substances of the European and American environmental protection

agencies (Defra, 2007).

Despite the potential damaging affects to the environment, HOC are an important

class of chemicals that provide many of our daily commodities, so their continuous

application and usage is ubiquitous. In order to prevent the release of these

compounds to the environment, efficient emission control measures have to be

implemented to comply with the increasing regulatory pressures. Ideally, the best

practise would be to act at the process level and prevent or minimise the release of

emissions. Some of these actions include: process development and modification,

implementation of the best production technologies, substitution of hazardous

chemicals when possible and leak detection and repair (Penciu and Gavrilescu,

2003). However, when these measures are not enough to prevent emissions, control

methods have to be implemented (end-of-pipe approach).

1.1.2 Treatment technologies

Increasing communal environmental awareness coupled to stringent regulations have

compelled industries to control their pollutant discharges and adopt suitable

treatment technologies. There is a wide range of treatment technologies available to

control pollutant emissions. As a result of industrial activity, HOC can be found in

wastewaters but they are more commonly found in waste gas streams, as most of

them are volatile organic compounds (VOC).

Some commonly used technologies applied to waste gas treatment are:

16

Chapter 1

Adsorption - Process where pollutants are transferred from gas streams into

a porous solid phase such as activated carbon and zeolites. The contaminated

gas stream is passed through an adsorbent material, normally in a column,

and the VOCs adhere into the active sites of the adsorbing support, being

retained in the column. A typical activated carbon unit can adsorbe 1 0 - 3 0

% VOC on a weight basis, after which requires regeneration or suitable

disposal. These units are suitable for the treatment of low concentrated VOC

streams (up to 10 ppm), with 90-95 % removal efficiency (Delhomenie and

Heitz, 2005).

Absorption - Consists of the transfer of pollutants from gas streams to a

liquid phase such as water and amines. The treatment units normally consist

of a packed column where the gas stream is introduced in the bottom, and a

liquid stream flows in counter current absorbing the VOC. The efficiency of

this process depends on the solubility of the gas in the liquid phase, the

mixing provided by the packing, the column residence time and pollutant

concentration. The absorbers can operate with VOC concentrations ranging

from 500 - 5000 ppm with removal efficiencies of 90 - 95 % (van der

Braken, 2001). However, the remaining concenfrated liquid sfream requires

fiirther treatment, such as desorption and VOC recycle or incineration.

Membrane separation - Selective separation of gas mixtures through semi-

permeable membranes made of polymers, silicon or ceramics. The

membrane units normally consist of spiral-wound modules, which material is

permeable to VOC but relatively impermeable to air. This process has a great

VOC recovery potential, however the energy requirements are high, due to

necessary high pressures, and the membranes generally have a short life.

This technology can treat streams containing 50 - 100 ppm of VOC,

concentrating the VOCs to 50 - 98% of their initial concentrations.

Incineration - Consists of the thermal oxidation of pollutants at

temperatures higher than 1000 °C. The waste streams are introduced into an

incineration chamber and all the VOCs are virtually destroyed. These

17

Chapter 1

incinerators are indicated for the treatment of highly concentrated streams,

VOC concentrations from 100 - 2000 ppm, and provide 95 - 99 % removal

efficiencies. The units can offer thermal energy recovery, contributing to an

overall operating cost reduction. However, this technology requires close

monitoring to prevent the formation of by-products, such as nitrogen oxides

and dioxins, which are very toxic.

• Biological treatment technologies (BTT) - Biocatalytic oxidation of the

pollutants by the action of microrganisms and fungi. The waste streams need

to be humidified or transferred into a liquid media first, and then passed

through a column or bioreactor containing biomass where the VOCs are

oxidised to carbon dioxide and water. This process presents the major

advantage that it does not require additional post-treatments or disposal. The

VOC conversions that can be achieved with BTT are 80 - 95 %. The three

main BTT units will be discussed in more detail below.

In this dissertation, the focus will be placed on the operation of BTT for the

treatment of HOC. Despite being more easily controlled, conventional physical and

chemical treatment solutions tend to be more costly when compared to BTT

(Delhomenie and Heitz, 2005). Furthermore, these solutions create an additional

concern as the pollutants are transformed or concentrated, and still require

appropriate disposal or further processing. The principle advantages attributed to

BTT are: (i) low capital and operating costs, with low energy requirements, (ii)

production of innocuous by-products, and (iii) accepted as an environmentally

friendly option by the public and regulators (Edwards and Nirmalakhandan, 1996).

For the treatment of waste gas, the most widely applied BBT are (Figure 1.1):

• Biofilter - consists of a packed bed filled with either compost, plastic media,

activated carbon, or ceramic media, where immobilized cells are attached

(Yeom and Daugulis, 2000). The waste gas stream is humidified prior to

entering the column, and requires good distribution through the packed

material to ensure good pollutant removal;

18

Chapter 1

Clean Air

Contaminated air

Water and nutrients

B i o f i l t e r

Water and nutrients

Clean Air •

Contaminated air

Biotrickling Filter

Clean Air

Contact unit

Bioreactor

• Li qui d

Water and nutrients

A Contaminated

air

Bioscrubber

Figure 1.1. Schemes of Biofilter, Biotrickling filter and Bioscrubber waste gas

treatment configurations (Adapted from Edwards and Nirmalakhandan, 1996).

• Biotrickling filter - has a similar configuration to the biofilter, with the

exception that moisture is sprinkled onto the top of the filter media, which

comes from a separate recirculation unit that provides control of nutrients and

pH. The packing material requires a higher porosity to allow air and liquid

streams to pass through the column (Edwards and Nirmalakhandan, 1996);

19

Chapter 1

• Bioscrubber - is different from the two configurations above. It normally

contains two interconnected units, a contacting column and a bioreactor. In

the first unit the pollutants in the waste gas are transferred into a continuous

liquid phase, by bubbling the air through a liquid. This liquid phase is

transported to an aerated bioreactor unit where biodegradation occurs

(Delhomenie and Heitz, 2005). Alternatively, the gas stream can also be

sparged directly into the bioreactor, although high pollutant concentrations

can inhibit bacterial activity.

The biofilter is the simplest technology, and involves lower capital costs

(Delhomenie and Heitz, 2005). However, it provides poor control of nutrients and pH

in the packed bed, and channels can be formed in the support material, which results

in poor pollutant removal (Yeom and Daugulis, 2000). Thus, this technology is only

recommended for low pollutant concentrations. The biotrickling filter is an improved

version of the biofilter, which provides better control of nutrient and pH in the media

as it contains a separate recirculation unit. This configuration allows the treatment of

higher pollutant concentrations, but also produces more biomass that can eventually

clog the packing material and compromise the removal efficiency. The bioscrubber

affords better process control than the other two configurations, and is suitable for

the treatment of highly contaminated waste gas. However, mass transfer limitations

may occur between the waste gas and the liquid media, which can diminish pollutant

removal (Koutinas et al., 2005). High biomass concentrations can introduce oxygen

limitations in the system, which can be overcome by supplying more oxygen,

although this incurs in higher treatment costs.

