Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
Imperial College London
Department of Chemical Engineering
and Chemical Technology
Biomolecular Approach to the study of
microbial dynamics during biodegradation of
halogenated compounds
A thesis Submitted for the Degree of Doctor of Philosophy of the
University of London and the Diploma of Imperial College
by
Ines Isabel Rodrigues Baptists
January 2008
ABSTRACT
The work presented in this thesis investigates the microbial dynamics of specific bacterial
strains involved in the continuous biodegradation of halogenated compounds under dynamic
substrate loading conditions. The overall aim was the understanding and characterisation of
microbial communities, in terms of their stability, activity and resilience, through the
application of biomolecular techniques.
Initially, the substrates and specific bacterial strains to be studied were selected, and the
biomolecular techniques to monitor the microbial communities were also established. Before
analysing the effect of environmental disturbances on the specific strains and associated
communities, it was considered crucial to firstly describe the evolution of these communities
under constant environmental conditions. These experiments, carried out under non-sterile
conditions, showed that one bacterial strain was stable, even when submitted to a large and
deliberate contamination, while another bacterial strain was out-competed by a better-
adapted strain. This contrasting result was attributed to the way the specific biodegrading
capacity was stored in each strain. Following this initial study under constant conditions, the
previous strains were applied to the treatment of a waste-gas stream contaminated with
halogenated compounds under different dynamic loading conditions. A bioscrubber system
coupled with an oil-absorber column was used as a strategy to buffer sudden changes to inlet
concentration. The outcome benefit of this strategy was the minimisation of pollutant
discharged into the environment. Microbial analysis showed that the oil-absorber had a
positive effect on the community by enhancing its microbial activity, thus improving its
resilience to sudden substrate changes and starvation periods. In addition, these microbial
analyses also revealed that the oil-absorber system maintained a more stable community,
with less changes occurring during the different operating periods.
Overall, the biomolecular characterisation of the bacterial strains studied in this work
contributed to a thorough understanding of the biodegradation processes involving
halogenated compounds, under dynamic feeding scenarios. Ultimately, the information
compiled in this dissertation could provide a basis for the design of more efficient and
reliable biological treatment technologies for the treatment of waste streams with alternating
composition.
This thesis is dedicated to my dear family
For being so supportive and encouraging throughout my PhD
ACKOWLEDGEMENTS
Firstly, I would like to thank my supervisor Prof. Andrew Livingston for the
opportunity he gave me to join his research group, and for his passionate and
rigorous approach to research, which has guided and inspired me throughout my
PhD.
I would also like to acknowledge my co-supervisor Dr. Sakis Mantalaris for his
valuable advice, critical discussions and positive approach towards all my PhD
adversities.
I have enjoyed working with Emma, Michalis, Ludmila and Andrea, and really
appreciated all their help and advice during my experiments. I am also thankful to all
the people at Imperial (Chem Eng and Biochemistry) that helped me with my
research in one-way or another, and to all the guys around the labs for the friendly
environment. I would also like to thank the BIOSAP group for suggestions and
useful discussions regarding my work.
My biggest thank you goes to my dear parents and siblings for their encouragement
and continuous support through all the highs and lows of my PhD. I couldn't have
done it without you!! A big thank you also goes to my friends for always being there
supporting me, even from miles away!
Finally, I would like to acknowledge Fundagao para a Ciencia e Tecnologia and the
European Young Researcher Network - BIOSAP for financial support.
LIST OF PUBLICATIONS
Strain stability in biological systems treating recalcitrant organic compounds.
Emanuelsson EAC, Baptista IIR, Mantalaris A, Livingston AG. 2005. Biotechnology
and Bioengineering 92:843-849.
Stability and performance of Xanthobacter autotrophicus GJIO during 1,2-
dichloroethane biodegradation. Baptista IIR, Peeva L, Zhou N-Y, Leak DJ,
Mantalaris A, Livingston AG. 2006. Applied and Environmental Microbiology
72:4411-4418.
The use of an oil absorber as a strategy to overcome starvation periods in
degrading 1,2-dichloroethane in waste gas. Koutinas M, Baptista IIR, Peeva LG,
Ferreira Jorge RM, Livingston AG. 2007. Biotechnology and Bioengineering
96:673-686.
Evidence of species succession during chlorobenzene biodegradation. Baptista
IIR, Zhou N-Y, Emanuelsson EAC, Peeva LG, Leak DJ, Mantalaris A, Livingston
AG. 2008. Biotechnology and Bioengineering (Spotlight) 99:68-74.
The use of an oil-absorber-bioscrubber system during biodegradation of
sequentially alternating loadings of 1,2-dichloroethane and fluorobenzene in a
waste gas. Koutinas M, Baptista IIR, Meniconi A, Peeva LG, Mantalaris A, Castro
PL, Livingston AG. 2007. Chemical Engineering Science 62:5989-6001.
TABLE OF CONTENTS
ABSTRACT 2
ACKNOWLEDGEMENTS 4
LIST OF PUBLICATIONS 5
TABLE OF CONTENTS 6
LIST OF TABLES 9
LIST OF FIGURES 10
NOMENCLATURE 13
CHAPTER 1 - Introduction
1.1 Background 15
1.1.1 Halogenated organic compounds 15
1.1.2 Treatment technologies 16
1.1.3 Industrial treatment conditions 20
1.1.4 Microbial biodegradation of xenobiotic compounds 22
1.1.5 Biomolecular techniques 23
1.2 Objectives 28
1.3 Research strategy 28
1.4 Thesis structure 29
CHAPTER 2 - Stability and performance of strain Xanthobacter autotrophicus
GJIO degrading 1,2-dichloroethane
2.1 Summary 31
2.2 Introduction 32
2.2.1 Strain stability 32
2.2.2 Fluorescence in situ hybridization: application 34
2.2.3 Denaturing gradient gel electrophoresis: application 38
2.2.4 Model system 42
2.2.5 Objectives 42
2.3 Materials and Methods 43
2.4 Results and Discussion 50
2.4.1 Reactor functional performance 51
2.4.2 Bioreactor microbial dynamics: In situ hybridisation 53
2.4.3 Bioreactor microbial dynamics: Flow Cytometry 57
2.4.4 Bioreactor microbial dynamics: DGGE and sequencing 58
2.5 Conclusions 63
CHAPTER 3 - Species succession during chlorobenzene biodegradation
3.1 Summary 65
3.2 Introduction 66
3.2.1 Species succession 66
3.2.2 FISH: Probe Design 67
3.2.3 Microbial Growth Kinetics 69
3.2.4 Model System 71
3.2.5 Pandoraea Genus 71
3.2.6 Objectives 72
3.3 Materials and Methods 72
3.4 Results and Discussion 77
3.4.1 Reactor functional operation 78
3.4.2 Isolation and identification of a new MCB degrading strain 78
3.4.3 Strain MCB032 detection and quantification by FISH 80
3.4.4 Strain MCB032 identification with DGGE 82
3.4.5 Growth kinetics of strain MCB032 85
3.5 Conclusions 88
CHAPTER 4 - Microbial dynamics during the treatment of waste gas under
sequentially alternating pollutant conditions
4.1 Summary 89
4.2 Introduction 90
4.2.1 Sequentially Alternating Pollutant 90
4.2.2 Oil-Absorber bioscrubber 92
4.2.3 Model system 94
4.2.4 Objectives 96
4.3 Materials and Methods 96
4.4 Results and Discussion 101
4.4.1 FISH optimisation 101
4.4.2 Bioscrubber operation 108
4.4.3 Microbial community analysis 116
4.5 Conclusions 122
CHAPTER 5 - Performance and microbial dynamics of an oil-absorber
bioscrubber degrading chlorobenzene and fluorobenzene
5.1 Summary 124
5.2 Introduction 125
5.2.1 Model System 125
5.2.2 Objectives 125
5.3 Materials and Methods 125
5.4 Results and Discussion 127
5.4.1 Bioscrubber Only performance 129
5.4.2 Oil-Absorber Bioscrubber Performance 132
5.4.3 Comparison between the BO and OAB operation 136
5.4.4 Microbial Dynamics 139
5.5 Conclusions 144
CHAPTER 6 - Conclusions and Future Work
6.1 Summary 145
6.2 Project Overview 145
6.2.1 Stability of strain % autotrophicus sp. GJIO 145
6.2.2 Species succession during MCB biodegradation 146
6.2.3 Study of Sequentially Alternating Pollutant 147
6.3 Project Significance 148
6.3.1 Strain stability and species succession 148
6.3.2 Oil-absorber bioscrubber under SAP 149
6.3.3 Biomolecular techniques 150
6.4 Future Work Directions 151
6.4.1 Microbial Dynamics 151
6.4.2 Biomolecular techniques 151
6.4.3 OAB Applicability 154
REFERENCES 155
APPENDIX A - DNA extraction and sampling optimisation 172
APPENDIX B - Metabolic pathways 174
APPENDIX C - Probe design 177
LIST OF TABLES
CHAPTER 1
Table 1.1 Major advantages and disadvantages of 16S rRNA based
biomolecular techniques
CHAPTER 2
Table 2.1 Examples of common fluorochromes and DNA stains (Thermo Electron Corporation)
Table 2.2 Probes used in Chapter 1
Table 2.3 Schedule of the changes performed during the operation of
the CSTB
Table 2.4 Dice similarity coefficients between DGGE lanes determined
intra and inter stages.
