Impact of single-nucleotide polymorphisms at the TP53-bindingand responsive promoter region of BCL2 gene in modulatingthe phenotypic variability of LGMD2C patients

Ikhlass Hadj Salem • Fatma Kamoun •

Nacim Louhichi • Moez Trigui • Chahnez Triki •

Faiza Fakhfakh

Received: 15 September 2011 / Accepted: 30 January 2012 / Published online: 25 February 2012

� Springer Science+Business Media B.V. 2012

Abstract Apoptosis of skeletal muscle fibers is a well-

known event occurring in patients suffering from muscular

dystrophies. In this study, we hypothesized that functional

polymorphisms in genes involved in the mitochondrial

apoptotic pathway might modulate the apoptotic capacity

underlying the muscle loss and contributing to intrafamilial

and interfamilial variable phenotypes in LGMD2C (Limb

Girdle Muscular Dystrophy type 2C) patients sharing the

same c.521delT mutation in SGCG gene. Detection of

apoptosis was confirmed on muscle biopsies taken from

LGMD2C patients using the TUNEL method. We geno-

typed then ten potentially functional SNPs in TP53, BCL-2

and BAX genes involved in the mitochondrial apoptotic

pathway. Potential genotype-dependent Bcl-2 and p53

protein expressed in skeletal muscle was investigated using

western blot and ELISA assays. The result showed that

muscle cells carrying the TP53-R72R and TP53-16 bp del/

del genotypes displayed an increased p53 level which

could be more effective in inducing apoptosis by activation

of the pro-apoptotic gene expression. In addition, the

BCL2-938 AA genotype was associated with increased

Bcl-2 protein expression in muscle from LGMD2C patients

compared to -938CC genotype, while there was no evi-

dence of significant difference in the BAX haplotype. Our

findings suggest that increased Bcl-2 protein expression

may counteract pro-apoptotic pathways and thus reduce the

muscle loss. To the best of our knowledge, this is a pioneer

study evaluating the role of apoptotic BCL-2 and TP53

genes in contributing to the phenotypic manifestation of

c.521delT mutation in LGMD2C patients. Larger studies

are needed to validate these findings.

Keywords Apoptosis � Bcl-2 � p53 � Single nucleotide

polymorphism � Phenotypic heterogeneity � LGMD2C

Introduction

Apoptosis is observed during normal development in most

tissues and it is a well-known event during skeletal muscle

myogenesis [1, 2]. In addition, apoptosis of skeletal muscle

fibers has been produced in rodents in various experimental

conditions whereas apoptosis of muscle fibers occurring in

humans suffering from different neuromuscular disorders

remains controversial [3, 4]. Some studies have reported

apoptosis of muscle fibers in patients suffering from spinal

muscular atrophy [5] as well as in those suffering from

muscular dystrophies [6]. However, other studies have

failed to demonstrate apoptosis of myonuclei in these dis-

orders and in muscle fibers of patients affected by

inflammatory myopathies [7, 8]. Since skeletal fibers are

mitochondria-rich, several signalling pathways of skeletal

muscle apoptosis are currently under intense investigation

with a particular focus on the role played by mitochondria

[9, 10].

I. Hadj Salem (&) � N. Louhichi � F. Fakhfakh (&)

Laboratoire de Genetique Moleculaire Humaine, Faculte de

Medecine de Sfax, Universite de Sfax, Avenue Magida Boulila,

3029 Sfax, Tunisia

e-mail: ikhlass_hadj82@yahoo.com

F. Fakhfakh

e-mail: faiza.fakhfakh@gmail.com

F. Kamoun � C. Triki

Service de Neurologie Pediatrique, CHU Hedi Chaker de Sfax,

Sfax, Tunisia

M. Trigui

Service d’Orthopedie et Traumatologie, CHU Habib-Bourguiba

de Sfax, Sfax, Tunisia

123

Mol Biol Rep (2012) 39:7479–7486

DOI 10.1007/s11033-012-1581-4

Muscle atrophy is a genetically-controlled process

involving the activation of the apoptotic pathways and the

ubiquitin- proteasome systems [11]. Although the exact

mechanisms underlying the loss of muscle mass are far to

be unveiled, accumulating preclinical evidence suggests

that acceleration of myocytes loss via apoptosis might

represent a key mechanism driving the onset and progres-

sion of muscle loss and leading to phenotypic heteroge-

neity [11, 12].

