Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3-DIOXYGENASE
DURING ACUTE INFLUENZA INFECTION
by
JULIE MARIE FOX
(Under the Direction of Ralph A. Tripp)
ABSTRACT
Influenza virus is a worldwide concern causing significant morbidity and
mortality. Although vaccines are available to prevent infection, the vaccine is targeted
toward homologous strains of influenza virus providing limited heterologous protection.
The majority of the cross-protection is derived from T cell immunity which is directed
primarily at the conserved internal proteins of influenza virus. Enhancing the T cell
response during vaccination could provide better cross-protection and perhaps reduce the
need for seasonal vaccines. We hypothesized that modulating the activity of indoleamine
2, 3-dioxygenase (IDO) during influenza virus infection could enhance the immune
response augmenting T cell memory to the vaccine. IDO has been shown to suppress the
immune response through depletion of tryptophan and production of kynurenine
metabolites. Pharmacological inhibition of IDO during acute influenza infections
resulted in enhanced Th1-type response and memory T cell responses. Assessment of
early immune time-points following infection revealed IDO inhibition enhanced cytokine
production, and IDO activity was induced in alveolar epithelial cells through IFN-λ
stimulation. 1MT treatment increased the pro-inflammatory response with increased
expression of TNF-α and IL-6 following influenza virus infection. The enhanced pro-
inflammatory response with IDO inhibited was modulated by the alveolar macrophage
population residing in the lung airways. Together, these finding show a role for IDO
during influenza virus infections and provide insight into the potential use of IDO
modulation for vaccine and therapeutic designs.
INDEX WORDS: Influenza, IDO, 1MT, T cells, IFNλ, epithelial cells, alveolar
macrophages
IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3-DIOXYGENASE
DURING ACUTE INFLUENZA INFECTION
by
JULIE MARIE FOX
BS, University of Central Florida, 2008
A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial
Fulfillment of the Requirements for the Degree
DOCTOR OF PHILOSOPHY
ATHENS, GEORGIA
2013
© 2013
Julie Marie Fox
All Rights Reserved
IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3-DIOXYGENASE
DURING ACUTE INFLUENZA INFECTION
by
JULIE MARIE FOX
Major Professor: Ralph A. Tripp
Committee: S. Mark Tompkins
Kimberly D. Klonowski
Wendy T. Watford
Donald A. Harn
Electronic Version Approved:
Maureen Grasso
Dean of the Graduate School
The University of Georgia
December 2013
iv
DEDICATION
This work is dedicated to my mom and dad, Donna and Tom Fox, for their
support and belief that I can achieve my dreams.
v
ACKNOWLEDGEMENTS
I would like to thank my advisor, Ralph Tripp, for providing excellent training
and resources to conduct this research and preparing me with the tools to be a successful
scientist. I want to thank my committee members, S. Mark Tompkins, Kim Klonowski,
Wendy Watford, and Don Harn for their support and insight into the project.
I need to thank everyone that was intimately involved in this project particularly
Leo Sage, Andrew Mellor, Lei Huang, and Phillip Chandler for their help and discussion,
and Elizabeth O’Connor for always being enthusiastic and optimistic. I am grateful for
the researchers at the Animal Health Research Center who have been critical in teaching
me the tools to complete this project, particularly Jackelyn Crabtree for training in cell
culture, Jamie Barber for patiently teaching me flow cytometry, Cheryl Jones for training
in all things influenza, Les Jones for his help with molecular techniques. Thank you to
Abjheet Bakre for listening to every problem and brainstorming solutions with me,
Patricia Jorquera, Olivia Perwitasari, Jason O’Donnell, Mary Hauser, Xiuzhen Yan, and
Josh Powell for their assistance and discussion. Thank you to Victoria Meliopoulos,
Tiffany Turner, Jon Gabbard, Jennifer Pickens, Dan Dlugolenski, Alaina Jones Mooney,
and Anthony Gresko for sharing their knowledge and providing laughter and friendship
through the good and bad days. An enormous thank you to Leslie Sitz for every crisis
she remedied and for going above and beyond what was ever asked of her to help me.
vi
Thank you to my family for always listening and being interested in what I was
doing even if they did not understand one word I said. Finally, thank you to Shamus
Keeler for his unconditional support and helpfulness through this endeavor.
vii
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS .................................................................................................v
LIST OF TABLES ...............................................................................................................x
LIST OF FIGURES ........................................................................................................... xi
CHAPTER
1 INTRODUCTION .............................................................................................1
References ....................................................................................................6
2 LITERATURE REVIEW ................................................................................13
Introduction to Influenza Virus ..................................................................13
Replication of Influenza Virus ...................................................................22
Pandemic Potential.....................................................................................23
Influenza Virus Vaccines and Therapeutics ..............................................26
Disease Pathogenesis .................................................................................28
Innate Immune Response ...........................................................................29
Adaptive Immune Response ......................................................................33
Overview of Indoleamine 2, 3-Dioxygenase (IDO) ..................................39
Mechanism of IDO Immune Suppression..................................................42
Kynurenine Pathway Metabolites ..............................................................44
IDO’s Role in Infectious Disease Pathogenesis.........................................45
Conclusions ................................................................................................52
viii
References ..................................................................................................53
3 INHIBITION OF INDOLEAMINE 2, 3-DIOXYGENASE (IDO)
ENHANCES THE T CELL RESPONSE TO INFLUENZA VIRUS
INFECTION ..................................................................................................106
Abstract ....................................................................................................107
Introduction ..............................................................................................108
Material and Methods ..............................................................................110
Results ......................................................................................................113
Discussion ................................................................................................119
Acknowledgements ..................................................................................123
References ................................................................................................123
4 INTERFERON LAMBDA UPREGULATES IDO1 EXPRESSION IN LUNG
EPITHELIAL CELLS FOLLOWING INFLUENZA VIRUS
INFECTION ..................................................................................................141
Abstract ....................................................................................................142
Introduction ..............................................................................................143
Material and Methods ..............................................................................144
Results ......................................................................................................149
Discussion ................................................................................................154
Acknowledgements ..................................................................................157
References ................................................................................................157
ix
5 INHIBITION OF IDO DURING EARLY STAGES OF INFLUENZA VIRUS
INFECTION AUGMENTS PRO-INFLAMMATORY CYTOKINE
PRODUCTION ..............................................................................................169
Abstract ....................................................................................................170
Introduction ..............................................................................................171
Material and Methods ..............................................................................172
Results ......................................................................................................177
Discussion ................................................................................................182
Acknowledgements ..................................................................................184
References ................................................................................................185
6 DEVELOPMENT OF A NOVEL METHOD TO INDUCIBLY SILENCE
IDO ACTIVITY.............................................................................................200
Abstract ....................................................................................................201
Introduction ..............................................................................................202
Material and Methods ..............................................................................203
Results ......................................................................................................207
Discussion ................................................................................................208
Acknowledgements ..................................................................................210
References ................................................................................................210
7 CONCLUSIONS............................................................................................218
x
LIST OF TABLES
Page
Table 5.1: Genes differentially regulated post-X31 infection with 1MT treatment
compared to Con-treatment in mouse lungs ........................................................192
xi
LIST OF FIGURES
Page
Figure 3.1: Influenza infection increases IDO activity in the lungs and sera ..................132
Figure 3.2: 1MT treatment does not affect total frequency of T cells infiltrating the
lungs .....................................................................................................................133
Figure 3.3: IDO inhibition does not change viral titers ...................................................134
Figure 3.4: 1MT treatment enhances the Th1 response ...................................................135
Figure 3.5: IDO inhibition enhances the influenza specific response .............................137
Figure 3.6: IDO inhibition increases the frequency of functional PA-specific CD8+ T
cells ......................................................................................................................138
Figure 3.7: Inhibition of IDO activity increases the presence of CD8+ effector memory
cells ......................................................................................................................140
Figure 4.1: Influenza infection up-regulates IDO1 expression ........................................162
Figure 4.2: A/HK/X31 (X31) infection up-regulates IDO1 expression ..........................163
Figure 4.3: IDO and IFNλ expression is related to MOI of infection ..............................164
Figure 4.4: IDO expression correlates with IFNλ expression ..........................................165
Figure 4.5: rIFNλ directly up-regulates the expression of IDO .......................................166
Figure 4.6: IFNλ partially up-regulates IDO1 during influenza infection .......................167
Figure 4.7: Inhibition of IDO decreases viral titers and reduces cellular viability ..........168
Figure 5.1: 1MT treatment enhances pro-inflammatory cytokines in lungs following
influenza infection with modest increase in IDO1 expression ............................193
xii
Figure 5.2: Interaction of genes identified in TLR array .................................................194
Figure 5.3: Increased peli1 expression is mediated through macrophages ......................195
Figure 5.4: 1MT enhances pro-inflammatory cytokine expression .................................196
Figure 5.5: 1MT treatment enhances alveolar macrophage secretion of TNF-α and
IL-6 ......................................................................................................................198
Figure 6.1: Transduced MLE-15 cells sufficiently knock down the mRNA expression and
activity of IDO1 ...................................................................................................216
Figure 6.2: shRNA is gradually produced following doxycycline induction ..................217
Figure 7.1: Proposed model for IDO modulation of the acute immune response to
influenza ...............................................................................................................223
1
CHAPTER 1
INTRODUCTION
Influenza virus is a major health and economic concern causing significant
morbidity and mortality worldwide (13, 38). Despite the general availability of an
efficacious vaccine, influenza virus remains in seasonal circulation in part through subtle
mutations in a hemagglutinin (HA) and neuraminidase (NA), known as antigenic drift,
resulting in immunologically distinct viruses (20). Current influenza virus vaccines are
designed to generate a potent neutralizing antibody response against the HA protein and
live-attenuated vaccines having an added benefit of stimulating T cell memory responses
(8). While antibodies require the same or closely related HA epitopes for efficacy (1), T
cells provide a response directed at conserved internal proteins of influenza virus
potentially offering heterologous virus immunity (8). Also, influenza viruses periodically
undergo antigenic shift through genetic reassortment in mixing vessels such as swine
resulting in a novel virus having the potential of causing a global pandemic (7). The
antibodies produced to current influenza virus vaccines generally provide limited to no
protection against a pandemic virus. Studies have shown the importance of T cell
memory in protection from disease (31, 35, 37), and efforts have been focused on
producing a vaccine with enhanced memory T cell generation (16, 27).