Table 2.5 Assignment of identities to band sequences extracted from
the DGGE gel
CHAPTER 3
Table 3.1 Probes used in chapter 3
Table 3.2 similarity coefficients between DGGE lanes
CHAPTER 4
Table 4.1 Probes used in chapter 4
Table 4.2 Pre-treatments used in the hybridisation of strain GPl
CHAPTER 5
Table 5.1 Experimental schedule
Table 5.2 Similarity matrix with the Dice similarity coefficients
APPENDIX
Table A1 Description of the lyses methods tested for DNA extraction
LIST OF FIGURES
CHAPTER 1
Figure 1.1 Schemes of Biofilter, Biotrickling filter and Bioscrubber
waste gas treatment configurations (Adapted firom Edwards
and Nirmalakhandan, 1996)
CHAPTER 2
Figure 2.1 Fluorescent in situ hybridisation procedure steps (adapted
from Sanz and Kochling, 2007)
Figure 2.2 Denaturing gradient gel electrophoresis procedure steps
(modified from Sanz and Kochling, 2007)
Figure 2.3 Scheme of the CSTR set-up
Figure 2.4 Bioreactor functional performance
Figure 2.5 Bioreactor microbial dynamics
Figure 2.6 Micrographs of FISH-hybridized bacteria
Figure 2.7 DGGE profile of bacterial samples collected throughout the
different stages of operation.
CHAPTER 3
Figure 3.1 Scheme of the CSTR set-up
Figure 3.2 Chloride balance observed in the MCB degrading bioreactor
Figure 3.3 Phylogenetic tree with Pandoraea pnomenusa strain MCB032
and its closest relatives
Figure 3.4 FISH protocol optimisation for strain MCB032
Figure 3.5 FISH analysis in samples collected from the MCB bioreactor
Figure 3.6 DGGE analysis in samples collected from the MCB bioreactor
Figure 3.7 A typical growth curve for strain MCB032 at a MCB
10
concentration of 32 mg L'̂
Figure 3.8 Linear regression of the exponential area highlighted in figure
3.7.
Figure 3.9 Growth kinetics of strains MCB032 and JS150 on MCB
CHAPTER 4
Figure 4.1 Schematic of the oil-absorber bioscrubber set-up
Figure 4.2 HCl pre-treatment of GPl cells
Figure 4.3 Lysozyme pre-treatment of GPl cells.
Figure 4.4 Lipase and proteinase k pre-treatment of GP1 cells
Figure 4.5 Lipase and proteinase k pre-treatment of GJIO cells.
Figure 4.6 Evolution of the FB and DCE loadings during OAB (left
column) and BO operation (right column).
Figure 4.7 Evolution of the fluoride and chloride release during BO
operation.
Figure 4.8 Evolution of the fluoride and chloride release during OAB
operation.
Figure 4.9 Evolution of the total organic mass discharged (TOD) during
the different periods under both configurations.
Figure 4.10 Evolution of strains GJIO and F11 during the different periods
of operation.
Figure 4.11 FISH analysis of the microbial community in the bioscrubber.
Figure 4.12 Evolution of the community activity during the different
periods of operation.
CHAPTER 5
Figure 5.1 Evolution of the MCB and FB loads during BO operation
Figure 5.2 Evolution of the carbon dioxide released during the operation
under both configurations
Figure 5.3 Evolution of the fluoride and chloride release during BO
operation.
Figure 5.4 Evolution of the MCB and FB loads during OAB operation
Figure 5.5 Evolution of the fluoride and chloride release during OAB
11
operation
Figure 5.6 Evolution of the TOC released during operation under BO and
OAB configurations
Figure 5.7 Evolution of the TOD released of each substrate during the
operation under both configurations
Figure 5.8 DGGE profile of the PCR-amplified 16S rDNA gene
extracted from the bacterial community throughout the
different periods of operation
Figure 5.9 Comparative dissimilarity (1-Dc) between operating periods
with OAB and BO configurations
Figure 5.10 Evolution of active cells during the different periods with
OAB and BO configurations
APPENDIX
A1 Comparative DGGE analysis of the different DNA-extraction
methods
A2 Analysis of duplicate samples collected firom bioreactors
B1 Degradation pathway of 1,2-dichloroethane by X.
autotrophicus sp. strain GJIO (Ploeg et al., 1994)
B2 Metabolic pathway of 1,2-dibromoethane by strain
Mycobacterium sp. strain GPl (Poelarens et al., 2000)
B3 Metabolic pathway of monochlorobenzene by Burkholderia
sp. strain JS150 (Nishino et al., 1992)
B4 Metabolic pathway of fiuorobenzene by Rhyzobiales sp. strain
F l l (Carvalho et al., 2006b).
12
NOMENCLATURE
Abbreviations
3CB 3-chlorobenzoate
4FC 4-fluorocatechol
A Adenine
bp Base pairs
BTT Biological treatment technologies
C Cytosine
ARDRA Amplified ribosomal DNA restriction analysis
BTT Biological treatment technologies
BO Bioscrubber only
CSTR Continuous stirred tank reactor
Cy3 bis-succinimidyl-ester
DAPI 4',6-diamidino-2-phenylindole
DBE 1,2-dibromoethane
Dc Dice similarity coefficient
DCE 1,2-dichloroethane
DGGE Denaturing gradient gel electrophoresis
DNA Deoxyribonucleic acid
Ds Dissimilarity
FC Flow cytometry
FISH Fluorescence in situ hybridization
FITC Fluorescein isothiocyanate
FB Fluorobenzene
G Guanine
HOC Halogenated organic compound
Ks Substrate saturation constant
MCB Monochlorobenzene
NCBI National center for biotechnology information
OAB Oil-absorber bioscrubber
OD Optical Density
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PI Propidium iodide
RDP-II Ribosomal database project II
RE Removal efficiency
RISA rDNA interspace spacer analysis
13
rRNA Ribosomal ribonucleic acid
S Substrate concentration
Sm Substrate inhibitory concentration
SAP Sequentially alternating pollutants
Ss Specific staining
SSCP Single strand conformation polymorphism
t Time
T Thiamine
TOC Total organic carbon
TOD Total organic discharge
T-RFLP Terminal restriction firagment length polymorphism
Ts Total staining
V Viability
VOC Volatile organic compounds
X Biomass concentration
Greek letters
fJ'max
Specific growth rate Maximum specific growth rate
14
Chapter 1
CHAPTER 1
Introduction
1.1 BACKGROUND
1.1.1 Halogenated organic compounds
The halogenated organic compounds (HOC) represent an important class of
chemicals used extensively in industry to produce everyday commodities. More than
3700 HOC have been released from natural sources, such as oceans, volcanoes,
plants, fungi and microrganisms. These mainly contain chlorine and bromine, and a
few contain fluorine and iodine (Gribble, 2003). During the past 75 years a wide
range of HOC were synthesised and their industrial production has intensified
(Eurochlor, 2004). The main applications of HOC are as solvents, pesticides, fuel
additives, plastics, degreasers, and as precursors of many chemicals (Chaudhry and
Chapalamadugu, 1991). Within HOC, 1,2-dichloroethane (DCE) is the most highly
produced, with latest reports indicating a production of over 9 million tons in 2001 in
the USA alone (Anonymous, 2002), making it the fourth largest chemical produced
in the world.
HOC can be divided into three main groups:
• Aliphatics - This group contains short chain substituted organics such as 1,2-
dichloroethane (DCE) and chlorofluorcarbons (CFC's);
• Polycyclics - This group includes cyclic organics such as polychlorinated
biphenyls (PCBs);
• Aromatics - This group contains substituted benzenes such as chlorobenzene
(MCB) and Dichloro-Diphenyl-Trichloroethane (DDT).
Regardless of their application, a fraction of these chemicals is eventually discharged
into the environment. Currently, HOC are among the most common pollutants found
in water and soils (De Wildeman and Verstraete, 2003). The unique chemical and
physical properties of these compounds, such as persistency and toxicity, raise
15
Chapter 1
serious environmental and health concerns. Most of these compounds are classified
as xenobiotic, meaning that they are of synthetic origin and thus foreign to living
organisms (lUPAC, 2007). This can prevent the natural biodegradation of HOC from
occurring rapidly, resulting in adverse effects to the environment that can last for
decades. Classical examples of these long-term effects are: the ozone layer depletion
caused by CFC's released into the atmosphere; poisoning of wild life through
biological magnification, and an increased risk of cancer caused by the pesticide
DDT. Many HOC are suspected carcinogens and several of these figure in the
Priority List of Substances of the European and American environmental protection
agencies (Defra, 2007).
Despite the potential damaging affects to the environment, HOC are an important
class of chemicals that provide many of our daily commodities, so their continuous
application and usage is ubiquitous. In order to prevent the release of these
compounds to the environment, efficient emission control measures have to be
implemented to comply with the increasing regulatory pressures. Ideally, the best
practise would be to act at the process level and prevent or minimise the release of
emissions. Some of these actions include: process development and modification,
implementation of the best production technologies, substitution of hazardous
chemicals when possible and leak detection and repair (Penciu and Gavrilescu,
2003). However, when these measures are not enough to prevent emissions, control
methods have to be implemented (end-of-pipe approach).