1.1.3 Industrial treatment conditions

The overall performance of BTT is generally decreased when exposed to dynamic

conditions, such as environmental disturbances or changes in waste composition

(Freschl et al., 1991; Goodal et al. 1997). Unfortunately, these conditions correspond

to industrial treatment reality, and can lead to instability or inhibition of microbial

cultures. This is undesirable since the biological treatment could be compromised

until the stability of the system is re-established.

20

Chapter 1

The main limitations and problems affecting industrial BTT are the following:

• Recalcitrance of many organic compounds prevents their immediate

degradation and can only be achieved by the application of specialised

bacterial strains (Pieper and Reineke, 2000);

• Mixture of waste streams with other occasional chemicals used on site can be

toxic for bacterial cultures (Emanuelsson, 2004);

• Batch processes typically produce waste streams with fluctuating loads that

can inhibit microbial activity (Cai et al., 2006; Kim et al., 2005; La Para et

al., 2002);

• Production of different compounds in the same industrial process may

generate waste streams with different compositions, which can also lead to

microbial inhibition (Ferreira Jorge and Livingston, 2000a; Ferschl et al.,

1991); a situation generally referred to as sequentially alternating pollutants

(SAP).

One strategy used industrially to minimise the environmental impact is to implement

treatment technologies at the exact point source of emission, thus preventing dilution

and contamination of large volumes of waste fluids. This approach is particularly

important in the case of toxic compounds, as in this way they can be treated

separately in a dedicated treatment unit. However, these BTT applied to point source

are more likely to be affected by waste streams with fluctuating loads and SAP

resulting from batch processes.

Microrganisms are sensitive to variations, so it is difficult to achieve an efficient

treatment when operating under fluctuating and variable waste production regimes

(Freschl et al., 1991). Treatment failure can have serious environmental

consequences and disrupt industrial processes. In order to prevent bacterial inhibition

under these dynamic conditions, it is important to develop strategies to enhance BTT

efficiency and process stability. Different approaches have been developed to buffer

inlet concentrations into BTT and minimise the inhibitory effects of high pollutant

loads on microbial communities. These strategies include application of immobilized

cells in aerobic granules (Jiang et al., 2004), granular activated carbon as adsorbents

21

Chapter 1

(Carvalho et al., 2006a), and organic solvents as absorbents (Oliveira and Livingston,

2003). The latter approach will be investigated later in this thesis as a solution for the

treatment of SAP waste gas streams.

1.1.4 Microbial biodegradation of xenobiotic compounds

Over the last 50 years industry has produced and synthesised many products that are

new to microrganisms. Some of these compounds are xenobiotic and their biological

degradation is difficult to achieve (Pieper and Reineke, 2000). However,

microrganisms have a great capacity for adaptation, and the exposure to new

compounds constitutes an opportunity for the microrganisms to evolve their

metabolic pathways and develop the ability to utilize new substrates (Brock, 1997).

The evolution of catabolic pathways can be achieved by mutation in the genes, or by

acquisition of novel genes. Horizontal gene transfer (gene transference between

different bacteria) plays an important role in the evolution of catabolic pathways

(Top et al. 2002; Poelarends et al. 2000). Genes that encode for the degradation of

xenobiotic compounds are often encoded in mobile genetic elements such as

plasmids. This genetic material can be disseminated into other bacteria through: (i)

conjugation, (ii) transformation and (iii) transduction. Transformation is the uptake

of free DNA segments into the bacteria and transduction is DNA transfer via

bacteriophages (van Limbergen et al. 1998). These two methods have a limited

contribution to genetic material exchange when compared to conjugation, which can

occur even between gram-positive and gram-negative bacteria. In this case, the

genetic dissemination occurs when two bacteria physically contact and form a pore

through which the plasmids or DNA segments are exchanged. This is the most

common route microrganisms use to acquire the ability to degrade new recalcitrant

substrates.

Microbial growth on HOC requires the production of catabolic enzymes that cleave

the carbon-halogen bonds, commonly known as dehalogenases. These enzymes are

not widely distributed in nature and only a limited number of bacterial strains,

designated in this dissertation as "specific strains", possess the complete enzymatic

set to completely mineralize HOC (Janssen et al., 1994). Many of these specific

22

Chapter 1

strains can be isolated, through enrichment methods, from indigenous cultures found

at contaminated sites. This was the case of the bacterial cultures studied in this

dissertation: Xanthobacter autotrophicus sp. GJIO, able to degrade 1,2-

dichloroethane (Janssen et al., 1985); Burkholderia sp. JS150, able to degrade

monochlorobenzene (Spain and Nishino, 1987); and Rhizobiales sp. F l l , able to

degrade fluorobenzene (Carvalho et al., 2005). However, the application of specific

strains, isolated under laboratory conditions, in industrial treatment facilities is a hard

task to achieve. The stability of these strains can be affected by environmental and

functional parameters (described in section 1.1.3), as well as by the presence of other

competitive species. Furthermore, some recent studies have revealed that even under

constant functional conditions, bioreactors can harbour highly dynamic communities

(Fernandez et al., 1999; Zumstein et al., 2000). Therefore, in order to develop

strategies to improve the efficiency of BTT, a thorough knowledge of strain

dynamics is required to reveal factors and conditions that could influence culture

stability.

1.1.5 Biomolecular techniques

Classical culture techniques have a valuable and important role in microbiology,

such as the isolation of many microrganisms. However, it has been shown that

culture-dependent methods are species selective, and do not provide an accurate

picture of the overall community composition (Wagner et al., 1993). The

development of reliable and easy to use biomolecular techniques has enabled

engineers to gain insight into microbial communities and prompted the study of

microbial dynamics within bioreactors (Briones and Raskin, 2003). The major

advantages of biomolecular techniques compared to the classical culture-dependent

methods are:

• Identification of bacterial strains is based on their genotype and not on their

phenotype or morphology. This allows an accurate identification of bacterial

strains and permits differentiation between closely related strains;

• Detection of many uncultivable bacterial strains that also play an important

role in microbial communities (Amann et al., 1995);

23

Chapter 1

• Identification of different strains can be achieved quickly when compared to

the usual 2-3 days that colonies take to develop;

• Insight into physiologic state of the bacterial strains can be obtained.

Most of these techniques are based on the 16S rRNA, targeting it directly or using its

gene sequence (rDNA). The properties that make the 16S rRNA such a popular

target to study microbial communities are:

• It is present in relatively high amounts in all microrganisms (each cell

contains around 10,000 ribosomes), making it ideal for direct analysis using

specific probes (Head et al. 1998; Lipski et al. 2001);

• This molecule comprises highly conserved regions, which is useful for

universal primer application, and also interspersed variable regions, which

contain enough genetic information to allow for a good differentiation

between closely related species (Olsen et al. 1986; Woese et al., 1977);

• The wealth of sequences deposited in online databases; for instance the

ribosomal database project - RDPII holds 351,796 sequences (Cole et al.,

2005). This allows comparative sequence analysis, specific probe design, and

phylogenetic identity assessment (Amann and Ludwig, 2000).