A wide clinical spectrum has been reported in patients

with LGMD2C (Limb Girdle Muscular Dystrophy type 2C)

ranging from Duchenne-like features with acute muscle

atrophy to adult-onset LGMD with minimal symptoms.

The age of onset, rate of progression and severity can vary

between and within affected families [13, 14]. This mul-

tiplicity of symptoms and signs cannot be explained on the

basis of the specific mutation alone. It depends on the

interactions with other genetic and/or epigenetic factors.

Therefore, we hypothesized that functional polymorphisms

in genes involved in the mitochondrial apoptotic pathway

might modulate the apoptotic capacity phenotype under-

lying the loss of muscle, thus contributing to intrafamilial

and interfamilial variable phenotypes caused by the iden-

tical mutation c.521delT.

Materials and methods

Study patients

The affected patients were all homozygous for the same

mutation c.521delT responsible for the LGMD2C. They

were clinically evaluated according to the Vignos scale

[15]. The main clinical features of the eight patients are

summarized in Table 1. Notable intrafamilial and interfa-

milial phenotypic variability existed among these patients

in the following parameters: age of onset, pace of pro-

gression and extent of limb weakness and disability

(Table 1).

Muscle tissue specimens

Biopsies were taken from the median head of the deltoid

muscle, for diagnosis purposes, and were used after the

patients’ informed consent. Four muscle biopsies from

healthy individuals and five from LGMD2C patients were

analyzed. A part of each biopsy specimen was frozen

immediately after excision in isopentane cooled by means

of liquid nitrogen and was stored at -80�C. Serial Sec-

tions 4 lm in thickness were cut in a cryostat microtome,

dried at room temperature, and directly stained or stored at

-80�C.

Detection of apoptosis

To detect apoptosis in muscle tissue we used the TUNEL

assay with an in situ Cell Death Detection kit (Fluorescein,

Roche) according to the manufacturer’s recommendations.

Positive controls were made by incubating some sections

with 0.5 mg/ml DNAse I (Promega) at room temperature

for 10 min before TUNEL staining. DNAse I treated sec-

tions incubated with fluorescein-labeled nucleotide mixture

without the addition of terminal deoxynucleotidyl trans-

ferase, were used as negative controls. The slides were

washed with phosphate buffer saline (PBS) and stained

with a 4,6-diamidino-2-phenylindole (DAPI: 100 ug/l)

solution for 20 min at room temperature. The slides were

analyzed using a fluorescence Microscope (Axioskop Z

plus Zeiss). All the experiments were conducted three to

four times with appropriate controls.

Genotyping

The genotyping methods used to distinguish the 10 selected

polymorphisms in 3 apoptosis-related genes TP53, BCL2

and BAX are presented in Table 2. Direct sequencing was

used for detecting four polymorphisms: c.459?1619 A[G

in BCL-2 and c.34?43 C[T; c.233?14 A[G and c.824

G[A in BAX genes. Genotyping methods for six SNPs

were previously described and detected by using either

PCR–RFLP (c.215 C[G and c.672?62 A[G in TP53

gene; -938 C[A and c.127 G[A in BCL-2 gene) or PCR-

PIRA (-248 G[A in BAX gene) or standard PCR (16-bp

ins/del in TP53 gene) [Table 2; [16, 17]]. The PCR

amplification was performed in a thermal cycler (Gene-

Amp PCR System 9700 (Applied Biosystems)) in a final

volume of 50 ll using 200 ng DNA, 8 pmol of each pri-

mer, 2 mM MgCl2, 500 lM dNTP, 1 9 PCR buffer, and

2 U Taq DNA polymerase. The conditions for the PCR

were as follows: initial denaturation at 95�C for 5 min,

followed by 10 cycles: 40 s at 95�C, 45 s at 66–60�C, and

45 s at 72�C, and then 35 cycles at 95�C for 40 s, 60�C for

45 s, 72�C for 45 s, and a final extension at 72�C for

10 min.

As regards the BCL2 (-938 C[A) polymorphism in the

promoter, the primers amplified a 262 bp DNA fragment.