1.1.2 Treatment technologies
Increasing communal environmental awareness coupled to stringent regulations have
compelled industries to control their pollutant discharges and adopt suitable
treatment technologies. There is a wide range of treatment technologies available to
control pollutant emissions. As a result of industrial activity, HOC can be found in
wastewaters but they are more commonly found in waste gas streams, as most of
them are volatile organic compounds (VOC).
Some commonly used technologies applied to waste gas treatment are:
16
Chapter 1
Adsorption - Process where pollutants are transferred from gas streams into
a porous solid phase such as activated carbon and zeolites. The contaminated
gas stream is passed through an adsorbent material, normally in a column,
and the VOCs adhere into the active sites of the adsorbing support, being
retained in the column. A typical activated carbon unit can adsorbe 1 0 - 3 0
% VOC on a weight basis, after which requires regeneration or suitable
disposal. These units are suitable for the treatment of low concentrated VOC
streams (up to 10 ppm), with 90-95 % removal efficiency (Delhomenie and
Heitz, 2005).
Absorption - Consists of the transfer of pollutants from gas streams to a
liquid phase such as water and amines. The treatment units normally consist
of a packed column where the gas stream is introduced in the bottom, and a
liquid stream flows in counter current absorbing the VOC. The efficiency of
this process depends on the solubility of the gas in the liquid phase, the
mixing provided by the packing, the column residence time and pollutant
concentration. The absorbers can operate with VOC concentrations ranging
from 500 - 5000 ppm with removal efficiencies of 90 - 95 % (van der
Braken, 2001). However, the remaining concenfrated liquid sfream requires
fiirther treatment, such as desorption and VOC recycle or incineration.
Membrane separation - Selective separation of gas mixtures through semi-
permeable membranes made of polymers, silicon or ceramics. The
membrane units normally consist of spiral-wound modules, which material is
permeable to VOC but relatively impermeable to air. This process has a great
VOC recovery potential, however the energy requirements are high, due to
necessary high pressures, and the membranes generally have a short life.
This technology can treat streams containing 50 - 100 ppm of VOC,
concentrating the VOCs to 50 - 98% of their initial concentrations.
Incineration - Consists of the thermal oxidation of pollutants at
temperatures higher than 1000 °C. The waste streams are introduced into an
incineration chamber and all the VOCs are virtually destroyed. These
17
Chapter 1
incinerators are indicated for the treatment of highly concentrated streams,
VOC concentrations from 100 - 2000 ppm, and provide 95 - 99 % removal
efficiencies. The units can offer thermal energy recovery, contributing to an
overall operating cost reduction. However, this technology requires close
monitoring to prevent the formation of by-products, such as nitrogen oxides
and dioxins, which are very toxic.
• Biological treatment technologies (BTT) - Biocatalytic oxidation of the
pollutants by the action of microrganisms and fungi. The waste streams need
to be humidified or transferred into a liquid media first, and then passed
through a column or bioreactor containing biomass where the VOCs are
oxidised to carbon dioxide and water. This process presents the major
advantage that it does not require additional post-treatments or disposal. The
VOC conversions that can be achieved with BTT are 80 - 95 %. The three
main BTT units will be discussed in more detail below.
In this dissertation, the focus will be placed on the operation of BTT for the
treatment of HOC. Despite being more easily controlled, conventional physical and
chemical treatment solutions tend to be more costly when compared to BTT
(Delhomenie and Heitz, 2005). Furthermore, these solutions create an additional
concern as the pollutants are transformed or concentrated, and still require
appropriate disposal or further processing. The principle advantages attributed to
BTT are: (i) low capital and operating costs, with low energy requirements, (ii)
production of innocuous by-products, and (iii) accepted as an environmentally
friendly option by the public and regulators (Edwards and Nirmalakhandan, 1996).
For the treatment of waste gas, the most widely applied BBT are (Figure 1.1):
• Biofilter - consists of a packed bed filled with either compost, plastic media,
activated carbon, or ceramic media, where immobilized cells are attached
(Yeom and Daugulis, 2000). The waste gas stream is humidified prior to
entering the column, and requires good distribution through the packed
material to ensure good pollutant removal;
18
Chapter 1
Clean Air
Contaminated air
Water and nutrients
B i o f i l t e r
Water and nutrients
Clean Air •
Contaminated air
Biotrickling Filter
Clean Air
Contact unit
Bioreactor
• Li qui d
Water and nutrients
A Contaminated
air
Bioscrubber
Figure 1.1. Schemes of Biofilter, Biotrickling filter and Bioscrubber waste gas
treatment configurations (Adapted from Edwards and Nirmalakhandan, 1996).
• Biotrickling filter - has a similar configuration to the biofilter, with the
exception that moisture is sprinkled onto the top of the filter media, which
comes from a separate recirculation unit that provides control of nutrients and
pH. The packing material requires a higher porosity to allow air and liquid
streams to pass through the column (Edwards and Nirmalakhandan, 1996);
19
Chapter 1
• Bioscrubber - is different from the two configurations above. It normally
contains two interconnected units, a contacting column and a bioreactor. In
the first unit the pollutants in the waste gas are transferred into a continuous
liquid phase, by bubbling the air through a liquid. This liquid phase is
transported to an aerated bioreactor unit where biodegradation occurs
(Delhomenie and Heitz, 2005). Alternatively, the gas stream can also be
sparged directly into the bioreactor, although high pollutant concentrations
can inhibit bacterial activity.
The biofilter is the simplest technology, and involves lower capital costs
(Delhomenie and Heitz, 2005). However, it provides poor control of nutrients and pH
in the packed bed, and channels can be formed in the support material, which results
in poor pollutant removal (Yeom and Daugulis, 2000). Thus, this technology is only
recommended for low pollutant concentrations. The biotrickling filter is an improved
version of the biofilter, which provides better control of nutrient and pH in the media
as it contains a separate recirculation unit. This configuration allows the treatment of
higher pollutant concentrations, but also produces more biomass that can eventually
clog the packing material and compromise the removal efficiency. The bioscrubber
affords better process control than the other two configurations, and is suitable for
the treatment of highly contaminated waste gas. However, mass transfer limitations
may occur between the waste gas and the liquid media, which can diminish pollutant
removal (Koutinas et al., 2005). High biomass concentrations can introduce oxygen
limitations in the system, which can be overcome by supplying more oxygen,
although this incurs in higher treatment costs.
1.1.3 Industrial treatment conditions
The overall performance of BTT is generally decreased when exposed to dynamic
conditions, such as environmental disturbances or changes in waste composition
(Freschl et al., 1991; Goodal et al. 1997). Unfortunately, these conditions correspond
to industrial treatment reality, and can lead to instability or inhibition of microbial
cultures. This is undesirable since the biological treatment could be compromised
until the stability of the system is re-established.
20
Chapter 1
The main limitations and problems affecting industrial BTT are the following:
• Recalcitrance of many organic compounds prevents their immediate
degradation and can only be achieved by the application of specialised
bacterial strains (Pieper and Reineke, 2000);
• Mixture of waste streams with other occasional chemicals used on site can be
toxic for bacterial cultures (Emanuelsson, 2004);
• Batch processes typically produce waste streams with fluctuating loads that
can inhibit microbial activity (Cai et al., 2006; Kim et al., 2005; La Para et
al., 2002);
• Production of different compounds in the same industrial process may
generate waste streams with different compositions, which can also lead to
microbial inhibition (Ferreira Jorge and Livingston, 2000a; Ferschl et al.,
1991); a situation generally referred to as sequentially alternating pollutants
(SAP).
One strategy used industrially to minimise the environmental impact is to implement
treatment technologies at the exact point source of emission, thus preventing dilution
and contamination of large volumes of waste fluids. This approach is particularly
important in the case of toxic compounds, as in this way they can be treated
separately in a dedicated treatment unit. However, these BTT applied to point source
are more likely to be affected by waste streams with fluctuating loads and SAP
resulting from batch processes.
Microrganisms are sensitive to variations, so it is difficult to achieve an efficient
treatment when operating under fluctuating and variable waste production regimes
(Freschl et al., 1991). Treatment failure can have serious environmental
consequences and disrupt industrial processes. In order to prevent bacterial inhibition
under these dynamic conditions, it is important to develop strategies to enhance BTT
efficiency and process stability. Different approaches have been developed to buffer
inlet concentrations into BTT and minimise the inhibitory effects of high pollutant
loads on microbial communities. These strategies include application of immobilized
cells in aerobic granules (Jiang et al., 2004), granular activated carbon as adsorbents
21
Chapter 1
(Carvalho et al., 2006a), and organic solvents as absorbents (Oliveira and Livingston,
2003). The latter approach will be investigated later in this thesis as a solution for the
treatment of SAP waste gas streams.