These culture-independent techniques can be divided into two groups targeting: (i)

the 16S rRNA in ribosomes (ii) the 16S rDNA gene. The first group includes

fluorescence in situ hybridization, which can be a quantitative technique allowing the

specific detection of species of interest (Amann et al. 1995; Lipski et al. 2001). The

second group based on nucleic acid fingerprinting, includes techniques such as

denaturing gradient gel electrophoresis and single stranded conformation

polymorphism, which provide an overall picture of the bacterial community diversity

and changes occurring over time (Delbes, et al. 2001; Muyzer et al., 1993). This last

group requires DNA amplification through Polymerase Chain Reaction before

analysis. A description of the biomolecular techniques most commonly applied in

environmental studies is presented below.

Fluorescence in situ hybridization (FISH) - This is a 16S rRNA targeted tool that

uses fluorescent-labelled oligonucleotide probes to identify and detect microrganisms

24

Chapter 1

at different phylogenetic levels. The combined use of universal and strain specific

probes can provide an accurate quantification of the strains of interest within a

community. The principle of this technique is based on the attachment of a

fluorescent oligonucleotide probe, which consists of a segment of approximately 20

nucleotides, to the cell's rRNA complementary sequence (Head et al. 1998; Amann,

et al. 2000). The fluorescence signal can be detected with an epifluorescence

microscope. A detailed description of this technique is presented in section 2.2.2.

Polymerase Chain Reaction (PGR) - This is a powerful technique that

exponentially amplifies specific DNA molecules for different biomolecular

applications, such as fingerprinting techniques (Briones and Raskin, 2003). It

explores the same principle as in DNA synthesis, thus requiring a DNA template

sequence, a polymerase enzyme, a set of primers to select the target gene and

deoxyribonucleoside triphosphates (dNTP's) to form the new DNA. PGR is

dependent on primers for specificity and the thermostable polymerase, isolated fi'om

Thermophilus aquaticus, that allows the different steps of the process to occur

consecutively at different tempeatures (Kleppe et al., 1971). Each PGR cycle can be

divided into 3 steps, with the following general characteristics:

• DNA denaturation: The DNA strands are separated at 95 °G for 1 minute;

• Annealing of primers: the primers hybridise with the single stranded DNA

sequence at 50-65 °G (temperature depends on primers melting temperature)

for 1 minute;

• Sequence extension: the polymerase enzyme links the dNTP's to form a new

DNA sequence at 72 °G for 2 minutes.

A typical 30-cycle reaction can amplify a single DNA molecule to produce billions

of copies in less than 3 hours.

Denaturing gradient gel electrophoresis (DGGE) - A DNA fingerprint technique

used to study complex communities. The DNA extracted from environmental

samples is PGR-amplified (16S rRNA gene), thus generating DNA sequences with

the same size but different composition. The PGR products are separated by

electrophoresis in a polyacrylamide gel with a denaturing gradient. Depending on

their melting temperature, the DNA fragments migrate in a specific pattern

25

Chapter 1

producing different bands, each typically corresponding to a different species. This

analysis provides an overall view of community diversity and any population shifts.

A detailed description of this technique is presented in section 2.2.3.

Terminal-restriction fragment length polymorphism (T-RFLT) - This technique

relies on the differences in restriction behaviour of DNA sequences from different

microbial species. It is PGR based, however one of the primers used to amplify the

16S gene contains a fluorescent label. The PGR products are digested with restriction

enzymes and, given that different species have different sequences, the segments

originated will have different lengths. The terminal segments, which are

fluorescently labelled, are normally run through a DNA analyser and distinguished

by laser-induced fluorescence detection, but can also be separated by gel

electrophoresis (Dorigo et al., 2005).

Amplified ribosomal rDNA restriction analysis (ARDRA) - This technique is

similar to the T-RFLT as the PGR products are also digested by restriction enzymes.

However in this case, all the restriction fragments are separated in a non-denaturing

polyacrylamide gel, generating a restriction pattern for the whole community. This

technique requires extensive sequencing and previous knowledge of the dominant

species to recognize the different band patterns.

Single stranded conformation polymorphism (SSCP) - This technique detects

sequence variations of single stranded DNA within a community. Each single

stranded DNA molecule folds into a unique secondary conformation according to

their nucleotide sequence and the physicochemical environment (Schweiger and

Tebbe, 1998). After PGR-amplification the DNA strands are separated by heating the

sample at 94 °G and then are separated according to their conformation in a

polyacrylamide gel.

rDNA internal spacer analysis (RISA) - This technique explores the differences of

the DNA gene region between the 23S and 16S. This spacer is unique for each

species and differs in length and base pair sequence. Thus, the PGR-amplification

26

Chapter 1

products can be separated by non-denaturing polyacrylamide gel electrophoresis

(Garcia-Martinez et al., 1999).

Table 1.1. Major advantages and disadvantages of 16S rRNA based biomolecular

techniques

Method References Advantages Disadvantages

FISH

Amann et al., 1995; Manz et

al., 1994;

Quantitative method; Affordable technique that requires basic equipment

Tedious analysis and quantification;

DGGE Muyzer et al., 1993; Gillan et

al,1998

Profiling of complex communities; High sample

throughput

Affected by DNA extraction and PGR biases;

T-RFLT Lui et al, 1997 Automated analysis using fluorescent primers and a

DNA analyser

Requires expensive and specific equipment

ARDRA Fernandez et

al,1999 Long DNA sequences can

be analysed Not indicated for complex

communities

SSCP Zummstein et

al., 2000 Simple procedure that

requires basic equipment Difficult separation of longer DNA sequences

RISA Von Canstein

et al., 2001 Highly sensitive method Lack of database for comparative analysis

The power and versatility of these biomolecular techniques is remarkable. However,

in order to generate a faithful picture of the microbial communities, several pitfalls

and biases associated with these techniques have to be addressed. Without careful

consideration, factors such as; sampling, DNA extraction, PGR reaction, and the

technique itself, can consecutively introduce species selectivity (Dahllof, 2002). A

summary of the major advantages and disadvantages of the biomolecular techniques

described is presented in Table 1.1. In this dissertation, FISH and DGGE were

selected to study the microbial communities in the bioreactor systems operated.

These will be discussed in further detail in chapter 2.

27

Chapter 1

1.2 OBJECTIVES

Dynamic waste production regimes, commonly encountered in industry, undoubtedly

affect BTT performance. In order to withstand this situation, strategies to enhance

treatment efficiency have to be developed together with a comprehensive insight into

microbial dynamics. The overall aim of this dissertation is to investigate the

dynamics of specific bacterial strains, responsible for the biodegradation of selected

HOC, in non-sterile bioreactor configurations exposed to different functional

conditions. The novelty explored in this thesis relies in the application of

biomolecular techniques to specifically monitor bacterial strains within biodegrading

communities exposed to sequentially alternating pollutant (SAP) scenarios.