Then, the PCR product was digested by BccI (New Eng-

land BioLabs) overnight at 37�C. The wild-type allele

(AA) produced two bands of 154 and 108 bp; wild-type/

variant allele (CA) produced three bands of 108, 154 and

262 bp and the variant allele (CC) produced a single

262 bp band (Table 2).

Regarding the BAX (-248 G[A) polymorphism in the

promoter, the forward primer (CATTAGAGCTGCG-

ATTGGACCG), in which the -2 C was introduced to

create a MspI restriction site, and the reverse primer

7480 Mol Biol Rep (2012) 39:7479–7486

123

(GCTCCCTCGGGAGGTTTGGT), amplified a 109 bp

DNA fragment (Table 2). Then, the PCR product was

digested by MspI (Fermentas) overnight at 37�C.

As for the TP53 (Arg72Pro) polymorphism in the pro-

moter, the primers amplified a 296 bp DNA fragment.

Then, the PCR product was digested by BstUI (New

England BioLabs) overnight at 60�C. The wild-type allele

(GG) produced two bands of 169 and 127 bp); wild-type/

variant allele (GC) produced three bands of 127, 169 and

296 bp and the variant allele (CC) produced a single

296 bp band (Table 2). Genotypes identified by PCR–

RFLP were confirmed with DNA sequencing using an ABI

PRISM� 3100 DNA sequencer.

Western-blot analysis of Bcl-2 expression in muscle

samples

We investigated the association between the CC, AC and

AC genotypes of polymorphism BCL-2 (-938 C[A) and

Bcl2 protein expression level in muscle. Nine muscle

biopsies were solubilized in treatment buffer in the pres-

ence of protease inhibitors. Protein concentration was

determined according to Bradford [18]. After denaturation

for 5 min at 100�C, sodium dodecyl sulphate (SDS)–

polyacrylamide gel electrophoresis was performed using of

equal amounts of muscular proteins, followed by transfer to

nitrocellulose filters. After blocking the reaction with 5%

milk powder and incubation with the primary antibodies

(anti-Bcl2 diluted titer of 1/1,000 and anti a-dystroglycan

diluted titer of 1/2,000), the nitrocellulose sheet was further

incubated with a mouse peroxidase-conjugated secondary

antibody (1/5,000) and developed using an enhanced

chemiluminescence system (Immun-Star HRP kit Bio-Rad)

according to the manufacturer’s instructions. Films were

scanned and densitometry was used to quantify the

immunoblot signals. To compare protein expression among

the different genotypes, the average intensity of the signal

was multiplied by the number of pixels in that area and

normalized to a-dystroglycan expression. The following

antibodies were used: mouse monoclonal anti-Bcl2 anti-

body (Invitrogen), mouse anti- a-dystroglycan antibody

(VIA4-1; Upstate Biotechnology), and mouse peroxidase-

conjugated secondary antibody (IgG H?L code 75031

Sanofi Diagnostics Pasteur).

Enzyme linked immunosorbent assay (ELISA)

Wells from microliter plates were coated with muscular

proteins for 2 h at 37�C and then overnight at 4�C. The

plates were washed with PBS-Tween and blocked with 1%

non-fat, powdered milk in PBS-Tween for 1 h at 37�C.

After three washings, monoclonal anti-Bcl-2, monoclonal

anti-p53 (Santa Cruz Biotechnology; diluted titer of

1:100)) and mouse anti- a-dystroglycan antibodies were

used for 2 h at 37�C. Dilution was the same as that used in

western blot assay. The plates were washed and peroxy-

dase-conjugated anti-mouse IgG (diluted titer of 1:5,000 in

the PBS-Tween) was added for 1 h at 37�C. Three wash-

ings were performed, and the chromogenic reagent tetra-

methylbenzidine (TMB) was used to reveal the binding of

the peroxidase-conjugated second antibody. The reaction

was stopped by adding 50 ll of 2 M H2SO4 to each well,

and the resulting absorbance was measured at 450 nm.

Statistical analysis

To test the genotype-dependent differences in protein

expression (Western-blot analysis), we performed pairwise

comparisons using Student t test. Differences were regar-

ded significant at P values less than 0.05.