1.1.4 Microbial biodegradation of xenobiotic compounds
Over the last 50 years industry has produced and synthesised many products that are
new to microrganisms. Some of these compounds are xenobiotic and their biological
degradation is difficult to achieve (Pieper and Reineke, 2000). However,
microrganisms have a great capacity for adaptation, and the exposure to new
compounds constitutes an opportunity for the microrganisms to evolve their
metabolic pathways and develop the ability to utilize new substrates (Brock, 1997).
The evolution of catabolic pathways can be achieved by mutation in the genes, or by
acquisition of novel genes. Horizontal gene transfer (gene transference between
different bacteria) plays an important role in the evolution of catabolic pathways
(Top et al. 2002; Poelarends et al. 2000). Genes that encode for the degradation of
xenobiotic compounds are often encoded in mobile genetic elements such as
plasmids. This genetic material can be disseminated into other bacteria through: (i)
conjugation, (ii) transformation and (iii) transduction. Transformation is the uptake
of free DNA segments into the bacteria and transduction is DNA transfer via
bacteriophages (van Limbergen et al. 1998). These two methods have a limited
contribution to genetic material exchange when compared to conjugation, which can
occur even between gram-positive and gram-negative bacteria. In this case, the
genetic dissemination occurs when two bacteria physically contact and form a pore
through which the plasmids or DNA segments are exchanged. This is the most
common route microrganisms use to acquire the ability to degrade new recalcitrant
substrates.
Microbial growth on HOC requires the production of catabolic enzymes that cleave
the carbon-halogen bonds, commonly known as dehalogenases. These enzymes are
not widely distributed in nature and only a limited number of bacterial strains,
designated in this dissertation as "specific strains", possess the complete enzymatic
set to completely mineralize HOC (Janssen et al., 1994). Many of these specific
22
Chapter 1
strains can be isolated, through enrichment methods, from indigenous cultures found
at contaminated sites. This was the case of the bacterial cultures studied in this
dissertation: Xanthobacter autotrophicus sp. GJIO, able to degrade 1,2-
dichloroethane (Janssen et al., 1985); Burkholderia sp. JS150, able to degrade
monochlorobenzene (Spain and Nishino, 1987); and Rhizobiales sp. F l l , able to
degrade fluorobenzene (Carvalho et al., 2005). However, the application of specific
strains, isolated under laboratory conditions, in industrial treatment facilities is a hard
task to achieve. The stability of these strains can be affected by environmental and
functional parameters (described in section 1.1.3), as well as by the presence of other
competitive species. Furthermore, some recent studies have revealed that even under
constant functional conditions, bioreactors can harbour highly dynamic communities
(Fernandez et al., 1999; Zumstein et al., 2000). Therefore, in order to develop
strategies to improve the efficiency of BTT, a thorough knowledge of strain
dynamics is required to reveal factors and conditions that could influence culture
stability.
1.1.5 Biomolecular techniques
Classical culture techniques have a valuable and important role in microbiology,
such as the isolation of many microrganisms. However, it has been shown that
culture-dependent methods are species selective, and do not provide an accurate
picture of the overall community composition (Wagner et al., 1993). The
development of reliable and easy to use biomolecular techniques has enabled
engineers to gain insight into microbial communities and prompted the study of
microbial dynamics within bioreactors (Briones and Raskin, 2003). The major
advantages of biomolecular techniques compared to the classical culture-dependent
methods are:
• Identification of bacterial strains is based on their genotype and not on their
phenotype or morphology. This allows an accurate identification of bacterial
strains and permits differentiation between closely related strains;
• Detection of many uncultivable bacterial strains that also play an important
role in microbial communities (Amann et al., 1995);
23
Chapter 1
• Identification of different strains can be achieved quickly when compared to
the usual 2-3 days that colonies take to develop;
• Insight into physiologic state of the bacterial strains can be obtained.
Most of these techniques are based on the 16S rRNA, targeting it directly or using its
gene sequence (rDNA). The properties that make the 16S rRNA such a popular
target to study microbial communities are:
• It is present in relatively high amounts in all microrganisms (each cell
contains around 10,000 ribosomes), making it ideal for direct analysis using
specific probes (Head et al. 1998; Lipski et al. 2001);
• This molecule comprises highly conserved regions, which is useful for
universal primer application, and also interspersed variable regions, which
contain enough genetic information to allow for a good differentiation
between closely related species (Olsen et al. 1986; Woese et al., 1977);
• The wealth of sequences deposited in online databases; for instance the
ribosomal database project - RDPII holds 351,796 sequences (Cole et al.,
2005). This allows comparative sequence analysis, specific probe design, and
phylogenetic identity assessment (Amann and Ludwig, 2000).
These culture-independent techniques can be divided into two groups targeting: (i)
the 16S rRNA in ribosomes (ii) the 16S rDNA gene. The first group includes
fluorescence in situ hybridization, which can be a quantitative technique allowing the
specific detection of species of interest (Amann et al. 1995; Lipski et al. 2001). The
second group based on nucleic acid fingerprinting, includes techniques such as
denaturing gradient gel electrophoresis and single stranded conformation
polymorphism, which provide an overall picture of the bacterial community diversity
and changes occurring over time (Delbes, et al. 2001; Muyzer et al., 1993). This last
group requires DNA amplification through Polymerase Chain Reaction before
analysis. A description of the biomolecular techniques most commonly applied in
environmental studies is presented below.
Fluorescence in situ hybridization (FISH) - This is a 16S rRNA targeted tool that
uses fluorescent-labelled oligonucleotide probes to identify and detect microrganisms
24
Chapter 1
at different phylogenetic levels. The combined use of universal and strain specific
probes can provide an accurate quantification of the strains of interest within a
community. The principle of this technique is based on the attachment of a
fluorescent oligonucleotide probe, which consists of a segment of approximately 20
nucleotides, to the cell's rRNA complementary sequence (Head et al. 1998; Amann,
et al. 2000). The fluorescence signal can be detected with an epifluorescence
microscope. A detailed description of this technique is presented in section 2.2.2.
Polymerase Chain Reaction (PGR) - This is a powerful technique that
exponentially amplifies specific DNA molecules for different biomolecular
applications, such as fingerprinting techniques (Briones and Raskin, 2003). It
explores the same principle as in DNA synthesis, thus requiring a DNA template
sequence, a polymerase enzyme, a set of primers to select the target gene and
deoxyribonucleoside triphosphates (dNTP's) to form the new DNA. PGR is
dependent on primers for specificity and the thermostable polymerase, isolated fi'om
Thermophilus aquaticus, that allows the different steps of the process to occur
consecutively at different tempeatures (Kleppe et al., 1971). Each PGR cycle can be
divided into 3 steps, with the following general characteristics:
• DNA denaturation: The DNA strands are separated at 95 °G for 1 minute;
• Annealing of primers: the primers hybridise with the single stranded DNA
sequence at 50-65 °G (temperature depends on primers melting temperature)
for 1 minute;
• Sequence extension: the polymerase enzyme links the dNTP's to form a new
DNA sequence at 72 °G for 2 minutes.
A typical 30-cycle reaction can amplify a single DNA molecule to produce billions
of copies in less than 3 hours.
Denaturing gradient gel electrophoresis (DGGE) - A DNA fingerprint technique
used to study complex communities. The DNA extracted from environmental
samples is PGR-amplified (16S rRNA gene), thus generating DNA sequences with
the same size but different composition. The PGR products are separated by
electrophoresis in a polyacrylamide gel with a denaturing gradient. Depending on
their melting temperature, the DNA fragments migrate in a specific pattern
25
Chapter 1
producing different bands, each typically corresponding to a different species. This
analysis provides an overall view of community diversity and any population shifts.
A detailed description of this technique is presented in section 2.2.3.
Terminal-restriction fragment length polymorphism (T-RFLT) - This technique
relies on the differences in restriction behaviour of DNA sequences from different
microbial species. It is PGR based, however one of the primers used to amplify the
16S gene contains a fluorescent label. The PGR products are digested with restriction
enzymes and, given that different species have different sequences, the segments
originated will have different lengths. The terminal segments, which are
fluorescently labelled, are normally run through a DNA analyser and distinguished
by laser-induced fluorescence detection, but can also be separated by gel
electrophoresis (Dorigo et al., 2005).
Amplified ribosomal rDNA restriction analysis (ARDRA) - This technique is
similar to the T-RFLT as the PGR products are also digested by restriction enzymes.
However in this case, all the restriction fragments are separated in a non-denaturing
polyacrylamide gel, generating a restriction pattern for the whole community. This
technique requires extensive sequencing and previous knowledge of the dominant
species to recognize the different band patterns.
Single stranded conformation polymorphism (SSCP) - This technique detects
sequence variations of single stranded DNA within a community. Each single
stranded DNA molecule folds into a unique secondary conformation according to
their nucleotide sequence and the physicochemical environment (Schweiger and
Tebbe, 1998). After PGR-amplification the DNA strands are separated by heating the
sample at 94 °G and then are separated according to their conformation in a
polyacrylamide gel.
rDNA internal spacer analysis (RISA) - This technique explores the differences of
the DNA gene region between the 23S and 16S. This spacer is unique for each
species and differs in length and base pair sequence. Thus, the PGR-amplification
26
Chapter 1
products can be separated by non-denaturing polyacrylamide gel electrophoresis
(Garcia-Martinez et al., 1999).