Within this overall aim, the specific objectives of this study are to:

1. Optimise biomolecular techniques to quantify specific HOC degraders and to

characterise the overall community composition;

2. Analyse the stability and performance of the individual HOC degrading strains

under long-term constant operating conditions;

3. Investigate the dynamics of the specific degraders and overall community during

bioreactor operation under SAP treatment scenarios;

4. Interpret microbial community changes in light of functional perturbations in the

bioreactor systems;

5. A final objective of this dissertation is to generate engineering insights useful to

eventual scale up and operation of improved BTT.

1.3 RESEARCH STRATEGY

The research strategy established to accomplish the objectives stated above was as

follows:

• A group of HOC with potential industrial interest, for which complete

microbial degradation has been described, was selected. These contained

different halogens so that their combined biodegradation could be easily

monitored.

• FISH was the biomolecular technique selected and optimised to quantify the

specific HOC degraders and determine the community activity.

28

Chapter 1

DGGE was also applied in combination with FISH to monitor the overall

community dynamics and detect significant community shifts.

Before estimating the effect of environmental disturbances on the HOC

degrading strains, the evolution of these strains and their associated

communities was investigated under stable environmental conditions. This

long-term stability was tested in continuous stirred tank bioreactors (CSTR)

under constant non-sterile conditions. The behaviour of these strains was

monitored with FISH and DGGE to assess whether any changes would occur

during the continuous biodegradation. Functional changes, such as a

deliberate contamination, were later introduced to study their effect on the

bacterial strains.

The specific bacterial strains that exhibited a stable behaviour in previous

experiments, were applied in a bioscrubber system removing two HOC under

SAP conditions. Two different system configurations were tested and

compared under identical functional conditions, one containing an oil-

absorber unit or another comprising the bioscrubber only. The microbial

dynamics of the individual strains and overall community were investigated

in both systems, and collectively examined with the functional performance.

1.4 THESIS STRUCTURE

This thesis is divided in six chapters, each containing the following sections:

summary, introduction, materials and methods, results and discussion, and

conclusions. Chapter 2 addresses the stability of a specific bacterial strain able to

degrade 1,2-dichloroethane (DCE), under constant operation and also under some

functional perturbations: nitrogen limitation and addition of glucose as a co-

substrate. Chapter 3 investigates the succession between two monochlorobenzene

degraders, and analyses the stability of the predominant degrader. The isolation and

characterization of a new chlorobenzene degrader is also reported. Chapter 4 presents

the optimisation and application of FISH to detect two specific strains in a waste-gas

treatment system operating under a SAP feeding scenario. Chapter 5 investigates

community dynamics by DGGE in a similar SAP feeding scenario using a different

29

Chapter 1

model system. Chapter 6 summarises the main conclusions and implications of this

thesis and proposes directions to future work. Appendixes refer to the DNA

extraction and optimisation (Appendix A), metabolic pathways for the aerobic

degradation of 1,2-dichloroethane, monochlorobenzene, fluorobenzene and 1,2-

dibromoethane (Appendix B), and 16S rRNA probe design (Appendix C).

30

Chapter 2

CHAPTER 2

Stability and performance of stvdim.Xanthobacter autotrophicus GJIO

degrading 1,2-dichloroethane

2.1 SUMMARY

The stabiHty of microbial strains is an important issue to be addressed when

developing BTT able to deal with dynamic waste streams. In order to associate

functional perturbations to community changes, the community has to be stable

under constant operating conditions. Otherwise, it would not be reasonable to assume

this cause-effect relation, as the community could change independently of

functional perturbations. In this chapter, the dynamics of a microbial community

dominated by Xanthobacter autotrophicus GJIO, degrading a synthetic wastewater

containing 1,2-dichloroethane (DCE), was investigated. This study was performed

over a 140-day period in a non-sterile continuous stirred tank bioreactor (CSTR),

subjected to different operational regimes: nitrogen limiting conditions, baseline

operation and introduction of glucose as a co-substrate. The microbial community

was analysed by a combination of Fluorescence in situ Hybridization (FISH), and

Denaturing Gradient Gel Electrophoresis (DGGE). Under nitrogen limiting

conditions DCE degradation was restricted (83%) but this did not affect the

dominance of strain GJIO, determined by FISH to comprise 85% of the active

population. During baseline operation, DCE degradation improved significantly to

over 99.5%, and then remained constant throughout the subsequent experimental

period. DGGE profiles revealed a stable, complex community while FISH confirmed

that strain GJIO remained the dominant species. During the addition of glucose as a

co-substrate, DGGE profiles showed a proliferation of other species in the CSTR.

The percentage of strain GJIO dropped to 8% of the active population in just five

days, however this did not affect the DCE biodegradation. The return to baseline

conditions was accompanied by the re-establishment of strain GJIO as the dominant

species. This study demonstrated the stability of strain GJIO under constant

operation, and also revealed its capacity to withstand perturbations both at the

functional and microbial level.

31

Chapter 2

2.2 INTRODUCTION

2.2.1 Strain Stability

The application of specific strains to industrial BTT can be difficult as typical

operating conditions, such as non-sterile long-term operation and dynamic waste

production regimes, can be challenging for microbial communities (Koutinas et al.,

2006; Von Canstein et al., 2001). Previous studies have addressed the effect of

various functional conditions on treatment performance, however mostly neglecting

the dynamics of bacterial communities and how these could influence treatment

efficiency. This black-box approach to BTT disregards the basic understanding of

bacterial dynamics, which is an important factor in BTT optimisation. Within the last

two decades, the introduction of biomolecular techniques to environmental research,

has allowed a more thorough analysis of microbial communities and the

incorporation of this knowledge into BTT development.

Recent studies on the dynamics of microbial communities within bioreactors have

demonstrated that functional stability is not necessarily correlated to community

stability (Fernandez et al., 1999; Kaewpipat and Grady Jr, 2002; Zumstein et al.,

2000). These findings highlight the fact that microbial communities can change and

evolve independently of functional parameters. Fernandez et al. (1999) reported one

of the first studies of microbial dynamics and culture stability in bioreactors. During

a 605 day period, a culture of bacteria and archae was monitored in a well-mixed

methanogenic reactor fed with glucose. Using ARDRA, they were able to

characterize and follow culture evolution. Although the bioreactor performance and

operating conditions were stable during this period (pH, COD and methane

production remained constant), the bacterial population was found to be highly

dynamic, and significant changes were observed in both archae and bacterial

domains. Contradicting previous assumptions, this work has shown that system

stability does not imply community stability. This is an interesting finding since prior

to the availability of biomolecular techniques, the development and modelling of

bioreactors assumed that no major changes occurred in microbial cultures when

operating under constant conditions.