2
Recent studies addressing the host response and metabolomics linked to immunity
have shown that inhibition of indoleamine 2, 3- dioxygenase (IDO) has the potential to
increase the T cell response upon vaccination and develop an increased memory response
(9, 24, 36). IDO is an intracellular enzyme that catabolizes tryptophan (trp) into
kynurenine (kyn) through the kynurenine pathway where it is the first and rate-limiting
step (15, 34). IDO activity is strongly upregulated by IFNγ stimulation (6), while other
molecules, such as type I interferons (39), LPS (42), CTLA-4 (26), can increase activity
to various degrees. IDO is expressed by a variety of cells including plasmacytoid and
myeloid-derived dendritic cells (10, 33), macrophages (28), and epithelial/endothelial
cells (5, 17, 40). The lack of trp and presence of kyn causes proliferation arrest and
apoptosis of immune cells (11, 12, 29). Furthermore, IDO activity has been associated
with inducing anergy in effector T cells and skewing naïve CD4+ T cells to a Treg
phenotype over a Th1 or Th17 response (2, 29). From these downstream events, IDO
activity creates an immunosuppressive environment. During an influenza virus infection,
IDO activity is increased in the mouse lung airways peaking at day 10 post-infection
(43). Although some research has shown IDO to be active during influenza virus
infection (43), little work has been done evaluating the modulatory effect of the immune
response following an influenza virus infection in a mouse model. Understanding the
effect of IDO during a primary infection will provide insight into using IDO
manipulation to enhance vaccine and therapeutic efficacy.
The long term goal of these studies is to examine the role of IDO during a primary
influenza infection to determine the mechanisms of IDO immune modulation. The
central hypothesis of these studies is that expression of IDO during influenza infection
3
suppresses the innate and adaptive immune response through reduction of pro-
inflammatory cytokine production and magnitude of the T cell response. The study
includes the following aims:
Specific aim 1. To determine the activity and role of IDO in the frequency and activation
of CD8+ and CD4+ T cells responding to acute influenza virus infection. The working
hypothesis is that inhibition of IDO during an influenza virus infection will enhance the
Th1 response and frequency of influenza virus-specific CD8+ T cells. IDO was inhibited
pharmacologically in C57BL/6 mice using 1-methyl-D, L-tryptophan (1MT) treatment in
drinking water. Viral load and IDO activity were determined from day 1 through day 14
post-infection and the T cell response was evaluated at day 10 post-infection.
Specific aim 2. To evaluate the induction and role of IDO expression by alveolar
epithelial cells during influenza virus infection. Since influenza virus primarily infects
respiratory epithelial cells and increases the expression of IDO in these cells (19, 32), the
induction and role of IDO is potentially unique to this cell type. The working hypothesis
is that IFNλ is up-regulated during influenza virus infections inducing the expression and
activity of IDO in alveolar epithelial cells. IDO expression and activity was assessed in
the mouse lung epithelial cell line, MLE-15, following influenza infection and IFNλ
stimulation.
Specific aim 3. To evaluate the effects of IDO on expression of pro-inflammatory
cytokines during influenza virus infection and determine the host cell types affected.
4
Since IDO inhibition modified the T cell response during influenza virus infections (Aim
1), the changes in the T cell response potentially are a result of early innate responses
affecting the cytokine milieu. The working hypothesis is that IDO inhibition through
1MT treatment increases the expression of pro-inflammatory cytokines in alveolar
macrophages. The effects of IDO suppression on cytokine response were initially
assessed in 1MT treated C57BL/6 mice through a TLR PCR array. The affected cell
type, i.e. type II alveolar epithelial cells and macrophages, was addressed in vitro using
mouse lung epithelial cells (MLE-15) and macrophage-like cells (Raw264.7) and
confirmed with primary murine alveolar macrophages.
An additional goal of this research was to utilize RNA interference (RNAi) to
conditionally silence IDO1 in vitro and in vivo. Two enzymes, IDO1 and IDO2, have
the same function and similar structures but are differentially expressed (4, 14). Recent
work is focused on delineating the roles of each enzyme, but this requires the ability to
preferentially inhibit one over the other (3). The primary method to transiently inhibit
IDO activity is pharmacologically through administration of 1MT, although there is some
debate about the 1MT isoform that preferentially inhibits IDO1 versus IDO2 (18, 25).
Recent studies have been focused on developing new methods and/or compounds to
block IDO1 or IDO2 expression and activity (3, 23). IDO1 knockout mice are available,
but the removal of IDO1 during early weeks of life may have an impact on the
development of the immune system which may result in a skewed immune response to
infection. We proposed using RNAi to transiently reduce IDO1 expression. A lentiviral
vector containing an inducible short hairpin RNA (shRNA) against IDO1 was used to
integrate the shRNA into the host genome. During induction, the specific shRNA is
5
processed through the microRNA (miRNA) pathway (30). It is transcribed by RNA
polymerase II or III and processed by Drosha (21, 30). Exportin 5 traffics the shRNA
from the nucleus to the cytoplasm (41) where it is further processed by Dicer to remove
the hairpin structure and produce 3’-overhangs (22). Finally, the guide strand is loaded
onto RNA-induced silencing complex (RISC) and can target the mRNA of the gene of
interest for degradation or translational repression (30). The use of RNA interference
(RNAi) to silencing IDO1 expression will provide the ability to conditionally silence
IDO1 at varying times to determine the essential time period of IDO1 activity during
infection.
Specific aim 4. To produce and evaluate the efficacy of a lentiviral vector expressing a
doxycycline-inducible shRNA against IDO1. The working hypothesis is that transduction
using a lentiviral vector containing a shRNA against IDO1 (shIDO1) will effectively
silence IDO1 expression and activity in vitro. MLE-15 cells were utilized as a model for
shRNA knock-down efficacy. These preliminary studies provide the basis for exploring
shRNA transduction in vivo and utilization of the transduced cell lines for current and
future studies.
These specific aims will provide a better understanding of the role and
modulatory effects of IDO in regard to influenza virus infections. IDO has a well-
established history of suppressing the immune response, particularly T cells, providing a
precedence to utilize IDO inhibition as a method to enhance immunity. Understanding
the immunological changes during an infection in the absence of IDO will potentially
benefit development of vaccines and augment heterologous influenza virus protection.
6
References:
1. 2009. Serum cross-reactive antibody response to a novel influenza A (H1N1)
virus after vaccination with seasonal influenza vaccine. MMWR Morb Mortal
Wkly Rep 58:521-524.