Table 1 Clinical and paraclinical data of LGMD2C patients sharing the c.521delT mutation

Patients Current age

[years]/sex

Age of onset

[years]

Serum CK

(UI)/age [years]aCalves

hypertrophy

Functional

gradebWheelchair bound

(age [years])

P1 17/M 4 11,900/8 – 10 10

P10 13/F 9 9,000/9 ? 2 –

P2 22/M 11 735/18 ? 10 14

P20 18/M 5 650/15 – 10 10

P3 13/F 5 8,110/7 – 10 9

P4 17/M 7 10,570/8 ? 10 12

P40 13/F 10 9,875/11 ? 3 –

P5 9/F 7 10,840/7 – 3 –

P6 8/F 6 10,485/7 – 3 –

M male, F female, CK Creatine Kinase, ? present, – absenta Normal value of CK: 25–350 IU/Lb Clinical testing are based on a scale of 10 [15]

Mol Biol Rep (2012) 39:7479–7486 7481

123

Results

Apoptosis assay

To investigate the mechanism of myofiber degeneration in

c-sarcoglycan deficiency, TUNEL staining was performed

on deltoid muscle biopsies from LGMD2C patients and

healthy individuals. No TUNEL positive myonuclei were

detected in healthy muscle (Fig. 1, HI). In contrast,

TUNEL-positive myonuclei were commonly found in

LGMD2C patients’ muscle (Fig. 1, P1 and P4) indicating

that apoptosis contributed to muscle degeneration in c-

Fig. 1 Apoptosis in LGMD2C deltoid muscular biopsies. Cross-

sections from healthy individual (HI) and LGMD2C patients (P1 and

P4) were labeled for apoptosis staining by TUNEL. Digitized images

were merged to superimpose the TUNEL labeled nuclei (greenpseudocolor field) with the DAPI staining to mark the cells and

discriminate myonuclei from outer nuclei. No TUNEL positive

nucleus was detected in the normal muscle whereas, in the LGMD2C

patients, positive nuclei can be observed in some fibers. Three

successive tissue sections for each sample were examined by

Fluorescence microscopy (magnification 940). Color figure online

Table 2 Genotyping assays for the selected polymorphisms

Gene Position and

base change

Genotyping method Primer PCR

product

Enzyme Gel band

pattern

TP53 p.R72P G[C

(rs1042522)

PCR–RFLP F: 50ATCTACAGTCCCCCTTGCCG30 296 bp BstUI G allele: 169

and 127 bp

R: 50GCAACTGACCGTGCAAGTCA30 C allele: 296 bp

16-bpins/del

(rs17878362)

PCR F: 50TGGGACTGACTTTCTGCTCTT30 Del: 180 bp

R: 50TCAAATCATCCATTGCTTGG30 Ins: 196 bp

c.672?62 G[A

(rs1625895)

PCR–RFLP F: 50TGGCCATCTACAAGCAGTCA30 404 bp MspI G allele:

336 bp,

68 bp

R: 50TTGCACATCTCATGGGGTTA30 A allele: 404 bp

BCL2 -938 C[A

(rs2279115)

PCR–RFLP F: 50TCCTGCCTTCATTTATCCAGCA30 262 bp Bcc I A allele:

154 bp,

108 bpR: 50CCAGGAGAGAGACAGGGGACA30

C allele: 262 bp

c.127 G[A

(rs1800477)

PCR–RFLP F: 50CCCGTTGCTTTTCCTCTGGGA30 178 bp Bgl I G allele: 157 bp,

21 bp

R: 50AGAAGATGCCCGCCGCGGGG30 A allele: 178 bp

c.458?1619 G[A

(rs4987853)

Direct

sequencing

F: 50TCTGTTGTCCCTTTGACCTTG30 196 bp

R: 50GGCCACGTAAAGCAACTCTC30

BAX -248 G[A

(rs4645878)

PIRA–PCR:

Mismatch,

sense primer

-2 G-to-C

F: 50CATTAGAGCTGCGATTGGACCG30 109 bp MspI G allele: 89 bp,

20 bp

R: 50GCTCCCTCGGGAGGTTTGGT30 A allele: 109 bp

c.34?43 C[T

(rs4645881)

Direct

sequencing

F: 50CATTAGAGCTGCGATTGG30 406 bp

R: 50CTCAGTGCTTGGAGATCG30

c.233?14 A[G

(rs1805419)

Direct

sequencing

F: 50CCGTCACTTTATCTGCTAGG30 521 bp

R: 50GGCCCAGACTCCTAGTTCTTAG30

c.824 G[A

(rs704243)