32

Chapter 2

Similar findings were observed by Zumstein et al. (2000) when running a fluidised

bed reactor during a 2 year period, fed with vinasse, under constant operating

conditions (feeding, temperature and pH). The bacterial and archaeal community

dynamics was monitored by SSCP. The gel patterns showed that the archaeal culture

remained relatively stable however, the bacteria domain composition changed

rapidly over time. Another interesting study by Kaewpipat et al. (2002) performed in

lab-scale activated sludge reactors, showed that different communities can be

functionally similar. They inoculated two reactors with the same sludge consortium

and analysed the evolution of the communities with DGGE over a period of 150 days

under constant operating conditions. They found that, although the functional

performance was identical, the communities changed over time and each one evolved

in a different way. This clearly demonstrates that microbial interactions are intrinsic

to a community and occur independently of the functional performance of a

bioreactor.

In contrast, however, other studies performed in full-scale BTT, have reported stable

communities under constant operation (LaPara et al., 2002; Tresse et al., 2002).

Interestingly, Smith et al. (2003) have shown that even a complex community, such

as activated sludge treating a pulp mill effluent, can exhibit stable long-term

behaviour, even when exposed to perturbations at the functional level, such as

shutdown and start-up of a wastewater treatment plant. This study showed a good

correlation between community stability and functional consistency in terms of BOD

removal.

Stability is a contentious issue and different views have been presented. A

particularity of the studies described above is that they are focused on mixed cultures

and have only followed specific phylogenetic groups. Only a very limited number of

studies have looked into the long-term stability of individual species, whose

enzymatic capability is indispensable for treatment success (Carvalho et al., 2006a).

Furthermore, the substrates used in the majority of studies to date are easily

biodegradable (e.g. glucose and vinasse). There is little information on stability of

communities during biodegradation of complex and recalcitrant compounds.

33

Chapter 2

Therefore, it would be interesting to investigate the stability of a specific strain, and

the dynamics of the associated community, degrading a recalcitrant compound. In

point source BTT, in which biodegradation of toxic and/or recalcitrant compounds is

dependent on specific strains, this is an important issue to be addressed, as the

disappearance of one of this strains could lead to treatment disruption. Elucidation of

the stability of specific strains under constant operating conditions is essential before

introducing operating changes in the systems, as it would be impossible to relate

operational changes to community shifts if this community also changed under

constant operational conditions.

2.2.2 Fluorescence in situ Hybridization: application

As discussed in section 1.1.5, FISH is a 16S rRNA targeted tool that uses

fluorescent-labelled oligonucleotide probes to identify and detect microrganisms at

different phylogenetic levels (DeLong et al., 1989).

The probes targeting the rRNA can be divided into general and specific probes,

depending on whether they bind to a common or specific genetic area of the rRNA.

The most usual general probe is the EUB338I (Amann et al., 1990) which binds to all

bacteria, but other probes can be used to specifically target other taxonomic levels,

such as domain, order or family. Strain specific probes can also be used and designed

if the 16S rRNA sequence is known (further details in section 3.3.2). Another general

probe that is used to check the occurrence of non-specific binding is NonEUB338I

(Manz et al. 1992), which is the complementary sequence of the universal probe

EUB338I and thus should not bind to bacterial rRNA.

The overall FISH procedure can be visuahsed in Figure 2.1. The major steps are cell

fixation, hybridization and visualisation. Cell fixation is a procedure conducted to

preserve the cell integrity and prevent nucleic acid loss (Leitch, et al., 1994). This

step is normally introduced when samples are going to be stored for a long time, or

need to be permeated to facilitate probe penetration through the membrane.

However, if cells are going to be analysed directly and there are no permeability

issues, this step can be skipped.

34

Chapter 2

Hybridization is the process whereby the probe penetrates the cell and binds to the

targeted nucleic acid. The fluorescent probes enter the cell through the action of

temperature and a buffer containing formamide. The concentration of formamide and

the temperature of hybridisation influence the stringency of the hybridization and

how specific the probe attachment is. The more stringent the conditions applied, the

more specific the binding should be. Though very stringent conditions can also

prevent specific staining, thus these parameters have to be efficiently optimised. To

certify that the parameters selected are adequate, a negative control should be

performed with nonEUB338 probe (or other non-specific probe) to ensure there is no

non-specific binding. Following hybridization, the sample should be washed under

similar stringent conditions to ensure all probe in excess or partially bonded to rRNA

is removed.

Detection

-̂ 'NaaP-

Fixation

Hybridisation AUCAUUCUUUACGAAGAC I : i I M I I I I i

GCTGCCTCCCGTAGGAGT

COOH

Figure 2.1. Fluorescent in situ hybridisation procedure steps (adapted from Sanz and

Kochling, 2007)

The rRNA probes have a fluorochrome normally attached to the 5' end. These can be

visualised by excitation with light of the appropriate wavelength and using an

appropriate filter to visualise the emitted wavelength (Table 2.1). There are several

35

Chapter 2

fluorochromes available, each with different excitation and emission peaks that can

be visualised in different colours under a microscope. The difference between the

excitation and emission wavelengths of a fluorochrome is defined as the Stokes shift.

Some DNA stains can also be used to counterstain the target microrganism; the most

commonly used is 4',6-diamidino-2-phenylindole (DAPI), which stains all live cells.

Propidium iodide (PI) also binds to DNA, however it cannot cross the cell

membrane, therefore only dead cells with disrupted membranes are stained. Using

these two dyes, it is possible to determine the viability of a cell culture by calculating

the ratio between dead and live cells.

Table 2.1. Examples of common fluorochromes and DNA stains (Thermo Electron

Corporation)

Fluorochrome Wavelength

Colour Fluorochrome Excitation (nm) Emission (nm)

Colour

Fluorescein (FITC) 491 515 Green

Cy3 550 570 Yellow

Texas Red 583 603 Red

DNA Stains

DAPI 355 450 Blue

PI 530 615 Red

The traditional analytical technique applied to detect the fluorescence signal emitted

from hybridised cells is epifluorescence microscopy, although flow cytometry can

also be used (Lipski et al., 2001). Conventional epifluorescence microscopy is the

most common technique used to analyse the FISH signal. These microscopes are

equipped with light sources that can emit light fi-om ultraviolet to infrared, allowing

the detection of a broad range of fluorescent stains. The microscopes are equipped

with a set of different filters, which narrow down the light beam into the specific

wavelength, and a camera that provides digital imaging. A major drawback of this

technique is that it cannot be applied to thick samples, like biofilms. The confocal

laser microscope is an alternative in these cases, since it can take serial pictures of

the sample layers and then combine them to give a 3D image (Lipski et al., 2001).

36

Chapter 2

Flow cytometry (FC) is a rapid analysis technique that allows the counting, sorting

and detection of suspended cells at a rate higher than 10^ cells.s"' (Wallner et al.,

1995; Davey et al. 1996). In FC, cell suspensions are transported in a capillary-sized

tube through a laser beam by a continuous flowing stream (Al-Rubeai and Emery,

1996). The cells scatter some of the laser light generating three different signals:

forward scatter (related to cell size), side scatter (related to cell shape) and

fluorescence. The innovation of this technique lies both in the broad range of cell

parameters that can be determined (up to 11), and also its ability to sort cells,

allowing the selection of a population of interest from a highly diverse community

(Wallner et al., 1997; Winson et al., 2000). FC is a very efficient technique since

thousands of cells can be analysed within seconds. However only suspended cells

can be analysed, which restricts its application to environmental samples (Lipski et

al., 2001).