2. Baban, B., P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H.
Munn, and A. L. Mellor. 2009. IDO activates regulatory T cells and blocks their
conversion into Th17-like T cells. J Immunol 183:2475-2483.
3. Bakmiwewa, S. M., A. A. Fatokun, A. Tran, R. J. Payne, N. H. Hunt, and H.
J. Ball. 2012. Identification of selective inhibitors of indoleamine 2,3-
dioxygenase 2. Bioorg Med Chem Lett 22:7641-7646.
4. Ball, H. J., H. J. Yuasa, C. J. D. Austin, S. Weiser, and N. H. Hunt. 2009.
Indoleamine 2,3-dioxygenase-2; a new enzyme in the kynurenine pathway. The
International Journal of Biochemistry & Cell Biology 41:467-471.
5. Beutelspacher, S. C., P. H. Tan, M. O. McClure, D. F. Larkin, R. I. Lechler,
and A. J. George. 2006. Expression of indoleamine 2,3-dioxygenase (IDO) by
endothelial cells: implications for the control of alloresponses. Am J Transplant
6:1320-1330.
6. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine
dioxygenase by interferon in mice: a study with different recombinant interferons
and various cytokines. Biochem Biophys Res Commun 152:237-242.
7. Carrat, F., and A. Flahault. 2007. Influenza vaccine: the challenge of antigenic
drift. Vaccine 25:6852-6862.
7
8. Cox, R. J., K. A. Brokstad, and P. Ogra. 2004. Influenza virus: immunity and
vaccination strategies. Comparison of the immune response to inactivated and
live, attenuated influenza vaccines. Scand J Immunol 59:1-15.
9. Dai, H., and Z. Dai. 2008. The role of tryptophan catabolism in acquisition and
effector function of memory T cells. Curr Opin Organ Transplant 13:31-35.
10. Donovan, M. J., V. Tripathi, M. A. Favila, N. S. Geraci, M. C. Lange, W.
Ballhorn, and M. A. McDowell. 2012. Indoleamine 2,3-dioxygenase (IDO)
induced by Leishmania infection of human dendritic cells. Parasite Immunol
34:464-472.
11. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.
C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.
Cell Death Differ 9:1069-1077.
12. Fallarino, F., U. Grohmann, S. You, B. C. McGrath, D. R. Cavener, C.
Vacca, C. Orabona, R. Bianchi, M. L. Belladonna, C. Volpi, P. Santamaria,
M. C. Fioretti, and P. Puccetti. 2006. The combined effects of tryptophan
starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and
induce a regulatory phenotype in naive T cells. J Immunol 176:6752-6761.
13. Fiore, A. E., T. M. Uyeki, K. Broder, L. Finelli, G. L. Euler, J. A. Singleton,
J. K. Iskander, P. M. Wortley, D. K. Shay, J. S. Bresee, and N. J. Cox. 2010.
Prevention and control of influenza with vaccines: recommendations of the
Advisory Committee on Immunization Practices (ACIP), 2010. MMWR Recomm
Rep 59:1-62.
8
14. Fukunaga, M., Y. Yamamoto, M. Kawasoe, Y. Arioka, Y. Murakami, M.
Hoshi, and K. Saito. 2012. Studies on tissue and cellular distribution of
indoleamine 2,3-dioxygenase 2: the absence of IDO1 upregulates IDO2
expression in the epididymis. The journal of histochemistry and cytochemistry :
official journal of the Histochemistry Society 60:854-860.
15. Grohmann, U., F. Fallarino, and P. Puccetti. 2003. Tolerance, DCs and
tryptophan: much ado about IDO. Trends Immunol 24:242-248.
16. Guillonneau, C., J. D. Mintern, F. X. Hubert, A. C. Hurt, G. S. Besra, S.
Porcelli, I. G. Barr, P. C. Doherty, D. I. Godfrey, and S. J. Turner. 2009.
Combined NKT cell activation and influenza virus vaccination boosts memory
CTL generation and protective immunity. Proc Natl Acad Sci U S A 106:3330-
3335.
17. Jacoby, D. B., and A. M. Choi. 1994. Influenza virus induces expression of
antioxidant genes in human epithelial cells. Free Radic Biol Med 16:821-824.
18. Jia, L., K. Schweikart, J. Tomaszewski, J. G. Page, P. E. Noker, S. A.
Buhrow, J. M. Reid, M. M. Ames, and D. H. Munn. 2008. Toxicology and
pharmacokinetics of 1-methyl-d-tryptophan: absence of toxicity due to saturating
absorption. Food Chem Toxicol 46:203-211.
19. Knobil, K., A. M. Choi, G. W. Weigand, and D. B. Jacoby. 1998. Role of
oxidants in influenza virus-induced gene expression. The American journal of
physiology 274:L134-142.
20. Kreijtz, J. H., R. A. Fouchier, and G. F. Rimmelzwaan. 2011. Immune
responses to influenza virus infection. Virus Res 162:19-30.
9
21. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O.
Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates
microRNA processing. Nature 425:415-419.
22. Lee, Y. S., K. Nakahara, J. W. Pham, K. Kim, Z. He, E. J. Sontheimer, and
R. W. Carthew. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the
siRNA/miRNA silencing pathways. Cell 117:69-81.
23. Liu, X., N. Shin, H. K. Koblish, G. Yang, Q. Wang, K. Wang, L. Leffet, M. J.
Hansbury, B. Thomas, M. Rupar, P. Waeltz, K. J. Bowman, P. Polam, R. B.
Sparks, E. W. Yue, Y. Li, R. Wynn, J. S. Fridman, T. C. Burn, A. P. Combs,
R. C. Newton, and P. A. Scherle. 2010. Selective inhibition of IDO1 effectively
regulates mediators of antitumor immunity. Blood 115:3520-3530.
24. Liu, Z., H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai. 2007.
Suppression of memory CD8 T cell generation and function by tryptophan
catabolism. J Immunol 178:4260-4266.
25. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G.
Opelz, and P. Terness. 2009. IDO1 and IDO2 are expressed in human tumors:
levo- but not dextro-1-methyl tryptophan inhibits tryptophan catabolism. Cancer
Immunol Immunother 58:153-157.
26. Mellor, A. L., P. Chandler, B. Baban, A. M. Hansen, B. Marshall, J. Pihkala,
H. Waldmann, S. Cobbold, E. Adams, and D. H. Munn. 2004. Specific subsets
of murine dendritic cells acquire potent T cell regulatory functions following
CTLA4-mediated induction of indoleamine 2,3 dioxygenase. Int Immunol
16:1391-1401.
10
27. Mueller, S. N., W. A. Langley, E. Carnero, A. Garcia-Sastre, and R. Ahmed.
2010. Immunization with live attenuated influenza viruses that express altered
NS1 proteins results in potent and protective memory CD8+ T-cell responses. J
Virol 84:1847-1855.
28. Munn, D. H., E. Shafizadeh, J. T. Attwood, I. Bondarev, A. Pashine, and A.
L. Mellor. 1999. Inhibition of T cell proliferation by macrophage tryptophan
catabolism. J Exp Med 189:1363-1372.
29. Munn, D. H., M. D. Sharma, B. Baban, H. P. Harding, Y. Zhang, D. Ron, and
A. L. Mellor. 2005. GCN2 kinase in T cells mediates proliferative arrest and
anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 22:633-
642.
30. Rao, D. D., J. S. Vorhies, N. Senzer, and J. Nemunaitis. 2009. siRNA vs.
shRNA: similarities and differences. Adv Drug Deliv Rev 61:746-759.
31. Roberts, A. D., K. H. Ely, and D. L. Woodland. 2005. Differential contributions
of central and effector memory T cells to recall responses. J Exp Med 202:123-
133.
32. Sanders, C. J., P. C. Doherty, and P. G. Thomas. 2010. Respiratory epithelial
cells in innate immunity to influenza virus infection. Cell Tissue Res.
33. Sharma, M. D., B. Baban, P. Chandler, D. Y. Hou, N. Singh, H. Yagita, M.
Azuma, B. R. Blazar, A. L. Mellor, and D. H. Munn. 2007. Plasmacytoid
dendritic cells from mouse tumor-draining lymph nodes directly activate mature
Tregs via indoleamine 2,3-dioxygenase. J Clin Invest 117:2570-2582.
11
34. Sugimoto, H., S. Oda, T. Otsuki, T. Hino, T. Yoshida, and Y. Shiro. 2006.
Crystal structure of human indoleamine 2,3-dioxygenase: catalytic mechanism of
O2 incorporation by a heme-containing dioxygenase. Proc Natl Acad Sci U S A
103:2611-2616.