Table 1.1. Major advantages and disadvantages of 16S rRNA based biomolecular
techniques
Method References Advantages Disadvantages
FISH
Amann et al., 1995; Manz et
al., 1994;
Quantitative method; Affordable technique that requires basic equipment
Tedious analysis and quantification;
DGGE Muyzer et al., 1993; Gillan et
al,1998
Profiling of complex communities; High sample
throughput
Affected by DNA extraction and PGR biases;
T-RFLT Lui et al, 1997 Automated analysis using fluorescent primers and a
DNA analyser
Requires expensive and specific equipment
ARDRA Fernandez et
al,1999 Long DNA sequences can
be analysed Not indicated for complex
communities
SSCP Zummstein et
al., 2000 Simple procedure that
requires basic equipment Difficult separation of longer DNA sequences
RISA Von Canstein
et al., 2001 Highly sensitive method Lack of database for comparative analysis
The power and versatility of these biomolecular techniques is remarkable. However,
in order to generate a faithful picture of the microbial communities, several pitfalls
and biases associated with these techniques have to be addressed. Without careful
consideration, factors such as; sampling, DNA extraction, PGR reaction, and the
technique itself, can consecutively introduce species selectivity (Dahllof, 2002). A
summary of the major advantages and disadvantages of the biomolecular techniques
described is presented in Table 1.1. In this dissertation, FISH and DGGE were
selected to study the microbial communities in the bioreactor systems operated.
These will be discussed in further detail in chapter 2.
27
Chapter 1
1.2 OBJECTIVES
Dynamic waste production regimes, commonly encountered in industry, undoubtedly
affect BTT performance. In order to withstand this situation, strategies to enhance
treatment efficiency have to be developed together with a comprehensive insight into
microbial dynamics. The overall aim of this dissertation is to investigate the
dynamics of specific bacterial strains, responsible for the biodegradation of selected
HOC, in non-sterile bioreactor configurations exposed to different functional
conditions. The novelty explored in this thesis relies in the application of
biomolecular techniques to specifically monitor bacterial strains within biodegrading
communities exposed to sequentially alternating pollutant (SAP) scenarios.
Within this overall aim, the specific objectives of this study are to:
1. Optimise biomolecular techniques to quantify specific HOC degraders and to
characterise the overall community composition;
2. Analyse the stability and performance of the individual HOC degrading strains
under long-term constant operating conditions;
3. Investigate the dynamics of the specific degraders and overall community during
bioreactor operation under SAP treatment scenarios;
4. Interpret microbial community changes in light of functional perturbations in the
bioreactor systems;
5. A final objective of this dissertation is to generate engineering insights useful to
eventual scale up and operation of improved BTT.
1.3 RESEARCH STRATEGY
The research strategy established to accomplish the objectives stated above was as
follows:
• A group of HOC with potential industrial interest, for which complete
microbial degradation has been described, was selected. These contained
different halogens so that their combined biodegradation could be easily
monitored.
• FISH was the biomolecular technique selected and optimised to quantify the
specific HOC degraders and determine the community activity.
28
Chapter 1
DGGE was also applied in combination with FISH to monitor the overall
community dynamics and detect significant community shifts.
Before estimating the effect of environmental disturbances on the HOC
degrading strains, the evolution of these strains and their associated
communities was investigated under stable environmental conditions. This
long-term stability was tested in continuous stirred tank bioreactors (CSTR)
under constant non-sterile conditions. The behaviour of these strains was
monitored with FISH and DGGE to assess whether any changes would occur
during the continuous biodegradation. Functional changes, such as a
deliberate contamination, were later introduced to study their effect on the
bacterial strains.
The specific bacterial strains that exhibited a stable behaviour in previous
experiments, were applied in a bioscrubber system removing two HOC under
SAP conditions. Two different system configurations were tested and
compared under identical functional conditions, one containing an oil-
absorber unit or another comprising the bioscrubber only. The microbial
dynamics of the individual strains and overall community were investigated
in both systems, and collectively examined with the functional performance.
1.4 THESIS STRUCTURE
This thesis is divided in six chapters, each containing the following sections:
summary, introduction, materials and methods, results and discussion, and
conclusions. Chapter 2 addresses the stability of a specific bacterial strain able to
degrade 1,2-dichloroethane (DCE), under constant operation and also under some
functional perturbations: nitrogen limitation and addition of glucose as a co-
substrate. Chapter 3 investigates the succession between two monochlorobenzene
degraders, and analyses the stability of the predominant degrader. The isolation and
characterization of a new chlorobenzene degrader is also reported. Chapter 4 presents
the optimisation and application of FISH to detect two specific strains in a waste-gas
treatment system operating under a SAP feeding scenario. Chapter 5 investigates
community dynamics by DGGE in a similar SAP feeding scenario using a different
29
Chapter 1
model system. Chapter 6 summarises the main conclusions and implications of this
thesis and proposes directions to future work. Appendixes refer to the DNA
extraction and optimisation (Appendix A), metabolic pathways for the aerobic
degradation of 1,2-dichloroethane, monochlorobenzene, fluorobenzene and 1,2-
dibromoethane (Appendix B), and 16S rRNA probe design (Appendix C).
30
Chapter 2
CHAPTER 2
Stability and performance of stvdim.Xanthobacter autotrophicus GJIO
degrading 1,2-dichloroethane
2.1 SUMMARY
The stabiHty of microbial strains is an important issue to be addressed when
developing BTT able to deal with dynamic waste streams. In order to associate
functional perturbations to community changes, the community has to be stable
under constant operating conditions. Otherwise, it would not be reasonable to assume
this cause-effect relation, as the community could change independently of
functional perturbations. In this chapter, the dynamics of a microbial community
dominated by Xanthobacter autotrophicus GJIO, degrading a synthetic wastewater
containing 1,2-dichloroethane (DCE), was investigated. This study was performed
over a 140-day period in a non-sterile continuous stirred tank bioreactor (CSTR),
subjected to different operational regimes: nitrogen limiting conditions, baseline
operation and introduction of glucose as a co-substrate. The microbial community
was analysed by a combination of Fluorescence in situ Hybridization (FISH), and
Denaturing Gradient Gel Electrophoresis (DGGE). Under nitrogen limiting
conditions DCE degradation was restricted (83%) but this did not affect the
dominance of strain GJIO, determined by FISH to comprise 85% of the active
population. During baseline operation, DCE degradation improved significantly to
over 99.5%, and then remained constant throughout the subsequent experimental
period. DGGE profiles revealed a stable, complex community while FISH confirmed
that strain GJIO remained the dominant species. During the addition of glucose as a
co-substrate, DGGE profiles showed a proliferation of other species in the CSTR.
The percentage of strain GJIO dropped to 8% of the active population in just five
days, however this did not affect the DCE biodegradation. The return to baseline
conditions was accompanied by the re-establishment of strain GJIO as the dominant
species. This study demonstrated the stability of strain GJIO under constant
operation, and also revealed its capacity to withstand perturbations both at the
functional and microbial level.
31
Chapter 2
2.2 INTRODUCTION
2.2.1 Strain Stability
The application of specific strains to industrial BTT can be difficult as typical
operating conditions, such as non-sterile long-term operation and dynamic waste
production regimes, can be challenging for microbial communities (Koutinas et al.,
2006; Von Canstein et al., 2001). Previous studies have addressed the effect of
various functional conditions on treatment performance, however mostly neglecting
the dynamics of bacterial communities and how these could influence treatment
efficiency. This black-box approach to BTT disregards the basic understanding of
bacterial dynamics, which is an important factor in BTT optimisation. Within the last
two decades, the introduction of biomolecular techniques to environmental research,
has allowed a more thorough analysis of microbial communities and the
incorporation of this knowledge into BTT development.
Recent studies on the dynamics of microbial communities within bioreactors have
demonstrated that functional stability is not necessarily correlated to community
stability (Fernandez et al., 1999; Kaewpipat and Grady Jr, 2002; Zumstein et al.,
2000). These findings highlight the fact that microbial communities can change and
evolve independently of functional parameters. Fernandez et al. (1999) reported one
of the first studies of microbial dynamics and culture stability in bioreactors. During
a 605 day period, a culture of bacteria and archae was monitored in a well-mixed
methanogenic reactor fed with glucose. Using ARDRA, they were able to
characterize and follow culture evolution. Although the bioreactor performance and
operating conditions were stable during this period (pH, COD and methane
production remained constant), the bacterial population was found to be highly
dynamic, and significant changes were observed in both archae and bacterial
domains. Contradicting previous assumptions, this work has shown that system
stability does not imply community stability. This is an interesting finding since prior
to the availability of biomolecular techniques, the development and modelling of
bioreactors assumed that no major changes occurred in microbial cultures when
operating under constant conditions.
32
Chapter 2
Similar findings were observed by Zumstein et al. (2000) when running a fluidised
bed reactor during a 2 year period, fed with vinasse, under constant operating
conditions (feeding, temperature and pH). The bacterial and archaeal community
dynamics was monitored by SSCP. The gel patterns showed that the archaeal culture
remained relatively stable however, the bacteria domain composition changed
rapidly over time. Another interesting study by Kaewpipat et al. (2002) performed in
lab-scale activated sludge reactors, showed that different communities can be
functionally similar. They inoculated two reactors with the same sludge consortium
and analysed the evolution of the communities with DGGE over a period of 150 days
under constant operating conditions. They found that, although the functional
performance was identical, the communities changed over time and each one evolved
in a different way. This clearly demonstrates that microbial interactions are intrinsic
to a community and occur independently of the functional performance of a
bioreactor.