When compared with microscopy, FC presents the advantages of being automated,

objective and providing fast analysis. However, this technique is also complex and

expensive, usually requiring experienced technicians to operate it (Al-Rubeai and

Emery, 1996). FC has been widely employed in studies with eukaryotic cells, but the

existing environmental microbial studies are limited, primarily because the

prokaryotic cell dimensions are often within the detection limit of the instrument, and

also because these cells usually aggregate (Rieseberg et al., 2001). Even though,

some authors have successfully applied FC using fluorescent 16S rRNA-targeted

probes to characterize an activated sludge and sort specific phylogenetic groups

(Wallner et al., 1995), to discriminate Desulfobacter bacteria from a mixture with E.

coli (Amann et al., 1990), and to quantify uncultured bacteria present in the human

intestine (Zoetendal et al., 2002).

Although FISH has proved to be a valuable tool in the direct identification of

microrganisms, it is a multifaceted method that still has some limitations (Moter et

al., 2000; Wagner et al., 2003). The potential problems inherent to this technique are:

• Limited permeability of cells to probes. Some cells can be very difficult to

permeate, even when using a combination of fixatives and pre-treatments

(Manz et al., 1992; Zarda et al., 1997).

37

Chapter 2

• Difficult probe accessibility. The rRNA exhibits a three-dimensional

conformation, so not all targeted sequences are equally accessible (Fuchs et

al., 2000; Behrens et al. 2003).

• Low signal due to low rRNA content. The rRNA content of a cell varies

according to its activity, so a weaker signal will be attained fi:om less active

cells (Molin et al., 1999; Bouvier et al., 2003).

2.2.3 Denaturing Gradient Gel Electrophoresis: application

This DNA fingerprint technique was recently introduced into microbial ecology by

Muyzer et al. (1993). It allows the study and monitoring of complex communities

over time by DNA profiling. The gene targeted with this technique is also the 16S

rDNA. This gene contains highly conserved areas, which are common to all bacteria,

and also variable areas that contain enough information to differentiate closely

related species. The 16S gene contains nine variable areas (designated as VI to V9),

and the most commonly targeted by DGGE is the V3 area, which corresponds to

position 341 to 518 with reference to the Escherichia coli sequence (Muyzer et al.,

1993).

The procedure to perform DGGE can be visualised in Figure 2.2. The major steps are

DNA extraction, PCR amplification, electrophoresis and sequencing. There are

numerous methods to extract bacterial DNA, which involve a combination of bead

beating, detergents, enzymatic lyses, and solvent extraction (Gillan et al., 1998;

Stach et al., 2001). Most of these methods are time consuming and alternatively,

there are nowadays many commercial kits available that perform this task more

rapidly and as efficiently. Additionally, these kits provide a good method

standardisation, which is critical when extracting DNA regularly over long periods of

time. Regardless of the approach selected, it is difficult to ensure that the DNA

extracted is representative of the whole community, as some cells are more difficult

to lyse than others (Kuske et al., 1998). Furthermore, it has been shown that when

comparing different methods, a high DNA yield does not necessarily correspond to a

higher DNA diversity (Stach et al., 2001). The best way to achieve a good DNA

extraction is by using different approaches and comparing them through

fingerprinting techniques.

38

Chapter 2

DNA Extraction

Wfs

Chapter 2

pairs requires more energy to break rather than the double bond between the adenine

- thiamine (AT) base pairs. Therefore, the GC rich sequences will separate in a

higher denaturing area, while the AT rich sequences require less energy and will

separate in the less stringent part of the gel. Prior to the DGGE analysis, the optimal

conditions for the DNA separation have to be optimised, and these are: the gel

denaturing gradient and the electrophoresis running time (Muyzer et al., 1993). The

stringency of the denaturing gradient is determined by the amount of formamide and

urea contained in the polyacrylamide mixture of the gel, normally expressed as

weight percentage. The concentration of these chemicals changes gradually through

the gel, being higher at the bottom and lower at the top. The chemical gradient

determines the separation of the DNA and normally varies from 35% to 65%. The

traditional dye used to stain the DNA gels is ethidium bromide (EB). However other

stains have been introduced recently, such SYBR Green I and SYBR Gold, that

allow less background staining and thus, the detection of weaker bands. A more

sensitive detection can be achieved by silver staining, however these gels cannot be

used for sequencing purposes (Muyzer and Smalla, 1998). The visualization of the

gels is achieved by irradiating the gel with UV light and acquiring a picture with an

imaging system.

Prominent bands can be excised from the gel for identification. The DNA eluted

fi-om an excised band can be PCR-amplified and prepared for sequencing. The

principle of the current DNA sequencing methods was developed by Sanger et al.

(1977). This method explored the application of a modified version of a deoxyribose

sugar, which has two hydroxil groups removed (dideoxiribose), into the DNA

synthesis. When incorporated into a sequence this molecule is unable to form any

other bonds, thus leading to the sequence termination. Using DNA sequences radio-

labelled at the 5'- end, four separate polymerase reactions are carried out using one

type of dideoxynucleotide and all four normal deoxynucleotides. The resulting four

products contain sequences with different lengths that can be separated by gel

electrophoresis and detected by x-ray imaging. The sequence is then put together

starting from the bottom where the smallest fragment was detected, and determined

based on the column where each band appeared. Nowadays, the polymerase reaction

is performed in one tube using fluorescently-labelled dideoxynucleotides and normal

40

Chapter 2

deoxynucleotides. The separation of the products is performed by capillary

electrophoresis which can be run at high voltages and provide high throughput of

samples. Furthermore, the support polymer can be washed and reused, which allows

the automation of the method (Swerdlow et al , 1991). The fluorescent signal is

detected by laser and interpreted by specific software that delivers the nucleotide

sequence.

In order to assess the phylogenetic identity of a DGGE band, the retrieved DNA

sequence can be inserted into an online database, such as Ribosomal database project

(RDP-II; Cole et al., 2005) or National center for biotechnology information (NICB;

Zhang and Madden, 1997), and compared against all sequences deposited. These

sequences can also be used to design 16S rRNA probes, which can be applied by

FISH to quantify the detected species.

Although DGGE is a valuable tool to profile and analyse complex communities, it

has some constraints and pitfalls. Some of the potential limitations of this technique

are presented below:

• Poor DNA extraction and PGR bias can provide an inaccurate picture of the

overall community diversity (Gillan et al., 1998; Stach et al., 2001);

• Two different species can have similar migrating patterns and be represented

by the same band; while a species containing multiple rrN operons with

sequence heterogeneity can generate 2 or more bands (Haruta et al., 2002;

Muyzer and Smalla, 1998);

• It is a qualitative technique and quantification cannot be inferred from band

intensity (Haruta et al., 2002; Araya et al., 2003);

• Due to the short length on the DNA fragments analysed, it is often not

possible to determine the exact phylogenetic affiliation of a certain band

(Muyzer et al., 1995;).