35. Taylor, P. M., and B. A. Askonas. 1986. Influenza nucleoprotein-specific
cytotoxic T-cell clones are protective in vivo. Immunology 58:417-420.
36. Terness, P., T. M. Bauer, L. Rose, C. Dufter, A. Watzlik, H. Simon, and G.
Opelz. 2002. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-
dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan
metabolites. J Exp Med 196:447-457.
37. Thomas, P. G., R. Keating, D. J. Hulse-Post, and P. C. Doherty. 2006. Cell-
mediated protection in influenza infection. Emerg Infect Dis 12:48-54.
38. Thompson, W. W., D. K. Shay, E. Weintraub, L. Brammer, C. B. Bridges, N.
J. Cox, and K. Fukuda. 2004. Influenza-associated hospitalizations in the United
States. JAMA 292:1333-1340.
39. van der Marel, A. P., J. N. Samsom, M. Greuter, L. A. van Berkel, T.
O'Toole, G. Kraal, and R. E. Mebius. 2007. Blockade of IDO inhibits nasal
tolerance induction. J Immunol 179:894-900.
40. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-
gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via
indoleamine 2,3-dioxygenase. J Immunol 169:7039-7044.
12
41. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the
nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development
17:3011-3016.
42. Yoshida, R., and O. Hayaishi. 1978. Induction of pulmonary indoleamine 2,3-
dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Proc Natl
Acad Sci U S A 75:3998-4000.
43. Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of
indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl
Acad Sci U S A 76:4084-4086.
13
CHAPTER 2
LITERATURE REVIEW
Introduction to Influenza Virus
Influenza viruses causes significant morbidity and mortality worldwide,
particularly the elderly and young (346). Influenza virus belongs to the family
Orthomyxoviridae where there are three genera: influenza virus A, B, and C (245).
Influenza A virus is the most common and mainly infects birds and mammals, while
influenza B and C viruses are primarily found in humans (346). The viruses are
differentiated based on their subtype named for the hemagglutinin (HA) and
neuraminidase (NA) proteins (289). Currently, there are 17 HA subtypes and 10 NA
subtypes, which can be combined in varying fashions. Waterfowl are the reservoir for
influenza A viruses and 16/17 HA and 9/10 NA can be isolated from this population
(289). The H17 has only been isolated from yellow-shouldered bats (318).
Robert Shope isolated the influenza virus in the early 1930s from an infected
swine and proved that the filterable agent produced influenza virus-like disease in
subsequent swine infections (282, 283, 329). Later, he also showed that serum from
individuals infected with the 1918 Spanish influenza virus were able to neutralize the
virus (281). Although this was the first isolation and characterization of influenza virus,
epidemics of influenza virus-like disease have been described for many centuries
14
potentially dating back to ancient Greece, with the first documented pandemic in the 16th
century (256). Since this time, numerous pandemics have impacted the human population
with a continued threat of pandemic potential of novel influenza viruses. This section
covers a description of influenza virus and its replication, recent pandemics, current
vaccines and therapeutics, and the host response to combat infection.
Influenza A viruses
Influenza virus is an enveloped virus containing a single stranded, negative sense,
segmented RNA genome (346). There are 8 segments encoding 10-11 proteins (346).
The genome encodes two glycoproteins, the hemagglutinin (HA) and neuraminidase
(NA), a RNA dependent RNA polymerase comprised of the polymerase basic 2 (PB2),
polymerase basic 1 (PB1), and polymerase acidic (PA) proteins, a nucleoprotein (NP),
two structural proteins, the matrix 1 and 2 (M1 and M2), and three nonstructural proteins,
NS1, NS2/Nuclear export protein (NEP), and PB1-F2 (346). The segments are ordered
based on length beginning with the longest PB2 segment, followed by the PB1 segment,
which also encodes the PB1-F2 protein from an alternative open reading frame. The
third segment is the PA and the fourth segment is the HA. The fifth segment encodes the
NP followed by the NA segment (sixth segment). The seventh and eighth segment
encode two proteins from splicing, which are the M segment, encoding the M1 and M2,
and NS segment, encoding the NS1 and NS2 proteins, respectively (346). Influenza virus
is pleomorphic in shape ranging from spherical to filamentous with a diameter of
between 100 and 300 nm (245, 264). The virion contains an envelope derived from the
15
host lipid membrane which possess the HA and NA glycoproteins along with the M2 ion
channel (264).
There are two major glycoproteins on the surface of the influenza virion, i.e. the
HA and NA proteins (346). There is more HA present on the surface of the virion with a
ratio of HA to NA of 4:1 (339). The HA is responsible for attachment and fusion of the
virion to the host cell through binding of sialic acid glycans (SA) (285). There are 17
different HA proteins; H1-H16 can be found in the avian population (71), H1-H3 have at
one time circulated in humans (346), and H17 was recently discovered from a yellow
shouldered bat (318). The HA protein is a homotrimer that is composed of a globular
head, which is heavy glycosylated, a conserved stalk region, and a transmembrane
domain (180). The HA is cleaved from HA0 to HA1 and HA2 to be functional (63).
This cleavage is mediated by host proteases (38). Seasonal viruses utilize trypsin-like
proteases, such as TMPRSS2 and HAT (38) predominantly found in the respiratory tract
while the HA from high pathogenic viruses are cleaved by PC6 and furin because of the
presence of a polybasic cleavage site (119, 294). The ability of the HA from high
pathogenic viruses to be cleaved by ubiquitously expressed proteases allows the virus to
infect cells systemically (168).
Host specificity of the virus is in part determined through the linkage of the
underlying galactose of the sialic acid receptor. Human-adapted viruses preferentially
bind to α-2, 6-SA, while avian adapted viruses more readily bind to α-2, 3-SA (262).
This preference is linked to the presence and availability of the respective sialic acid in
the target organs of infection in the host adapted virus (330). The human upper
respiratory tract predominantly contains α-2, 6-SA while the lower respiratory tract
16
contains α-2, 3-SA and α-2, 6-SA (204, 278). The gastrointestinal tract (GI) of wild
aquatic birds is lined mostly with α-2, 3-SA, although the GI and respiratory tract also
express low levels of α-2, 6-SA (104). Finally, the swine respiratory tract harbors α-2, 3-
SA and α-2, 6-SA, which lends to the hypothesis that swine are a mixing vessel for avian
and human viruses strains (153). Although sialic acid is the main receptor for influenza
virus, studies are emerging that influenza virus is able to infect cells in the absence of
sialic acids (243) utilizing DC-SIGN or L-SIGN (190). The HA protein is also the main
antigen targeted by neutralizing antibodies, which causes the protein to undergo mutation
to avoid immune pressure through antigenic drift and shift, as discussed below (285).
The other main glycoprotein is the NA protein which is responsible for release of
influenza virus through sialidase activity (245). The NA protein is a homotetramer and
consists of a glycosylated mushroom-like head with 4 catalytic domains, a stalk region,
which is also slightly glycosylated, and a conserved membrane anchor (120). There are
10 different NA proteins; N1-N9 can be found in avian species, N1-N2 are found in
humans, and N10 was described from yellowed shouldered bats (318). Although it was
recently determined that the N10 does not possess neuraminidase activity (356). The
main function of the NA is to cleave α-2, 3-SA and α-2, 6-SA residues from the surface
of the host cell and the HA protein to detach progeny virus and prevent aggregation of the
virions, respectively (244). An additional function of NA is its cleavage of glycan
structures found in mucus to provide increased ability of influenza virus to reach the host
cells (205). The NA protein also has a role in host restriction. Like the HA protein,
evidence suggests that the NA can provide host specificity through the preferentially
cleavage of α-2, 3-SA or α-2, 6-SA (349). Furthermore, the NA is an antigenic target for
17
antibodies, which would block the release of the virus from the host cell, which drives
mutation of the protein to evade the immune response (346).