In contrast, however, other studies performed in full-scale BTT, have reported stable
communities under constant operation (LaPara et al., 2002; Tresse et al., 2002).
Interestingly, Smith et al. (2003) have shown that even a complex community, such
as activated sludge treating a pulp mill effluent, can exhibit stable long-term
behaviour, even when exposed to perturbations at the functional level, such as
shutdown and start-up of a wastewater treatment plant. This study showed a good
correlation between community stability and functional consistency in terms of BOD
removal.
Stability is a contentious issue and different views have been presented. A
particularity of the studies described above is that they are focused on mixed cultures
and have only followed specific phylogenetic groups. Only a very limited number of
studies have looked into the long-term stability of individual species, whose
enzymatic capability is indispensable for treatment success (Carvalho et al., 2006a).
Furthermore, the substrates used in the majority of studies to date are easily
biodegradable (e.g. glucose and vinasse). There is little information on stability of
communities during biodegradation of complex and recalcitrant compounds.
33
Chapter 2
Therefore, it would be interesting to investigate the stability of a specific strain, and
the dynamics of the associated community, degrading a recalcitrant compound. In
point source BTT, in which biodegradation of toxic and/or recalcitrant compounds is
dependent on specific strains, this is an important issue to be addressed, as the
disappearance of one of this strains could lead to treatment disruption. Elucidation of
the stability of specific strains under constant operating conditions is essential before
introducing operating changes in the systems, as it would be impossible to relate
operational changes to community shifts if this community also changed under
constant operational conditions.
2.2.2 Fluorescence in situ Hybridization: application
As discussed in section 1.1.5, FISH is a 16S rRNA targeted tool that uses
fluorescent-labelled oligonucleotide probes to identify and detect microrganisms at
different phylogenetic levels (DeLong et al., 1989).
The probes targeting the rRNA can be divided into general and specific probes,
depending on whether they bind to a common or specific genetic area of the rRNA.
The most usual general probe is the EUB338I (Amann et al., 1990) which binds to all
bacteria, but other probes can be used to specifically target other taxonomic levels,
such as domain, order or family. Strain specific probes can also be used and designed
if the 16S rRNA sequence is known (further details in section 3.3.2). Another general
probe that is used to check the occurrence of non-specific binding is NonEUB338I
(Manz et al. 1992), which is the complementary sequence of the universal probe
EUB338I and thus should not bind to bacterial rRNA.
The overall FISH procedure can be visuahsed in Figure 2.1. The major steps are cell
fixation, hybridization and visualisation. Cell fixation is a procedure conducted to
preserve the cell integrity and prevent nucleic acid loss (Leitch, et al., 1994). This
step is normally introduced when samples are going to be stored for a long time, or
need to be permeated to facilitate probe penetration through the membrane.
However, if cells are going to be analysed directly and there are no permeability
issues, this step can be skipped.
34
Chapter 2
Hybridization is the process whereby the probe penetrates the cell and binds to the
targeted nucleic acid. The fluorescent probes enter the cell through the action of
temperature and a buffer containing formamide. The concentration of formamide and
the temperature of hybridisation influence the stringency of the hybridization and
how specific the probe attachment is. The more stringent the conditions applied, the
more specific the binding should be. Though very stringent conditions can also
prevent specific staining, thus these parameters have to be efficiently optimised. To
certify that the parameters selected are adequate, a negative control should be
performed with nonEUB338 probe (or other non-specific probe) to ensure there is no
non-specific binding. Following hybridization, the sample should be washed under
similar stringent conditions to ensure all probe in excess or partially bonded to rRNA
is removed.
Detection
-̂ 'NaaP-
Fixation
Hybridisation AUCAUUCUUUACGAAGAC I : i I M I I I I i
GCTGCCTCCCGTAGGAGT
COOH
Figure 2.1. Fluorescent in situ hybridisation procedure steps (adapted from Sanz and
Kochling, 2007)
The rRNA probes have a fluorochrome normally attached to the 5' end. These can be
visualised by excitation with light of the appropriate wavelength and using an
appropriate filter to visualise the emitted wavelength (Table 2.1). There are several
35
Chapter 2
fluorochromes available, each with different excitation and emission peaks that can
be visualised in different colours under a microscope. The difference between the
excitation and emission wavelengths of a fluorochrome is defined as the Stokes shift.
Some DNA stains can also be used to counterstain the target microrganism; the most
commonly used is 4',6-diamidino-2-phenylindole (DAPI), which stains all live cells.
Propidium iodide (PI) also binds to DNA, however it cannot cross the cell
membrane, therefore only dead cells with disrupted membranes are stained. Using
these two dyes, it is possible to determine the viability of a cell culture by calculating
the ratio between dead and live cells.
Table 2.1. Examples of common fluorochromes and DNA stains (Thermo Electron
Corporation)
Fluorochrome Wavelength
Colour Fluorochrome Excitation (nm) Emission (nm)
Colour
Fluorescein (FITC) 491 515 Green
Cy3 550 570 Yellow
Texas Red 583 603 Red
DNA Stains
DAPI 355 450 Blue
PI 530 615 Red
The traditional analytical technique applied to detect the fluorescence signal emitted
from hybridised cells is epifluorescence microscopy, although flow cytometry can
also be used (Lipski et al., 2001). Conventional epifluorescence microscopy is the
most common technique used to analyse the FISH signal. These microscopes are
equipped with light sources that can emit light fi-om ultraviolet to infrared, allowing
the detection of a broad range of fluorescent stains. The microscopes are equipped
with a set of different filters, which narrow down the light beam into the specific
wavelength, and a camera that provides digital imaging. A major drawback of this
technique is that it cannot be applied to thick samples, like biofilms. The confocal
laser microscope is an alternative in these cases, since it can take serial pictures of
the sample layers and then combine them to give a 3D image (Lipski et al., 2001).
36
Chapter 2
Flow cytometry (FC) is a rapid analysis technique that allows the counting, sorting
and detection of suspended cells at a rate higher than 10^ cells.s"' (Wallner et al.,
1995; Davey et al. 1996). In FC, cell suspensions are transported in a capillary-sized
tube through a laser beam by a continuous flowing stream (Al-Rubeai and Emery,
1996). The cells scatter some of the laser light generating three different signals:
forward scatter (related to cell size), side scatter (related to cell shape) and
fluorescence. The innovation of this technique lies both in the broad range of cell
parameters that can be determined (up to 11), and also its ability to sort cells,
allowing the selection of a population of interest from a highly diverse community
(Wallner et al., 1997; Winson et al., 2000). FC is a very efficient technique since
thousands of cells can be analysed within seconds. However only suspended cells
can be analysed, which restricts its application to environmental samples (Lipski et
al., 2001).
When compared with microscopy, FC presents the advantages of being automated,
objective and providing fast analysis. However, this technique is also complex and
expensive, usually requiring experienced technicians to operate it (Al-Rubeai and
Emery, 1996). FC has been widely employed in studies with eukaryotic cells, but the
existing environmental microbial studies are limited, primarily because the
prokaryotic cell dimensions are often within the detection limit of the instrument, and
also because these cells usually aggregate (Rieseberg et al., 2001). Even though,
some authors have successfully applied FC using fluorescent 16S rRNA-targeted
probes to characterize an activated sludge and sort specific phylogenetic groups
(Wallner et al., 1995), to discriminate Desulfobacter bacteria from a mixture with E.
coli (Amann et al., 1990), and to quantify uncultured bacteria present in the human
intestine (Zoetendal et al., 2002).
Although FISH has proved to be a valuable tool in the direct identification of
microrganisms, it is a multifaceted method that still has some limitations (Moter et
al., 2000; Wagner et al., 2003). The potential problems inherent to this technique are:
• Limited permeability of cells to probes. Some cells can be very difficult to
permeate, even when using a combination of fixatives and pre-treatments
(Manz et al., 1992; Zarda et al., 1997).
37
Chapter 2
• Difficult probe accessibility. The rRNA exhibits a three-dimensional
conformation, so not all targeted sequences are equally accessible (Fuchs et
al., 2000; Behrens et al. 2003).
• Low signal due to low rRNA content. The rRNA content of a cell varies
according to its activity, so a weaker signal will be attained fi:om less active
cells (Molin et al., 1999; Bouvier et al., 2003).
2.2.3 Denaturing Gradient Gel Electrophoresis: application
This DNA fingerprint technique was recently introduced into microbial ecology by
Muyzer et al. (1993). It allows the study and monitoring of complex communities
over time by DNA profiling. The gene targeted with this technique is also the 16S
rDNA. This gene contains highly conserved areas, which are common to all bacteria,
and also variable areas that contain enough information to differentiate closely
related species. The 16S gene contains nine variable areas (designated as VI to V9),
and the most commonly targeted by DGGE is the V3 area, which corresponds to
position 341 to 518 with reference to the Escherichia coli sequence (Muyzer et al.,
1993).