In this dissertation, FISH and DGGE were the two biomolecular techniques selected

to study the microbial communities in the bioreactor systems operated. The

combination of these two techniques enabled the quantification of the specific strains

41

Chapter 2

involved in the HOC degradation, and provided an overall picture of the community

diversity and evolution over time.

2.2.4 Model System

1,2-dichloroethane (DCE) is a chlorinated organic compound widely used in

industry, mainly for the production of vinyl chloride. It is toxic and potentially

carcinogenic, therefore its emissions have to be controlled following strict

environmental regulations (Public Health Statement: 1,2-dichloroethane, ATSDR).

For these reasons, there is a potential interest in developing technologies able to

tackle waste-gas streams contaminated with DCE. Previous work with this

compound has already been carried out in our research group using strain

Xanthobacter autotrophicus GJIO (Ferreira Jorge and Livingston, 1999; Freitas dos

Santos and Livingston, 1995). This strain was isolated by enrichment in a chemostast

of a mixed culture obtained from a DCE contaminated site (Janssen et al., 1984), and

was the first bacterial isolate able to degrade DCE aerobically. It is characterized as a

rod shape, non-motile, gram-negative, catalase positive, oxidase negative

microrganism that forms small yellow opaque colonies on nutrient agar plates.

Furthermore, it is able to utilize DCE as a sole source of carbon and energy in

concentrations up to 15 mM. The degradation pathway for DCE degradation by

strain GJIO has been elucidated (Janssen et al., 1985), and is presented in Appendix

B.

2.2.5 Objectives

As highlighted previously, there is evidence suggesting that functional stability does

not imply community stability. This is an important issue to be addressed when

developing BTT able to deal with dynamic waste streams. Before studying the

influence of dynamic conditions in bioreactors, the stability of the microbial

populations should be analysed under constant conditions, as it would be impossible

to relate operational changes to community shifts if this community also changed

under constant operational conditions. Therefore, the aim of this chapter was to

investigate whether a single strain degrading a recalcitrant compound under non-

42

Chapter 2

sterile conditions exhibited stable behaviour under constant and dynamic operating

conditions. The response of the microbial community was evaluated in a CSTR

operated under the following conditions: (i) nitrogen limiting conditions, (ii) baseline

operating conditions, (iii) addition of glucose as a co-substrate. FISH and DGGE

were applied to monitor the microbial community and quantify the specific DCE

degrader.

2.3 MATERIALS AND METHODS

2.3.1 Bacteria and growth conditions

Xanthobacter autotrophicus strain GJIO (kindly provided by Prof. D. Janssen from

the University of Groningen, The Netherlands) can utilize DCE as a sole source of

carbon and energy. Strain GJIO was initially grown for 48h in shake flasks at 30 °C

under aerobic conditions. The flasks were tightly closed to prevent DCE evaporation

and filled to one fifth of their capacity with mineral medium (Janssen et al., 1984).

DCE 99% pure (Sigma, UK) was added to a final concentration of 5 mM.

2.3.2 Continuous stirred tank bioreactor (CSTR)

A scheme of the CSTR setup is presented in Figure 2.3. The bioreactor used was a

BioFlo 1000 - New Brunswick Scientific (NJ, USA) with 2.6 L total capacity (20 cm

high and 13 cm diameter), with a working volume of 2.3 L. The CSTR was equipped

with two six-bladed impellers (d = 0.05 m), positioned 0.01 m apart with the lower

impeller placed at 0.03 m above from the bottom of the vessel, and was stirred at 220

rpm. The vessel was fitted with four equally spaced baffles (0.006 m). The pH was

controlled by addition of NaOH (IM) and maintained at 7.00 ± 0.1 throughout the

experiment. The temperature of the biomedium was maintained at 30 °C and the

oxygen saturation was always above 30% (Mettler Toledo Ltd, Leicester, UK). The

bioreactor was inoculated with the GJIO shake flask culture and operated under non-

sterile conditions.

43

Chapter 2

Sterile Air inlet Air outlet

Biomedium

Overflow

£

10 V

= 0 ^ =1

Figure 2.3. Scheme of the CSTR set-up: (1) biomedium, (2) pH probe, (3)

thermocouple, (4) oxygen probe, (5) sampling port, (6) pH controller, (7) IM NaOH

solution, (8) peristaltic pump, (9) mineral medium, (10) DCE synthetic wastewater.

A mineral medium (Janssen et al , 1985) was used at a flow rate of 0.020 L If ' until

day 45 followed by enrichment with 0.5 g L"' of (NH4)2S04 supplied at 0.027 L h"'.

The concentration of DCE in the synthetic wastewater was ca. 3 g L"' and it was

supplied at a flow rate of 0.048 L h"' until day 45 and afterwards at 0.064 L h"'. On

day 109, glucose was added to the synthetic wastewater at a concentration of 2 g L"'

for a period of 13 days.

2.3.3 Analytical Methods

The DCE concentration in the liquid feed and in the CSTR outlet was analyzed using

an Agilent 6850 Series II gas chromatograph (GC; Agilent Technologies,

Wokingham, UK) with a flame ionization detector and a column (30 m x 0.318 mm x

35 pm, J&W Scientific, Agilent Technologies). DCE present in the liquid phase was

analyzed by extracting 8 mL of sample with 2.5 mL of n-Dccane and injecting 1 \xL

into the GC. The starting temperature was 40 °C for 2 min, increased by 20 °C min"'

to 90 °C and then increased by 40 °C min"' to 260 °C. DCE present in the bioreactor

gas outlet was analyzed by directly injecting 25 p,L of sample into the GC. The

44

Chapter 2

temperature was set at 40 °C for 2 min, and increased by 20 °C min"' to 70 °C. The

coefficient of variation was 0.2 % at a concentration of 24 mg L"V The glucose

concentration in the biomedium was analyzed by HPLC (Gilson, UK) with a UV

detector. The samples were centrifuged and filtered through a 0.2 pm filter to

eliminate bacteria and suspended solids. A sample was injected into the column (50

mm X 2.00 mm x 3pm) with a CIS stationary phase (Luna, Phenomenex), and the

mobile phase was water. The glucose concentration was determined based on a

calibration curve. Chloride concentration was analyzed by ion chromatography

(Dionex DX 120, with an lonPAC AS 114 4*250 mm column, Camberley, UK). The

mobile phase was 3.5 mM Na2C03 and 1.0 mM NaHCOa at 1.1 mL min"'. To analyze

the cations, the mobile phase used was 19mM CH4O3S (column lonPac CS12A,

Dionex). The samples were centrifuged and filtered through a 0.2 pm filter to

eliminate bacteria and suspended solids.