The RNA dependent RNA polymerase (RdRp) is a heterotrimer comprised of the
PB2, PB1, and PA proteins (245). The polymerase is responsible for transcription and
replication of the RNA genome (245). It is also associated with virulence and host
tropism (37). The RdRp lacks proofreading capabilities resulting in a high error rate
(291). These mutations result in the virus undergoing antigenic drift, as described below,
and evading the immune response, i.e. HA and NA, in particular (17, 84). The PB2
protein functions in initiation of transcription through cap recognition of pre-mRNA 5’
cap, which will be cleaved and utilized as a RNA primer during replication, as described
below (124). PB2 also localizes the RdRp to the nucleus through interaction with
importin α (307). Mutations in the PB2 protein have been associated with host adaption,
including an E627K mutation which enhances replication in mammalian cells compared
to avian (297). Also, a D701N mutation increases PB2 binding to importin α in human
cells compared to avian species (37). The PB1 protein is involved in elongation of the
RdRp and provides endonuclease activity (229, 346). PB1 is the primary backbone of the
polymerase and is essential for the catalytic domain; studies have been done showing that
only variations of the polymerase which contained the PB1 protein were able to
synthesize RNA (174). Finally, the PA protein possesses endonuclease activity, which
cleaves the 5’ cap from pre-mRNA (76). Furthermore, recent work has shown the PA
protein to be involved in the shutdown of host protein synthesis with evidence of strain
variation between the efficiently of host protein inhibition of avian and human origin
viruses (74).
18
The fifth segment encodes the nucleoprotein (NP) which encapsidates the viral
RNA (vRNA) through a positively charged RNA-binding cleft (265, 346), although NP is
unable to directly bind to influenza virus mRNA (137). One hypothesis is that there is an
encapsidation signal located on the 5’ end of the vRNA which functions to initiation NP
binding (255, 317). From this interaction, the NP provides a role in regulation of
replication and transcription, although the exact mechanism of regulation is unclear. The
NP protein interacts with other viral and host proteins (31, 92, 236). First, NP binds to
the PB1 and PB2 protein, describing a potential role for NP in switching influenza virus
from transcription to replication (31). Binding of NP to the polymerase proteins may
modify the RdRp to favor an unprimed replication versus primed mRNA production
(233). Recent work has shown interaction between the NP, RdRp, and NS2/NES proteins
results in the synthesis of small viral RNA (svRNA) which assists in the production of
vRNA (249). Furthermore, blockade of the svRNA resulted in loss of only vRNA
production with no effect on cRNA or mRNA levels (249). The NP protein has also been
shown to interact with importin α as well as enhance binding of PB2 to importin α (109)
and CRM1 (92). These two proteins (importin α and CRM1) assist in the localization
and export of the vRNP (viral ribonucleoprotein; RdRp, NP, vRNA) from the nucleus,
respectively.
A frame shift in the PB1 gene produces an alternative +1 open reading frame that
codes for the PB1-F2 protein (56). This gene is found in influenza A viruses, while
absent in influenza B viruses, and is highly expressed during early hours after infection
(177). The PB1-F2 protein localizes to the mitochondria where it depolarizes the
membrane potential leading to apoptosis (56, 61). It has also been shown to form
19
oligomeric structures resulting in cellular permeabilization (45). Besides a role in the
induction of apoptosis, the PB1-F2 protein enhances the pathogenicity (354) and modifies
the innate immune response following influenza virus infection (207). Numerous works
have shown a N66S mutation to enhance replication of the virus (56, 271). The N66S
mutation enhances binding to mitochondrial antiviral-signaling protein (MAVS) which
antagonizes the production of type I interferons resulting in enhanced virulence (332).
The PB1-F2 protein can be expressed in varying lengths, from 11 to 101 amino acids
(54). The majority of the viruses that cause severe disease possess a functional PB1-F2,
such as the 1918 H1N1 Spanish flu and HPAI H5N1 (62). The functional protein is also
found in the majority of H3N2 viruses; however, the most recent 2009 H1N1 pandemic
virus contains a severely truncated and non-functional form of PB1-F2 (54).
The seventh segment produces two proteins: the matrix 1 (M1) protein is
transcribed from the whole segment while the M2 protein is produced from splicing
(346). This also occurs in the eighth segment which encodes the two non-structural
proteins (NS1 and NEP/NS2). The M1 protein is produced late after infection and serves
multiple roles in the final steps of virus replication (118). The M1 interacts with the
vRNPs and assists in the export of the vRNP from the nucleus (201). Removal of the
M1 protein synthesis results in the accumulation of vRNPs in the nucleus (201). Once
removed from the nucleus, the M1 interacts with the M2 cytoplasmic tail (55, 333, 355)
and evidences suggests interaction with the HA and NA cytoplasmic tails as well (124,
129) to bring the vRNP to the site of viral budding, the plasma membrane, as well as
cluster the glycoproteins to the budding site (230). Finally, in the virion, the M1 protein
20
lines the envelope where it remains partially associated with viral envelope and the vRNP
(135).
The M2 protein is a type III integral membrane protein which serves to transport
protons across the viral membrane (88). The M2 functions in the viral entry, maturation,
and assembly (293, 342). Once the virus is endocytosed during entry, the M2 protein
reduces the pH through the import of protons which causes release of the vRNPs from
M1 thus allowing the vRNPs to travel from the cytoplasm to the nucleus for replication
(245). Similar to the role of M2 in the entry of influenza virus, for highly pathogenic
influenza viruses (H5 and H7) the M2 protein increases the pH of the trans-golgi network
to prevent the premature cleavage of the HA protein (26). During the final stages of virus
replication, i.e. assembly and budding, the M2 assists in the recruitment of the M1 protein
to the site of budding through interactions with the M2 cytoplasmic tail (156, 208).
Mutations of these binding domains resulted in reduced viral titers and increased
production of filamentous shaped virions (156). Unlike the other surface proteins (HA
and NA), the M2 protein is highly conserved between different influenza viruses (73) and
although there is two times more M2 present on the surface of infected cells, very few
M2 proteins are present on the virion (100).
The NS1 is produced from the whole gene while the NEP/NS2 is produced from
splicing of the eighth segment (346). The NS1 has a role as a viral interferon antagonist
as well as enhancement of viral mRNA translation (129). The NS1 protein’s role in
combating innate immune pathways and interferon production is discussed later in the
innate immune response section. The main role of the NEP is to export vRNP from the
nucleus through interaction with Crm1 and the cofactor RanGTP to be trafficked to the
21
cell membrane for virion release (92, 246). Additional work is emerging providing a role
of NEP in the transition between mRNA, cRNA, and vRNA production (249, 260).
Influenza B and C viruses
Influenza B virus also contains a genome comprised of 8 segments which encode
one or more proteins. The proteins encoded are the polymerase genes (PB2, PB1, PA),
HA, NP, NA, NB, M1, BM2, NS1, and NEP/NS2 (346). Unlike influenza A viruses,
influenza B virus encodes the NB protein which is produced from a -1 shift in the open
reading frame of the NA segment (346). The NB protein is associated with the
membrane and potentially is an ion channel, although this protein is not necessary for in
vitro replication it provides an advantage in vivo (136, 292). Influenza B encodes the
BM2 protein which is encoded from the M1 segment and is transcribed from a stop-start
codon that stops the transcription of the M1 gene and starts the transcription of BM2
(346). BM2 is also a membrane protein and may function as an ion channel (221).
Influenza B viruses has the same structure as influenza A but primarily infects humans
(245).
Influenza C virus only has 7 segments in its genome and encodes 9 genes (346).
The largest segments encode the PB2, PB1, and P3 proteins which are a part of the
polymerase (348). The HEF protein, which is the main surface glycoprotein for influenza
C, is the fourth segment and is involved in binding, fusion, and release of the virion
(143). The remaining proteins are the NP, CM1, CM2, NS1, and NEP/NS2 (245). The
CM1 and CM2 proteins are encoded by the sixth segment. The CM1 protein is similar to
the matrix protein and interacts with the vRNPs (292). The CM2 protein is also a surface
22
glycoprotein and may function as an ion channel (27). The surface of influenza C virus
has hexagonal reticular structures which distinguish them from influenza A and B viruses
(245). Influenza C virus is also predominantly found in humans.
The Orthomyxoviridae family also includes the genera Thogotovirus, Isavirus,
and Quarjavirus, although these virus genera will not be discussed (245, 248).
Replication of Influenza Virus
Influenza virus enters the host cell by HA binding to SA present on the surface of
the cell, and is endocytosed primarily via clathrin-coated pits, although clathrin-
independent methods have been observed (266). The M2 ion channel acidifies the
endosome through an influx of protons inducing a conformational change in HA2
exposing the fusion peptide (346). The fusion peptide binds to the endosomal membrane
and creates a pore releasing the viral genome complex (vRNPs) into the cytoplasm (66).
The pH decrease in the endosome also releases the vRNPs from the M1 protein (251).