Direct

sequencing

F: 50AATGCCCGTTCATCTCAG30 371 bp

R: 50CCTCAAGACCACTCTTCC30

7482 Mol Biol Rep (2012) 39:7479–7486

123

sarcoglycan deficient muscular dystrophy. Apoptotic fea-

tures were seen outside the myofiber, presumably in

mononuclear cells of LGMD2C interstitial muscular tissue

and in some fibers, but were also seen in intact or partially

degenerated muscle fibers (Fig. 1). The presence of

TUNEL-positive myonuclei in muscle fibers suggests that

c-sarcoglycan deficiency leads to apoptosis as an event in

the dystrophic process.

Genotyping

Since apoptotic phenotype was confirmed with TUNEL

assay and in order to explain the phenotypic heterogeneity

observed in the LGMD2C patients sharing the same

mutation c.521delT, we performed a genotype-phenotype

analysis using polymorphisms in apoptotic genes. Poly-

morphisms were included in this study if they might the-

oretically result in amino acid changes (nonsynonymous

SNP, nsSNP), or they are located at regulating regions such

as promoters, or reportedly associated with known pheno-

typic effects. We selected 10 potentially functional poly-

morphisms in 3 genes that were, TP53, BCL-2 and BAX

genes involved in the mitochondrial pathway. Figure 2

shows the haplotypes construction performed for all vari-

ants. With regard to SNPs in TP53 gene, we note two

different haplotypes: one haplotype includes variant het-

erozygotes for TP53 c.215C/G (p.R72P), TP53 intron 3

16-bp ins/del and TP53 c.672 ? 62A/G (TP53 intron 6

A/G), whereas the other haplotype includes variant in

homozygous state: c.215G (p.72R), 16 bp del/del and

c.672 ? 62G (Fig. 2).

The study of genotyping of the polymorphisms sites in

Bcl-2 family members’ genes showed similar genotypes for

-248 G[A; c.34?43 C[T; c.233?14 A[G; and c.824

G[A in Bax and c.127 G[A and c.458?1619 G[A in Bcl-

2 genes whereas the most studied polymorphism site -938

C[A in Bcl-2 gene showed different genotypes: CC, AA

and CA (Fig. 2).

Effects of the BCL2-938 C[A polymorphism on Bcl-2

protein expression in muscular biopsies

We investigated potential genotype-dependent Bcl-2 pro-

tein expression in skeletal muscle from LGMD2C patients

and healthy individuals. As shown in Fig. 3a, expression of

Bcl-2 in patients with -938 AA genotype was increased

significantly compared with that in muscle from LGMD2C

patients with CC genotypes. Protein expression associated

with the AC genotype was somehow more variable,

showing low expression compared to that seen in CC

genotypes, intermediate expression in another sample and

higher expression in one sample resembling the AA

genotype. To correct the variations in total protein, blots

were also probed with an anti-a-dystroglycan antibody.

After densitometry of Bcl-2 and a-dystroglycan specific

bands, the ratios of Bcl2/a-dystroglycan were computed

Fig. 2 Pedigree of the Tunisian

families harboring the

c.521delT mutation and

showing the haplotypes of

regulatory SNPs in apoptotic

genes TP53, BCL-2 and BAX.

m: mutation c.521delT in SGCGgene. We note two different

haplotypes for TP53 SNPs

(simple and double framed in

red) and three different

genotypes CC, AA and CA for

BCL2-938C/A polymorphism

(simple and double framed in

blue). Non-boxed genotypes for

the remaining SNPs are non-

informative for all patients.

Color figure online

Mol Biol Rep (2012) 39:7479–7486 7483

123

and associated with BCL2 genotypes (Fig. 3b). The ratios

Bcl2/a-dystroglycan were almost threefold higher when

comparing AA (0.980 ± 0.07) with CC genotypes

(0.31 ± 0.07; P = 0.0009; Student’s t test) whereas

intermediate ratios were found associated with the AC

genotype (0.54 ± 0.11). Thus, an increased activity of the

inhibitory P2 promoter appears to result in an accordingly

reduced bcl-2 protein expression associated with the CC

genotype.