The biomass was measured at 660 nm on a UV-Vis spectrophotometer (Unicam,

UK). The absorbance was correlated with dry weight (100 °C over 24h until constant

weight) to determine the actual biomass concentration. Carbon dioxide was

determined using an isothermal GC (GC-14A, Shimadzu, Milton Keynes, UK) fitted

with a thermal conductivity detector. Samples were injected at 128 °C into a Porapak

N column (2 m x 2 mm, Alltech Associates Applied Science Ltd, Camforth, UK)

packed with dininylbenzene/vinyl pyrrodinone at 28 °C. The coefficient of variation

for five samples was 2.6% at a concentration of 0.03% v/v carbon dioxide. Total

organic carbon (TOC) was measured with a Shimadzu 5050 total organic carbon

analyzer. The biomass and any remaining solids were removed from the biomedium

via centrifugation and filtration. The coefficient of variation for three samples was

0.5% at a concentration of 500 gm"^ of carbon.

2.3.4 Plate counting

Samples taken from the biomedium were serially diluted and spread onto nutrient

agar plates (per liter: peptone 5.0 g, beef extract 3.0 g, NaCl 8.0 g, 15 g agar). They

were incubated at 30 °C and emerging colonies were counted for a period of one

week. Colonies of X. autotrophicus GJIO were identified by their characteristic

45

Chapter 2

yellow colour. Plate counts were only performed during the optimisation of the FISH

technique and were ceased on day 70.

2.3.5 Sample collection and preparation for microbial analysis

Samples were collected from the biomedium through the sampling port and washed

in Phosphate-buffered saline (PBS; per liter: 1.040 g of Na2HP04, 0.332 g of

NaH2P04 and 0.754 g of NaCl). The samples were resuspended twice in 1 mL PBS

and 10 jiL of 0.1% (w/w) Igepal (Sigma, UK). Six pL of this cell suspension was

added to each spot of a Teflon coated slide with eight wells (Erie Scientific

Company, USA) coated with a thin layer of gelatin (0.1% (w/v)) and KCr(S04)2

(0.01% (w/v)). After air-drying, the slides were dehydrated in a series of ascending

ethanol concentrations (50, 80 and 100% (v/v)) for three min each step.

2.3.6 Oligonucleotide probes and slide in situ hybridization

The oligonucleotide probes used are listed in Table 2.2 and were labeled at the 5' end

with FITC or Cy3 (Thermo Electron Corporation, Dreieich, Germany). A 9 |a,L

aliquot of hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.1% (v/v) sodium

dodecyl sulphate (SDS), 15% (v/v) of formamide) was placed on each spot. One pL

of specific strain GJIO probe and 1 |j,L (50 ng jJ-L"') of either EUB338I, NonEUB or

ARCH344 probes were applied on each spot. The NonEUB probe was used as a

negative control to test the specificity of hybridization, and the ARCH344 was

occasionally used to assess whether any Archaea were present. The slides were

placed in an equilibrated humidity chamber at 35 °C for 2 h to hybridize. The slides

were thereafter rinsed with distilled water and immersed in a washing buffer (20 mM

Tris-HCl, 0.1% (w/v) SDS, and 0.34 M of NaCl) for 15 min at 50°C, followed by

rinsing with distilled water and air-drying. Before microscopic analysis, 10 pi of

DAPI (Sigma; 1 pg L"') was added to each spot for two minutes. Finally, the slides

were rinsed with distilled water, air dried and mounted with Citifluor (Citifiuor Ltd,

UK). For the viability analysis, 6 pL of cell suspension were added into a slide and

allowed to air dry. Then, 6 |iL of DAPI and PI (Sigma; 0.3 pg L"') were added to

each spot and rinsed after 2 min. The slides were analyzed using a fluorescence

microscope (Olympus BX51, Middlesex, UK) equipped with a digital photographic

46

Chapter 2

camera (Olympus DP 50). Images were acquired using specialized imaging software

(Analysis - Soft Imaging System version 3.2, Helperby, UK).

Table 2.2. Probes used in Chapter 1

Probe Sequence (5'^ 3') Source Fluor'

EUB338I GCT GCC TCC CGT AGO AGT Amann et al., 1990 FITC

NonEUB338 CGA CGG AGO GCA TCC TCA Manz et al., 1992 FITC

GJIO CAC CAA CCT CTC TCG AAC TC Emanuelsson et al., 2005 Cy3

ARCH344 TCG CGC CTG CTG CIC CCC GT Raskin et al., 1994 Cy3

^The fluorochrome modification was attached to the 5'- end of the sequence.

2.3.7 Flow Cytometry

Flow cytometry was performed on an EPICS ALTRA (Beckman Coulter) equipped

with a sorting system (10,000 cells/sec), a Coherent Enterprise II 621 Laser (351-364

nm and 488 nm) and an air-cooled red HeNe Laser (633 nm). Analysis of the results

was accomplished using the EXP02 Cytometry Software. The suspended cells were

analysed with a flow rate between 250-300 particles.s"'. Cell samples were harvested

from the bioreactor into 1.5 mL eppendorf tubes, and then washed in PBS and 0.1%

igepal through a sterile needle (to break the major clumps). For counterstaining

analysis, the cells were stained in PI for 1 min and then rinsed in PBS and

centrifuged 3 times. For liquid in situ hybridisation, the cells were serially

dehydrated by the addition of ImL of ascending ethanol concentrations (50, 80 and

100% (v/v)) for 3 minutes each step and centrifuging in between. A 36 |a,L aliquot of

hybridisation solution (same composition as in 2.3.6), and 2 ^L of probe were added

to each tube. The tubes were then placed to hybridise for 2 h at 45 °C. The tubes

were thereafter centrifiiged and the sample washed for 15 minutes at 45 °C in 0.5 mL

of a washing buffer (same composition as in 2.3.6). Samples were thereafter washed

and resuspended in 0.9 mL PBS and 10 mL of 0.1% igepal. The pre-treatments

applied to the samples consisted in ultrasonicating the samples for 5 to 20 seconds,

and washing the samples up to three times in PBS and igepal through a needle.

47

Chapter 2

2.3.8 DNA extraction and PGR reaction

Bacterial samples harvested from the reactor were washed in sterile PBS. DNA

extraction was performed using the UltraClean Microbial Genomic Isolation Kit

(MoBio, Carlsbad, USA) according to the manufacturer's instructions (see appendix

A for optimisation). The primers (MWG Biotech, Ebersberg, Germany) 518R (5'

ATTACCGCGGCTGCTGG 3') and GC-341F (5' CGCCCGCCG

CGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAG

CAG 3') targeting the V3 region of the 16S rDNA were used for the amplification of

DNA fragments corresponding to bases 341-518 with reference to the Escherichia

coli sequence. The PCR reactions were performed using 1 pL of DNA template and

24 jaL of a PCR mix (3 mM of MgCli, 0.5x NH4SO4 PCR buffer, 0.5x KCl PCR

buffer, 200 of dNTP's, 0.3pM of each primer and 1 U of Taq DNA polymerase

(Fermentas, Lithuania)). The following cycle condi