Once in the cytoplasm, the vRNA is transported to the nucleus through nuclear
localization signals on the NP proteins (65, 335). In the nucleus, the PB2 protein
initiates transcription through recognition of the 5’ cap on host pre-mRNA (124, 253).
The PA protein cleaves the pre-mRNA 5’ cap (76), which is then utilized as a primer for
transcription. The PB1 protein catalyzes the elongation of the primed transcript
producing the viral mRNA (112). The mRNA is trafficked as if it were host mRNA to
the cytoplasm and translated using host machinery. The HA, NA, and M2 proteins are
glycosylated and transported to the cellular membrane via the trans-Golgi network (245).
Although the exact mechanism is unknown, it is hypothesized that once adequate
23
amounts of NP are produced and trafficked back into the nucleus via importin α, the
RdRp switches to the synthesis of cRNA (255). The cRNA is a template for the
production of vRNA. The vRNA is encapsidated by the NP (255) and interacts with the
M1 protein (201). M1 associates with NS2/NEP to export the vRNP out of the nucleus
(150, 237). The M1 protein traffics the vRNPs to the plasma membrane through
interactions with the cytoplasmic tails of the M2, HA, and NA proteins for viral
packaging (55, 208, 333). The M1 protein, with the help of other viral proteins such as
HA, induces positive curvature of the plasma membrane and once the virion is budding,
the M2 protein induces negative curvature through the addition of a amphipathic helix
causing final budding of the virus (264). The NA protein cleaves the terminal sialic acid
residues on the surface of the cell and the HA protein to release the virion (346). Once
released from the cells, the HA0 protein is cleaved by host proteases to produce the
functional HA1 and HA2 (38). The virion is now able to infect neighboring cells and
repeat the replication process.
Pandemic Potential
The ability of influenza virus to evade the immune response is linked to antigenic
drift and shift (245). Mutations in the HA and NA, due to the high error rate of the
RdRp, result in the ability of the virus to evade the immune response, particularly
neutralizing antibodies (245). These mutations referred to as antigenic drift provide an
advantage to the virus and are the reason for yearly vaccination (310). Antigenic shift is
a result of reassortment of two distinct influenza viruses (245). Reassortment occurs
following infection of a single cell with two influenza viruses allowing the segmented
24
genome to be mixed between the two viruses resulting in a novel virus (346). Since these
viruses have not been seen in the population previously, the population is
immunologically naïve to the reassortant virus leading to the risk of pandemics.
Influenza virus pandemics have been described since early times where there has
typically been a pandemic occurring about every 36 years (310). Within the last two
centuries there have been four recognized influenza virus pandemics which had varying
degrees of morbidity and mortality (310). The most notorious pandemic is the 1918
Spanish Influenza virus. The 1918 pandemic caused 675,000 deaths in the United States
and estimated 50 million deaths worldwide (161, 309) mostly due to secondary infections
(218). The virus responsible for the 1918 pandemic was an avian derived H1N1 and it is
the ancestor to the current circulating strains (309). Infection with the 1918 H1N1 caused
W-shaped age mortality, with very young, very old, and ages 20-40 accounting for the
majority of the fatalities (310). The 1918 H1N1 was recently reconstructed and shown to
have high lethality in mice, high replication, and lack of trypsin requirements for
replication (323). Furthermore, work has shown that mutations in the HA (D190E and
D225G) reduced transmissibility of the virus (324) and shown the PB1-F2 protein to be a
virulence factor in enhanced bacterial pneumonia (207) and lung pathology (62).
The second pandemic of the 20th
century occurred in 1957 with the emergence of
the H2N2 Asian influenza virus (170). The H2N2 virus was a descendent of the 1918
virus; however, it contained three new gene segments, HA, NA, and PB1 (167, 272).
Unlike the 1918 H1N1, the large number of the fatalities had preexisting conditions and
died of viral pneumonia (193). The H2N2 circulated in the population during season
endemics and disappeared in 1968 (310). Replacing the H2N2 virus was the introduction
25
of the 1968 H3N2 Hong Kong influenza virus pandemic. The Hong Kong influenza
virus was derived from the 1957 virus but acquired two novel segments, HA and PB1
(272). This virus did not cause significant mortality most likely due to the presence of
pre-existing immunity to the NA of the 1957 virus (10) with the addition of a strong cell
mediated response. The H3N2 virus still remains in circulation in a seasonal manner
(310).
The most recent pandemic was the 2009 H1N1 swine-origin influenza virus
(pH1N1). The pH1N1 originated from a reassortment between a Eurasian H1N1 swine
lineage virus and a “triple reassortment” North American swine H1N2 lineage virus (115,
310). The PB1, PB2, PA, HA, NP, and NS were derived from the triple reassortment
North America virus, with the HA, NP, and NS being present in the classical swine
lineage (115). The NA and M originated from the Eurasian swine lineage virus (115).
During the first 12-months of the pandemic, there were between 43 and 89 million cases
(1) of pH1N1 infection and up to 570,000 individuals that died worldwide (72). The
majority of the severe cases were in the young population because of cross protection in
the older population from previous H1N1 exposure (198). The pH1N1, along with the
H3N2 virus, are still in current seasonal circulation (310).
Other influenza viruses have emerged causing epidemics and epizootics. These
epidemics include the highly pathogenic avian influenza (HPAI) viruses H5N1 and H7N7
and have occurred primarily in China and Southeast Asia, but also in Russia, Africa and
Europe (85, 169). An avian influenza virus is considered highly pathogenic if the HA
contains a polybasic cleavage site and kills at least 75% of chickens when administered
intravenously (296). The H5N1 and H7N7 viruses remain in a pre-pandemic level due to
26
the lack of efficient human to human transmission and require direct contact with
infected poultry or wild birds (6, 113). The HPAI H5N1 virus was isolated in 1997 from
Hong Kong where it infected individuals through direct contact with infected poultry
(284, 298). The H5N1 virus has been causing sporadic cases since 2003 with a fatality
rate up to a 60% (284). The HPAI H5N1 is found in migratory and aquatic fowl and can
be subsequently transmitted to the poultry population (169, 171). Although wild birds
are the main reservoir for influenza A viruses, infection normally does not cause clinical
disease, however infection with HPAI H5N1 usually results in high mortality in domestic
poultry (6). HPAI H5N1 contains multiple mutations which are thought to facilitate virus
fitness. The PB1 protein has an E627K mutation which enhances replication (279) and a
mutation in the NS1 protein (D92E) that increases resistance to IFNs (274). The HPAI
H7N7 virus isolated from the Netherlands in 2003 also caused infections in humans
through direct contact with infected poultry (175). Unlike the H5N1 outbreaks, the
majority of the individuals infected with the H7N7 virus developed conjunctivitis (175).
Most recently, in 2013, there was an epidemic of H7N9 low pathogenic avian influenza
virus in China and Taiwan (52). Currently, this virus has been unable to efficiently
transmit human to human (52).
Influenza Virus Vaccines and Therapeutics
Vaccination against influenza virus is generally an effective method to prevent
transmission and disease. Currently two types of vaccines are utilized, i.e. the
split/inactivated vaccine, and the live, attenuated vaccine (20, 40). The trivalent split
vaccine is mostly comprised of the HA and NA of three influenza virus strains, usually
27
two type A viruses including a H1N1, H3N2, and a type B virus (40). The trivalent
vaccine for the U.S. 2012-2013 season contains an A/California/7/2009 (H1N1) pdm09-
like virus, an A/Victoria/361/2011 (H3N2)-like virus, and a B/Wisconsin/1/2010-like
virus (50). These proteins are derived from whole grown virus that is inactivated and
disrupted to primarily contain the HA and NA (101). This is the most widely used
vaccine as it is safe for all ages, however young children generally require two doses to
provide protection, and it does not induce a robust response in the elderly (102). A
neutralizing antibody response provides the main mechanism of protection for this
vaccine as little to no cell-mediated response is produced (40). The live, attenuated
vaccine is a trivalent vaccine consisting of cold-adapted, temperature sensitive virus
mutants, meaning that the virus grows efficiently at 25°C but is unable to replicated at
37°C (20, 134). The nature of these viruses restrict the replication of the virus to the
nasopharynx not allowing replication in the lower respiratory tract or the lungs (134). A
benefit to the live, attenuated vaccine is the ability of the virus to replicate resulting in the
induction of a T cell response. While the main protection of the vaccine is still through
production of neutralizing antibodies targeting the HA, the live, attenuated influenza
virus vaccine induces a cell-mediated response (20); however, an increase in T cells is
more predominantly seen in children over adults (140). Recently, a quadrivalent vaccine
formulation of the yearly vaccine has been FDA approved for the 2013-2014 season
(238). This vaccine is comprised of 2 influenza A and 2 influenza B viruses and will be
available in the inactivated and live, attenuated versions of the vaccine (79). The vaccine
formulation for the U.S. 2013-2014 influenza virus vaccine will contain an
A/California/7/2009 (H1N1) pdm09-like virus, an A/Victoria/361/2011 (H3N2)-like
28
virus, and a B/Massachusetts/2/2012-like virus (51). The quadrivalent vaccine will also
include a B/Brisbane/60/2008-like virus (51).