From the result of ELISA assay, and as found in western

blot analysis, we found that CC genotype correlated with

low Bcl-2 expression, while AA genotype correlated with

the highest expression which confirms the western blot

result (Fig. 3c). We noted also the expression level of p53

in each genotype. Figure 3c shows the rate of p53

expression in each genotype. P53 expression was signifi-

cantly higher in TP53 R72R, 16 bp-del/del haplotype car-

riers (Fig. 3c). The expression of Bcl-2 and p53 was found

to be slightly lower in normal muscle.

Discussion

The Tunisian families described here bear the LGMD2C

after clinical, genetic and molecular investigation.

Although the patients shared the same mutation c.521delT

in SGCG gene and displayed similar mild limb girdle

muscular dystrophy phenotypic features, heterogeneity was

expressed by variability in the age of onset, in the age of

wheelchair-bound and in the course of the disease.

Understanding the intrafamilial clinical variability in

patients carrying the same mutation remains a great

challenge.

In this study, we performed genotype–phenotype anal-

ysis to examine the role of potentially functional variants in

TP53, BCL-2 and BAX apoptotic genes in modulating the

phenotype expression. An intriguing finding in the present

study is the significant difference in TP53 and BCL-2

haplotypes found between LGMD2C patients. TUNEL

assay was performed on histologically affected muscle

biopsies of five LGMD2C patients. The results demonstrate

the presence of myofibers presenting TUNEL-positive

nuclei. An increase in apoptosis and detection of TUNEL-

positive nuclei were found in biopsies from gsg-/-mice

suggesting that programmed cell death contributes to

myofiber degradation [19].

The bcl-2 family of proto-oncogenes encodes specific

proteins which are a well-known group of death-modulat-

ing factors regulated by the p53 transcriptional factor and

involved in the mitochondrial apoptotic pathway. Bcl-2

inhibits cell death in a variety of mammalian cell types,

whereas its homologous protein, Bax, promotes cell death

via apoptosis [20].

A total number of 14 polymorphisms have been identi-

fied in the TP53 gene but the most intensively studied ones

being R72P (c.215 C[G), p53-16 bp del/ins (intron 3), and

c.672?62 A[G (intron 6). Here we show for the first time

that biopsy muscle from LGMD2C patients carrying TP53

R72 and 16-bp deletion variants may display an increased

p53 level which is more effective to induce apoptosis by

inducing pro-apoptotic gene expression. In fact, the Pro72

and Arg72 variants were reported to differ in their

Fig. 3 Correlation between Bcl2-938 C/A, R72P, 16 bp ins/del TP53

genotypes and protein expression. a Genotype-dependent expression

of Bcl-2 protein in muscle from LGMD2C patients. Western-blot

analyses of muscle from patients with genotype BCL2-938 AA

showed increased expression of Bcl-2 protein (28 kDa) compared to

those from patients with BCL2-938 AC and BCL2-938 CC genotypes.

Alpha-dystroglycan (156 kDa) was used as a standard to allow for

normalization to differential protein loading. b Quantitative analysis

of protein expression shown in panel A. Densitometry was performed

using Scion Image statistical analysis. Horizontal bars represent the

mean value of the three values of each genotype. c The p53 and Bcl-2

expression levels were measured using the ELISA technique for the

different genotypes found in our genotype–phenotype analysis. HIHealthy individuals. The absorbance was read at 450 nm

7484 Mol Biol Rep (2012) 39:7479–7486

123

functional activity: the Arg72 variant suppressed effec-

tively cellular transformation, and was more efficient than

the Pro72 variant at inducing apoptosis [21, 22]. The

expression of p53 pro-apoptotic target genes and the

mitochondrial apoptotic response in p53-null cell lines

stably transfected with constructs that encode p53-R72 is

higher than in cell lines expressing the p53-P72 variant,

supporting the current view that p53-R72 is a more potent

inducer of apoptosis than p53-P72 [21]. Thus, the muscle

cells carrying the arginine allele may have greater sus-

ceptibility to apoptosis (Fig. 4). In addition, the 16 bp

deletion allele was described to be associated with high

level of TP53 transcript in lymphoblastoid cell lines,

whereas the 16 bp insertion allele might influence alter-

native splicing of p53 protein, leading to unstable tran-

scripts or proteins with altered activities and reduction of

interaction with the pro-apoptotic members [23].