The procedure to perform DGGE can be visualised in Figure 2.2. The major steps are
DNA extraction, PCR amplification, electrophoresis and sequencing. There are
numerous methods to extract bacterial DNA, which involve a combination of bead
beating, detergents, enzymatic lyses, and solvent extraction (Gillan et al., 1998;
Stach et al., 2001). Most of these methods are time consuming and alternatively,
there are nowadays many commercial kits available that perform this task more
rapidly and as efficiently. Additionally, these kits provide a good method
standardisation, which is critical when extracting DNA regularly over long periods of
time. Regardless of the approach selected, it is difficult to ensure that the DNA
extracted is representative of the whole community, as some cells are more difficult
to lyse than others (Kuske et al., 1998). Furthermore, it has been shown that when
comparing different methods, a high DNA yield does not necessarily correspond to a
higher DNA diversity (Stach et al., 2001). The best way to achieve a good DNA
extraction is by using different approaches and comparing them through
fingerprinting techniques.
38
Chapter 2
DNA Extraction
Wfs
Chapter 2
pairs requires more energy to break rather than the double bond between the adenine
- thiamine (AT) base pairs. Therefore, the GC rich sequences will separate in a
higher denaturing area, while the AT rich sequences require less energy and will
separate in the less stringent part of the gel. Prior to the DGGE analysis, the optimal
conditions for the DNA separation have to be optimised, and these are: the gel
denaturing gradient and the electrophoresis running time (Muyzer et al., 1993). The
stringency of the denaturing gradient is determined by the amount of formamide and
urea contained in the polyacrylamide mixture of the gel, normally expressed as
weight percentage. The concentration of these chemicals changes gradually through
the gel, being higher at the bottom and lower at the top. The chemical gradient
determines the separation of the DNA and normally varies from 35% to 65%. The
traditional dye used to stain the DNA gels is ethidium bromide (EB). However other
stains have been introduced recently, such SYBR Green I and SYBR Gold, that
allow less background staining and thus, the detection of weaker bands. A more
sensitive detection can be achieved by silver staining, however these gels cannot be
used for sequencing purposes (Muyzer and Smalla, 1998). The visualization of the
gels is achieved by irradiating the gel with UV light and acquiring a picture with an
imaging system.
Prominent bands can be excised from the gel for identification. The DNA eluted
fi-om an excised band can be PCR-amplified and prepared for sequencing. The
principle of the current DNA sequencing methods was developed by Sanger et al.
(1977). This method explored the application of a modified version of a deoxyribose
sugar, which has two hydroxil groups removed (dideoxiribose), into the DNA
synthesis. When incorporated into a sequence this molecule is unable to form any
other bonds, thus leading to the sequence termination. Using DNA sequences radio-
labelled at the 5'- end, four separate polymerase reactions are carried out using one
type of dideoxynucleotide and all four normal deoxynucleotides. The resulting four
products contain sequences with different lengths that can be separated by gel
electrophoresis and detected by x-ray imaging. The sequence is then put together
starting from the bottom where the smallest fragment was detected, and determined
based on the column where each band appeared. Nowadays, the polymerase reaction
is performed in one tube using fluorescently-labelled dideoxynucleotides and normal
40
Chapter 2
deoxynucleotides. The separation of the products is performed by capillary
electrophoresis which can be run at high voltages and provide high throughput of
samples. Furthermore, the support polymer can be washed and reused, which allows
the automation of the method (Swerdlow et al , 1991). The fluorescent signal is
detected by laser and interpreted by specific software that delivers the nucleotide
sequence.
In order to assess the phylogenetic identity of a DGGE band, the retrieved DNA
sequence can be inserted into an online database, such as Ribosomal database project
(RDP-II; Cole et al., 2005) or National center for biotechnology information (NICB;
Zhang and Madden, 1997), and compared against all sequences deposited. These
sequences can also be used to design 16S rRNA probes, which can be applied by
FISH to quantify the detected species.
Although DGGE is a valuable tool to profile and analyse complex communities, it
has some constraints and pitfalls. Some of the potential limitations of this technique
are presented below:
• Poor DNA extraction and PGR bias can provide an inaccurate picture of the
overall community diversity (Gillan et al., 1998; Stach et al., 2001);
• Two different species can have similar migrating patterns and be represented
by the same band; while a species containing multiple rrN operons with
sequence heterogeneity can generate 2 or more bands (Haruta et al., 2002;
Muyzer and Smalla, 1998);
• It is a qualitative technique and quantification cannot be inferred from band
intensity (Haruta et al., 2002; Araya et al., 2003);
• Due to the short length on the DNA fragments analysed, it is often not
possible to determine the exact phylogenetic affiliation of a certain band
(Muyzer et al., 1995;).
In this dissertation, FISH and DGGE were the two biomolecular techniques selected
to study the microbial communities in the bioreactor systems operated. The
combination of these two techniques enabled the quantification of the specific strains
41
Chapter 2
involved in the HOC degradation, and provided an overall picture of the community
diversity and evolution over time.
2.2.4 Model System
1,2-dichloroethane (DCE) is a chlorinated organic compound widely used in
industry, mainly for the production of vinyl chloride. It is toxic and potentially
carcinogenic, therefore its emissions have to be controlled following strict
environmental regulations (Public Health Statement: 1,2-dichloroethane, ATSDR).
For these reasons, there is a potential interest in developing technologies able to
tackle waste-gas streams contaminated with DCE. Previous work with this
compound has already been carried out in our research group using strain
Xanthobacter autotrophicus GJIO (Ferreira Jorge and Livingston, 1999; Freitas dos
Santos and Livingston, 1995). This strain was isolated by enrichment in a chemostast
of a mixed culture obtained from a DCE contaminated site (Janssen et al., 1984), and
was the first bacterial isolate able to degrade DCE aerobically. It is characterized as a
rod shape, non-motile, gram-negative, catalase positive, oxidase negative
microrganism that forms small yellow opaque colonies on nutrient agar plates.
Furthermore, it is able to utilize DCE as a sole source of carbon and energy in
concentrations up to 15 mM. The degradation pathway for DCE degradation by
strain GJIO has been elucidated (Janssen et al., 1985), and is presented in Appendix
B.
2.2.5 Objectives
As highlighted previously, there is evidence suggesting that functional stability does
not imply community stability. This is an important issue to be addressed when
developing BTT able to deal with dynamic waste streams. Before studying the
influence of dynamic conditions in bioreactors, the stability of the microbial
populations should be analysed under constant conditions, as it would be impossible
to relate operational changes to community shifts if this community also changed
under constant operational conditions. Therefore, the aim of this chapter was to
investigate whether a single strain degrading a recalcitrant compound under non-
42
Chapter 2
sterile conditions exhibited stable behaviour under constant and dynamic operating
conditions. The response of the microbial community was evaluated in a CSTR
operated under the following conditions: (i) nitrogen limiting conditions, (ii) baseline
operating conditions, (iii) addition of glucose as a co-substrate. FISH and DGGE
were applied to monitor the microbial community and quantify the specific DCE
degrader.
2.3 MATERIALS AND METHODS
2.3.1 Bacteria and growth conditions
Xanthobacter autotrophicus strain GJIO (kindly provided by Prof. D. Janssen from
the University of Groningen, The Netherlands) can utilize DCE as a sole source of
carbon and energy. Strain GJIO was initially grown for 48h in shake flasks at 30 °C
under aerobic conditions. The flasks were tightly closed to prevent DCE evaporation
and filled to one fifth of their capacity with mineral medium (Janssen et al., 1984).
DCE 99% pure (Sigma, UK) was added to a final concentration of 5 mM.
2.3.2 Continuous stirred tank bioreactor (CSTR)
A scheme of the CSTR setup is presented in Figure 2.3. The bioreactor used was a
BioFlo 1000 - New Brunswick Scientific (NJ, USA) with 2.6 L total capacity (20 cm
high and 13 cm diameter), with a working volume of 2.3 L. The CSTR was equipped
with two six-bladed impellers (d = 0.05 m), positioned 0.01 m apart with the lower
impeller placed at 0.03 m above from the bottom of the vessel, and was stirred at 220
rpm. The vessel was fitted with four equally spaced baffles (0.006 m). The pH was
controlled by addition of NaOH (IM) and maintained at 7.00 ± 0.1 throughout the
experiment. The temperature of the biomedium was maintained at 30 °C and the
oxygen saturation was always above 30% (Mettler Toledo Ltd, Leicester, UK). The
bioreactor was inoculated with the GJIO shake flask culture and operated under non-
sterile conditions.
43
Chapter 2
Sterile Air inlet Air outlet
Biomedium
Overflow
£
10 V
= 0 ^ =1
Figure 2.3. Scheme of the CSTR set-up: (1) biomedium, (2) pH probe, (3)
thermocouple, (4) oxygen probe, (5) sampling port, (6) pH controller, (7) IM NaOH
solution, (8) peristaltic pump, (9) mineral medium, (10) DCE synthetic wastewater.
A mineral medium (Janssen et al , 1985) was used at a flow rate of 0.020 L If ' until
day 45 followed by enrichment with 0.5 g L"' of (NH4)2S04 supplied at 0.027 L h"'.