Limited antiviral drugs are available that limit symptoms and reduce viral
shedding (295). The first drugs to become available against influenza A virus are
amantadine and rimantadine. These drugs target the M2 ion channel and ultimately affect
viral genome release during virus entry (25). As previously discussed, the M2 protein
acidifies the endosome releasing the vRNPs from the M1 protein and into the cytoplasm
(245). In the presence of amantadine or rimantadine this process is hindered (295).
Although initially effective, most circulating viruses since 2009 are resistant to these
drugs through a point mutation of the M2 protein (234). The second group of antivirals,
zanamivir and oseltamivir, bind to the active site of the NA protein and subsequently
blocks the neuraminidase activity (213). Unlike amantadine and rimantadine, zanamivir
and oseltamivir are effective against influenza A and B (213). Resistance to oseltamivir is
emerging in the circulating strains of influenza virus as of the 2011-2012 season (53).
This resistance has been associated with a H275Y mutation in the NA (345). However,
the 2009 H1N1 pandemic virus has also acquired an I223R mutation in the NA which
confers resistance to zanamivir and oseltamivir (328).
Disease Pathogenesis
Influenza virus infection causes an acute respiratory disease characterized by high
fever, upper respiratory tract inflammation, cough, headache, and malaise (311).
Symptoms normally subside in 7 to 10 days while general fatigue may last for additional
weeks (311). While most individuals develop these acute symptoms, those with pre-
29
existing conditions such as cardiac disease, COPD, immunocompromised state, diabetes
mellitus or elderly and very young individuals are at a higher risk for development of
viral or secondary bacterial pneumonia (64, 197, 311). Viral pneumonia is characterized
by pulmonary edema, dyspnea, and cyanosis and in severe cases can be fatal (311).
Streptococcus pneumoniae and Haemophilus influenzae are the most frequent
malefactors of secondary bacterial pneumonia (126), which is associated with massive
neutrophil infiltration into the airways (311).
Innate immune response
Influenza virus infection induces a robust immune response. During acute
infection, the initial defense is mediated through the innate immune response. Influenza
virus is recognized by multiple pattern recognition receptors (PRRs) which lead to the
production of pro-inflammatory cytokines and induction of the antiviral state mediated
through interferons (166). The three main mechanisms of influenza virus detection are
through Toll-like receptors (TLRs), RIG-I like receptor (RLR) family, and nucleotide
oligomerization domain-like receptors (NLR) (8, 209, 270). TLR3 and TLR7 are the
primary TLRs that respond to influenza virus infection (77, 184). TLR3 and TLR7 are
expressed by the majority of the homeostatic cell populations in the lungs including the
bronchial epithelial cells, macrophages, and dendritic cells (155, 179, 189) and recognize
double stranded RNA (dsRNA) and single stranded RNA, respectively (77, 305). Both
TLRs are present within the endosomal compartment, so they are triggered by influenza
virus during the entry stage of the virus replication (166). Following stimulation of the
receptor, TLR3 signals through the adaptor protein TRIF which subsequently leads to
30
downstream signaling resulting in the phosphorylation of IRF-3 and activation of NF-kB
(7). IRF-3 and NF-kB translocate to the nucleus where they initiate the production of
IFN-β and pro-inflammatory cytokines, respectively (305). Unlike TLR3, TLR7 utilizes
MyD88 as an adaptor protein. Downstream signaling from MyD88 results in the
phosphorylation of IRF-7 and activation of NF-kB and AP-1 resulting in the production
of IFN-α and pro-inflammatory cytokines, respectively, further discussed below (142,
305).
More recently, RIG-I, a member of the RLR family, has been shown to have an
important role in the induction of the antiviral immune response following influenza virus
infection (191). RIG-I localizes in the cytoplasm and recognizes ssRNA containing a 5’-
triphosophate (258, 306). Once the 5’-triphsophate is recognized, TRIM25 ubiquinates
RIG-I leading to activation of the downstream adaptor protein, MAVS (111). MAVS
initiates a cascade inducing the activation of Protein kinase R (PKR), IRF-3, IRF-7, and
NF-kB (149, 184). This pathway also leads to the production of interferons and pro-
inflammatory cytokines (240).
The NLR pathway is mediated through the activation of the NOD-like receptor
family, pyrin domain containing 3 (NLRP3) inflammasome (8). Two signals are required
to induce the activity of the inflammasome (183). The first being recognition by PRRs,
as listed above, which causes nuclear translocation of NF-kB. NF-kB initiates
transcription of NLRP3 and pro-IL-1β (183). NLRP3 is activated in response to the
second signal, in the case of influenza virus, this is produced by M2 activity (152). After
NLRP3 activation, the inflammasome is produced by incorporation of Apoptosis-
associated speck-like protein containing a CARD (ASC) and pro-caspase 1 resulting in an
31
active caspase 1, which cleaves pro-IL-1β into IL-1β (5, 8). Lack of NLRP3 expression
results in increased mortality in mice and reduced inflammatory response, suggesting an
important role of the NLRP3 inflammasome in influenza virus protection (8).
PRRs engagement result in the production of antiviral and pro-inflammatory
cytokines (163). The antiviral state is induced through type I and type III interferons
(IFNs) (314). IFN-α and IFN-β are the two main interferons in the type I IFN group of
proteins that are intimately involved in influenza virus infections; other type I IFNs
include IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ (314), although these will not be
discussed. Type I IFNs bind to the IFN-α receptor (IFNAR), which is comprised of the
IFNAR1 and IFNAR2 (314). The IFNAR is present on most cell types allowing almost
any cell to be effected by the stimulation of type I IFNs (321). Binding of IFN-α or IFN-
β to the IFNAR signals through the JAK-STAT pathway, where JAK1 and Tyk2
phosphorylate STAT1 and STAT2. STAT1-STAT2 binds to IRF9 and induces the
expression of interferon-stimulated genes (ISGs) by binding to interferon-sensitive
response elements (ISREs) (146). Type III IFNs (IFN-λ) also induce the production of
the antiviral state through ISG expression (176). There are 3 proteins in the IFN-λ
family, IL-29 (IFN-λ1), IL-28a (IFN-λ2), and IL-28b (IFN-λ3) (277). Humans have all
three IFN-λs; however, IFN-λ1 is a pseudogene in mice (133). IFN-λ has been shown to
be the predominant IFN produced following influenza virus infection in the mouse lung
(159). IFN-λ utilizes the IFN-λ receptor (IFNLR) which is a heterodimer of IL28Rα and
IL10Rβ (81). Although IFN-λ uses a distinct receptor, it still signals through the STAT1-
STAT2 pathway (176, 326). Mice lacking the IL28Rα have slightly increased mortality
and viral load, but the presence of type I interferons are able to overcome the lack of IFN-
32
λ signaling (217). Furthermore, IFNAR knock-out mice also only show slightly
increased mortality, which supports the idea that type I and type III IFNs provide similar
roles (159). However, in the absence of IFNAR1 and IL28Rα, STAT1, or STAT2, all
mice succumb to infection compared to complete protection in wild type mice (159, 217).
PKR, 2’5’-oligoadenylate synthetase (OAS)/ RNase L, and Mx1 (MxA in humans) are
important ISGs known to be up regulated by IFN signaling which help make cells
resistant to influenza virus infection (164).
Besides the induction of the antiviral state, infected epithelial and
macrophages/dendritic cells produce large amounts of chemokines and pro-inflammatory
cytokines to initiate cellular recruitment and activation/stimulation, respectively (163).