Anti-apoptotic BCL-2 gene plays an important role in

the regulation of apoptosis. Previous studies had examined

the significance of apoptosis in muscular dystrophies

pathogenesis by inhibiting apoptosis through either inacti-

vation of the pro-apoptosis protein Bax or overexpression

of the anti-apoptosis protein Bcl-2 [20]. In this study, we

found that muscle from patients homozygous for the

-938A allele displayed an increased Bcl-2 protein

expression while -938CC genotype correlated with the

lowest expression. As indicated in previous literature, this

polymorphism was located in the second promoter (P2) of

the BCL-2 gene, which worked as a negative modulator on

the first promoter (P1) and subsequently, BCL-2 gene

expression [24].This may suggest that the significantly

higher activity of the C allele may decrease more effi-

ciently the activation of the predominant promoter, P1. We

speculate then that C allele may result in a down-regulation

of bcl-2 mRNA transcript levels, a decrease in cellular

levels of bcl-2 protein, unregulated programmed cell death

which enhances loss of the muscle mass leading to a more

severe phenotype (Fig. 4).

A role for Bcl-2 in muscle pathology has been suggested

indicating that Bcl-2 is expressed in response to injury in

order to counter-act pro-apoptotic pathways and thus to

reduce the muscle loss [25]. Indeed, an overexpression of

Bcl-2 in myoblasts from mdx-mice was shown to prevent a

rise in intracellular Ca2?, and thus inhibiting apoptosis

[26]. It has been suggested that Bcl-2 may also act as an

antioxidant, thus protecting cells from free radicals [25].

Since free radical toxicity has been hypothesized as being

related to muscle fiber damage in several muscle disorders,

we cannot rule out the possibility that the expression of

these apoptosis-related proteins may reflect some protec-

tive mechanism of the injured muscle fiber against free-

radical cytotoxicity. Interestingly, this has been supported

in interventional animal studies [25].

Our observation indicates the possibility of apoptotic

BCL-2 and TP53 genes contributing to the phenotypic

manifestation of homozygous c.521delT mutation in our

patients, which, of course, requires confirmation from

independent studies to support this investigation. Although

the number of patients in each family is small and this

phenotypic expression could occur by chance, perhaps the

intrafamilial heterogeneity observed in our patients, toge-

ther with the interfamilial heterogeneity, could help us to

better understand which modifying factors play a role in

the different manifestations of the disease.

Acknowledgments We are grateful to the family members for their

invaluable cooperation. We are grateful to Pr. Raja Mokdad Gargouri

from Centre of Biotechnology of Sfax, for providing us the p53

antibody. We also acknowledge Mr. Jamil JAOUA, founder and

former head of the English Unit at the Sfax Faculty of Science,

Tunisia, for proofreading this paper.

References

1. Webb J (1977) Cell death in developing skeletal muscle: histo-

chemistry and ultrastructure. J Pathol 123:175–180

Fig. 4 Hypothesized mechanism for interaction between the Bcl2-

938 C/A and R72P, 16 bp ins/del TP53 polymorphisms and severity

of phenotype. LGMD2C patients who possess the proposed trans-

criptionally inactive Bcl-2-938C allele and R72R, 16-bp del/del

haplotype in TP53 gene may have reduced local BCL-2 levels,

resulting in suppressed Bcl-2-mediated inhibition of apoptosis,

enhanced programmed cell death by inducing expression of pro-

apoptotic genes, loss of muscle mass and subsequent more severe

phenotype

Mol Biol Rep (2012) 39:7479–7486 7485

123

2. Fidzianska A, Goebel H (1990) Human ontogenesis: cell death in

fetal muscle. Acta Neuropathol 81:572–577

3. Carraro U (1995) Apoptotic death of dystrophic muscle fibers

after exercise: a new hypothesis on the early events of muscle

damage. Basic Appl Myol 5:371–374

4. Podhorska-Olokov M, Sandri M, Bruson A et al (1995) Apoptotic

myonuclei appear in adult skeletal muscles of normal and mdxmice after mild exercise. Basic Appl Myol 5:87–90