The concentration of DCE in the synthetic wastewater was ca. 3 g L"' and it was
supplied at a flow rate of 0.048 L h"' until day 45 and afterwards at 0.064 L h"'. On
day 109, glucose was added to the synthetic wastewater at a concentration of 2 g L"'
for a period of 13 days.
2.3.3 Analytical Methods
The DCE concentration in the liquid feed and in the CSTR outlet was analyzed using
an Agilent 6850 Series II gas chromatograph (GC; Agilent Technologies,
Wokingham, UK) with a flame ionization detector and a column (30 m x 0.318 mm x
35 pm, J&W Scientific, Agilent Technologies). DCE present in the liquid phase was
analyzed by extracting 8 mL of sample with 2.5 mL of n-Dccane and injecting 1 \xL
into the GC. The starting temperature was 40 °C for 2 min, increased by 20 °C min"'
to 90 °C and then increased by 40 °C min"' to 260 °C. DCE present in the bioreactor
gas outlet was analyzed by directly injecting 25 p,L of sample into the GC. The
44
Chapter 2
temperature was set at 40 °C for 2 min, and increased by 20 °C min"' to 70 °C. The
coefficient of variation was 0.2 % at a concentration of 24 mg L"V The glucose
concentration in the biomedium was analyzed by HPLC (Gilson, UK) with a UV
detector. The samples were centrifuged and filtered through a 0.2 pm filter to
eliminate bacteria and suspended solids. A sample was injected into the column (50
mm X 2.00 mm x 3pm) with a CIS stationary phase (Luna, Phenomenex), and the
mobile phase was water. The glucose concentration was determined based on a
calibration curve. Chloride concentration was analyzed by ion chromatography
(Dionex DX 120, with an lonPAC AS 114 4*250 mm column, Camberley, UK). The
mobile phase was 3.5 mM Na2C03 and 1.0 mM NaHCOa at 1.1 mL min"'. To analyze
the cations, the mobile phase used was 19mM CH4O3S (column lonPac CS12A,
Dionex). The samples were centrifuged and filtered through a 0.2 pm filter to
eliminate bacteria and suspended solids.
The biomass was measured at 660 nm on a UV-Vis spectrophotometer (Unicam,
UK). The absorbance was correlated with dry weight (100 °C over 24h until constant
weight) to determine the actual biomass concentration. Carbon dioxide was
determined using an isothermal GC (GC-14A, Shimadzu, Milton Keynes, UK) fitted
with a thermal conductivity detector. Samples were injected at 128 °C into a Porapak
N column (2 m x 2 mm, Alltech Associates Applied Science Ltd, Camforth, UK)
packed with dininylbenzene/vinyl pyrrodinone at 28 °C. The coefficient of variation
for five samples was 2.6% at a concentration of 0.03% v/v carbon dioxide. Total
organic carbon (TOC) was measured with a Shimadzu 5050 total organic carbon
analyzer. The biomass and any remaining solids were removed from the biomedium
via centrifugation and filtration. The coefficient of variation for three samples was
0.5% at a concentration of 500 gm"^ of carbon.
2.3.4 Plate counting
Samples taken from the biomedium were serially diluted and spread onto nutrient
agar plates (per liter: peptone 5.0 g, beef extract 3.0 g, NaCl 8.0 g, 15 g agar). They
were incubated at 30 °C and emerging colonies were counted for a period of one
week. Colonies of X. autotrophicus GJIO were identified by their characteristic
45
Chapter 2
yellow colour. Plate counts were only performed during the optimisation of the FISH
technique and were ceased on day 70.
2.3.5 Sample collection and preparation for microbial analysis
Samples were collected from the biomedium through the sampling port and washed
in Phosphate-buffered saline (PBS; per liter: 1.040 g of Na2HP04, 0.332 g of
NaH2P04 and 0.754 g of NaCl). The samples were resuspended twice in 1 mL PBS
and 10 jiL of 0.1% (w/w) Igepal (Sigma, UK). Six pL of this cell suspension was
added to each spot of a Teflon coated slide with eight wells (Erie Scientific
Company, USA) coated with a thin layer of gelatin (0.1% (w/v)) and KCr(S04)2
(0.01% (w/v)). After air-drying, the slides were dehydrated in a series of ascending
ethanol concentrations (50, 80 and 100% (v/v)) for three min each step.
2.3.6 Oligonucleotide probes and slide in situ hybridization
The oligonucleotide probes used are listed in Table 2.2 and were labeled at the 5' end
with FITC or Cy3 (Thermo Electron Corporation, Dreieich, Germany). A 9 |a,L
aliquot of hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.1% (v/v) sodium
dodecyl sulphate (SDS), 15% (v/v) of formamide) was placed on each spot. One pL
of specific strain GJIO probe and 1 |j,L (50 ng jJ-L"') of either EUB338I, NonEUB or
ARCH344 probes were applied on each spot. The NonEUB probe was used as a
negative control to test the specificity of hybridization, and the ARCH344 was
occasionally used to assess whether any Archaea were present. The slides were
placed in an equilibrated humidity chamber at 35 °C for 2 h to hybridize. The slides
were thereafter rinsed with distilled water and immersed in a washing buffer (20 mM
Tris-HCl, 0.1% (w/v) SDS, and 0.34 M of NaCl) for 15 min at 50°C, followed by
rinsing with distilled water and air-drying. Before microscopic analysis, 10 pi of
DAPI (Sigma; 1 pg L"') was added to each spot for two minutes. Finally, the slides
were rinsed with distilled water, air dried and mounted with Citifluor (Citifiuor Ltd,
UK). For the viability analysis, 6 pL of cell suspension were added into a slide and
allowed to air dry. Then, 6 |iL of DAPI and PI (Sigma; 0.3 pg L"') were added to
each spot and rinsed after 2 min. The slides were analyzed using a fluorescence
microscope (Olympus BX51, Middlesex, UK) equipped with a digital photographic
46
Chapter 2
camera (Olympus DP 50). Images were acquired using specialized imaging software
(Analysis - Soft Imaging System version 3.2, Helperby, UK).
Table 2.2. Probes used in Chapter 1
Probe Sequence (5'^ 3') Source Fluor'
EUB338I GCT GCC TCC CGT AGO AGT Amann et al., 1990 FITC
NonEUB338 CGA CGG AGO GCA TCC TCA Manz et al., 1992 FITC
GJIO CAC CAA CCT CTC TCG AAC TC Emanuelsson et al., 2005 Cy3
ARCH344 TCG CGC CTG CTG CIC CCC GT Raskin et al., 1994 Cy3
^The fluorochrome modification was attached to the 5'- end of the sequence.
2.3.7 Flow Cytometry
Flow cytometry was performed on an EPICS ALTRA (Beckman Coulter) equipped
with a sorting system (10,000 cells/sec), a Coherent Enterprise II 621 Laser (351-364
nm and 488 nm) and an air-cooled red HeNe Laser (633 nm). Analysis of the results
was accomplished using the EXP02 Cytometry Software. The suspended cells were
analysed with a flow rate between 250-300 particles.s"'. Cell samples were harvested
from the bioreactor into 1.5 mL eppendorf tubes, and then washed in PBS and 0.1%
igepal through a sterile needle (to break the major clumps). For counterstaining
analysis, the cells were stained in PI for 1 min and then rinsed in PBS and
centrifuged 3 times. For liquid in situ hybridisation, the cells were serially
dehydrated by the addition of ImL of ascending ethanol concentrations (50, 80 and
100% (v/v)) for 3 minutes each step and centrifuging in between. A 36 |a,L aliquot of
hybridisation solution (same composition as in 2.3.6), and 2 ^L of probe were added
to each tube. The tubes were then placed to hybridise for 2 h at 45 °C. The tubes
were thereafter centrifiiged and the sample washed for 15 minutes at 45 °C in 0.5 mL
of a washing buffer (same composition as in 2.3.6). Samples were thereafter washed
and resuspended in 0.9 mL PBS and 10 mL of 0.1% igepal. The pre-treatments
applied to the samples consisted in ultrasonicating the samples for 5 to 20 seconds,
and washing the samples up to three times in PBS and igepal through a needle.
47
Chapter 2
2.3.8 DNA extraction and PGR reaction
Bacterial samples harvested from the reactor were washed in sterile PBS. DNA
extraction was performed using the UltraClean Microbial Genomic Isolation Kit
(MoBio, Carlsbad, USA) according to the manufacturer's instructions (see appendix
A for optimisation). The primers (MWG Biotech, Ebersberg, Germany) 518R (5'
ATTACCGCGGCTGCTGG 3') and GC-341F (5' CGCCCGCCG
CGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAG
CAG 3') targeting the V3 region of the 16S rDNA were used for the amplification of
DNA fragments corresponding to bases 341-518 with reference to the Escherichia
coli sequence. The PCR reactions were performed using 1 pL of DNA template and
24 jaL of a PCR mix (3 mM of MgCli, 0.5x NH4SO4 PCR buffer, 0.5x KCl PCR
buffer, 200 of dNTP's, 0.3pM of each primer and 1 U of Taq DNA polymerase
(Fermentas, Lithuania)). The following cycle condi