5. Tews DS, Goebel H (1997) Apoptosis-related proteins in skeletal

muscle fibers of spinal muscular atrophy. J Neuropathol Exp

Neurol 56:150–156

6. Tews DS, Goebel H (1997) DNA-fragmentation and expression

of apoptosis-related proteins in muscular dystrophies. Neuropa-

thol Appl Neurobiol 23:331–338

7. Schneider C, Gold R, Dalakas M et al (1996) MHC class

I-mediated cytotoxicity does not induce apoptosis in muscle

fibers nor in inflammatory T cells: studies in patients with pol-

ymyositis, dermatomyositis and inclusion body myositis. J Neu-

ropathol Exp Neurol 55:1205–1209

8. Olive M, Mtnez-Matos JA, Montero J et al (1997) Apoptosis is

not the mechanism of cell death of muscle fibers in human

muscular dystrophies and inflammatory myopathies. Muscle

Nerve 20:1328–1330

9. Pellegrino MA, Desaphy JF, Brocca L et al (2011) Redox

homeostasis, oxidative stress and disuse muscle atrophy. J Phys-

iol 589:2147–2160

10. Dam AD, Mitchell AS, Rush JWE, Quadrilatero J (2011) Ele-

vated skeletal muscle apoptotic signaling following glutathione

depletion. Apoptosis. doi:10.1007/s10495-011-0654-5

11. Marzetti E, Leeuwenburgh C (2006) Skeletal muscle apoptosis,

sarcopenia and frailty at old age. Exp Gerontol 41:234–238

12. Marzetti E, Privitera G, Simili V et al (2010) Multiple pathways

to the same end: mechanisms of myonuclear apoptosis in sarco-

penia of aging. Sci World J 19:340–349

13. Angelini C, Fanin M, Freda MP et al (1999) The clinical spec-

trum of sarcoglycanopathies. Neurology 52:176–179

14. Sandona D, Betto R (2009) Sarcoglycanopathies: molecular

pathogenesis and therapeutic prospects. Expert Rev Mol Med

11:e28. doi:10.1017/S1462399409001203

15. Vignos PJ, Spencer GE, Archibald KC (1963) Management of

progressive muscular dystrophy of childhood. J Am Med Assoc

194:89–96

16. Zhibin H, Chunying L, Kexin C et al (2008) Single nucleotide

polymorphisms in selected apoptotic genes and BPDE-induced

apoptotic capacity in apparently normal primary lymphocytes: a

genotype–phenotype correlation analysis. J Cancer Epidemiol.

doi:10.1155/2008/147905

17. Chen K, Hu Z, Wang LE et al (2007) Single-nucleotide poly-

morphisms at the TP53-binding or responsive promoter regions

of BAX and BCL2 genes and risk of squamous cell carcinoma of

the head and neck. Carcinogenesis 28:2008–2012

18. Rajini S, Barkha P, Hamadeh J (2009) Comparison of total pro-

tein concentration in skeletal muscle as measured by the Bradford

and Lowry Assays. J Biochem 145:791–797

19. Hack A, Chantal T, Fang J et al (1998) c-Sarcoglycan deficiency

leads to muscle membrane defects and apoptosis independent of

dystrophin. J Cell Biol 142:1279–1287

20. Miller JB, Girgenrath M (2006) The role of apoptosis in neuro-

muscular diseases and prospects for anti-apoptosis therapy.

Trends in Mol Med 12:279–286

21. Dumont P, Leu J, Della Pietra A et al (2003) The codon 72

polymorphic variants of p53 have markedly different apoptotic

potential. Nat Genet 33:357–365

22. Thomas M, Kalita A, Labrecque A et al (1999) Two polymorphic

variants of wild-type p53 differ biochemically and biologically.

Mol Cell Biol 19:1092–1100

23. Gemignani F, Moreno V, Landi S et al (2004) A TP53 poly-

morphism is associated with increased risk of colorectal cancer

and with reduced levels of TP53 mRNA. Oncogene

23:1954–1956

24. Young RL, Korsmeyer SJ (1993) A negative regulatory element

in the bcl-2 50-untranslated region inhibits expression from an

upstream promoter. Mol Cell Biol 13:3686–3697

25. Basset O, Boittin FX, Cognard C et al (2006) Bcl-2 overex-

pression prevents calcium overload and subsequent apoptosis in

dystrophic myotubes. Biochem J 395:267–276

26. Danielssona O, Nilssonb C, Lindvallc B et al (2009) Expression

of apoptosis related proteins in normal and diseased muscle: a

possible role for Bcl-2 in protection of striated muscle. NMD

19:412–417

7486 Mol Biol Rep (2012) 39:7479–7486

123