Following infection, epithelial cells secrete large amounts of MCP-1, RANTES, and IL-
8, whereas macrophages produce high levels of MIP-1α/β, MCP-1 and -3, IP-10, and
RANTES (164). These chemokines drive the recruitment of additional mononuclear cells
to the lung airways to combat the infection (163). The predominant pro-inflammatory
cytokines secreted are IL-1β, IL-6, TNF-α, IL-12 and IL-18 in addition to the IFNs and
these cytokines are produced by macrophages, dendritic cells, and epithelial cells (163,
268). Expression of these cytokines, as well as the chemokines, enhance activation and
maturation of antigen presenting cells (APCs), natural killer (NK) cells, and T cells
driving the Th1 response, discussed below (163, 273).
Although the innate immune response has multiple methods to reduce viral load,
influenza virus can also combat the induction of the innate response through the
expression of the NS1 protein (131). The influenza virus NS1 antagonizes the production
of IFNs, host mRNA synthesis, and induction of ISGs (270). First, the NS1 protein
33
blocks the IFNα/β response by binding and sequestering dsRNA, thus reducing the ability
of the cell to recognize viral replication through PKR and OAS (80). Furthermore, the
NS1 obstructs maturation of host mRNAs through binding of cleavage-polyadenylation
stimulating factor (CPSF) and blocking 3’ polyadenylation of host pre-mRNA halting
protein production of host genes (232). Finally, the NS1 protein binds to TRIM25
inhibiting the activation of RIG-I (110). Alternatively, NS1 blocks IFN induced proteins
to limit the antiviral state. The NS1 protein binds to PKR inhibiting its phosphorylation
of eIF2α, which renders eIF2α unable to block protein synthesis (24). Furthermore, NS1
binds to OAS and blocks activation of RNase L resulting in lack of RNA degradation
(216). In an alternative method to enhance virus replication, the NS1 protein activates
phosphatidylinositide 3-kinase (PI3K) potentially limiting apoptosis of the cell (130).
The lack of IFNα/β during the initial stages of the infection also reduces the ability of
DCs to mature which helps influenza virus initially evade the immune response (99).
Influenza viruses containing a mutated NS1 gene readily induce type I IFN secretion and
because of this, the virus is highly attenuated resulting in low virion output (337). The
innate immune response controls the infection until the adaptive immune response can
clear the remaining infected cells.
Adaptive immune response
The innate and adaptive immune system is bridged in part through the
presentation of antigens by professional APCs. The IFNs produced during the innate
response are also important for maturation of APCs, particularly DCs, to up-regulate
expression of MHC molecules, chemokines receptors, and co-stimulatory molecules
34
(314). Mature APCs home to the secondary lymphoid tissue for activation of the
adaptive immune cells (314). The adaptive immune system is separated into two arms,
i.e. the humoral and cell-mediated response. The humoral response is characterized by
the production of antibodies (172). Although antibodies are produced against most of the
influenza virus proteins, the antibodies against the HA protein provide viral neutralization
that can produce sterilizing immunity against homologous virus challenge, and mouse
studies suggest that this may occur without the need for a T cell response (40).
Furthermore, antibodies recognizing the NA and M2 proteins provide additional
assistance in viral clearance through blockade of virion budding and antibody dependent
cell-mediated cytotoxicity of infected cells by NK cells and complement-mediated
cytotoxicity, respectively (83, 158, 336). As previously discussed, antibodies against the
globular heads of HA and NA are only effective if the virus does not undergo antigenic
drift, but recent studies have shown the efficacy of cross-reactive antibodies directed to
the conserved stalk region of the HA protein and the conserved M2 protein (231, 290).
Another approach to provide heterologous protection is through the induction of the cell-
mediated immune response which is directed at conserved, internal viral proteins. In the
absence of antibody generation (e.g. μMT knockout mice), CD8+ T cells have been
shown to control the infection in mice, but in the absence of both antibody and CD8+ T
cells, few mice survive infection (319).
The cell-mediated immune response is characterized as the T cell-side of the
adaptive response. Peptides are presented to naïve CD8+ and CD4+ T cells through
major histocompatibility complex (MHC) class I and II, respectively (144, 261). Both
CD4+ and CD8+ T cells require initial activation from a professional APC (2). This
35
occurs through binding to MHC expressing a foreign antigen to the T cell receptor (TCR)
with co-stimulation by CD28 binding B7 on the APC (286). Activation up-regulates the
expression of the high affinity IL-2R, CD40L, and FasL (2). For influenza virus
infection, the CD8+ T cell response in the airways begins to establish between day 5-6,
peaking around 10 days post-infection, followed by contraction by day 14 post-infection
(203). This coincides with the elimination of virus by day 7 or 8 post-infection (203).
Generally, the CD4+ T cell response peaks in the lungs prior to the CD8 response (263).
During the contraction phase, a small population remains as memory cells, i.e. either
central or effector memory, that activate more rapidly upon re-exposure to antigen (39,
69, 78).
CD4+ T cells or T helper (Th) cells drive the immune response toward a Th1-,
Th2-, or Th17-based response through the elaboration of cytokines at the site of infection
(172). Influenza virus infection imitates a Th1-type response by the presence of IL-12
produced by APCs (49). The Th1 cells provide a role in the affinity maturation and class
switching of antibodies to a mucosal IgA and serum IgG2a subtype expression in mice in
germinal centers (referred to as TFH cells) (303). Interaction of CD40, present on B cells,
and CD40L, present on the TFH cells, maximize the humoral response and induce the
development of memory and plasma cells (185). Th1 cells also produce large amounts of
IL-2 enhancing the expansion of the CD4 and CD8 T cell populations (303), and more
evidence is showing cytotoxic abilities of the Th1 cells (43, 200). Cytotoxic CD4+ T
cells have the transcription factor eomesodermin, and provide effector functions through
granzyme B, FasL, and perforin, although the CD4+ T cells do not necessarily have to
derive from the Th1 lineage (303). Th1 cells are characterized by the presence of the
36
transcription faction T-bet (304) and produce IFNγ and TNF-α driving the CD8+ T cell
response (44) as well as enhancing memory CD8+ T cell generation (157). A large
amount of the CD4+ T cells in humans against the pandemic H1N1 is directed against the
M, PB1, NP, HA, and NA proteins (116). A recent study showed the importance of
CD4+ T cells in heterologous protection (343). CD4+ T cells were isolated from healthy
donors, with no pre-existing antibody response to the challenge virus, prior to and
following infection with a H3N2 or H1N1 viruses. Individuals with pre-existing CD4+ T
cells against internal proteins, rather than CD8+ T cells, had reduced disease severity and
virus shedding (343). These CD4+ T cells also showed cytotoxic effects against their
targets as well as recognized peptides derived from the pandemic H1N1 (343). This
study demonstrates the importance of the CD4 response in cross-protection.
CD8+ T cells or cytotoxic T lymphocytes (CTLs) have an important role in the
final clearance of influenza virus. CD8+ T cells use perforin/ granzymes, and Fas/FasL
interaction to kill infected cells through the recognition of MHC I: antigenic peptide
complexes (320). Another mechanism CD8+ T cells utilize to remove virally infected
cells is through TRAIL binding (41). CD8+ T cells also produced and enhance the
production of chemokines and cytokines, such as RANTES (48), TNF-α (347), and IFN-γ
(132). All these mechanisms used by CD8+ T cells overlap providing alternative
mechanisms of clearance in the absence of another (132). The CD8+ T cells are primed
in the lung-draining lymph nodes as well as in spleen resulting in the generation of
effector and memory cells, discussed below (325). These cells then traffic to the lungs to
remove virally infected cells (202). During infection, DCs are also recruited to the lungs
and provide an important role in the maintenance of CD8+ T cell effector functions
37
(210). Besides the CD8+ T cell effector functions, recent work is emerging providing a
regulatory role for CD8+ T cell through the production of IL-10 (302). Like the CD4+ T
cells, there are immunodominant epitopes for CD8+ cells during influenza virus
infection. In the C57BL/6 mouse model, the NP366-374 and PA224-233 specific CD8+ cells
dominate the acute infection whereas the NP366-374 is the dominant CD8+ T cell during a
challenge infection (22, 23, 67, 178). The immunodominant epitope found in the human
population is M158-66, which is presented by HLA-A*201 (270). This HLA is common
within humans and can be seen in over 50% of the population. It has been hypothesized
that the increase in the NP366-374 CD8+ T cell population may be due to the cells that
present this epitope. NP366-374 is commonly expressed by most cells including dendritic
cells and non-dendritic cells, while the PA224-233 peptide is almost exclusively expressed
on DCs (67). During the acute infection most naïve cells are activated by DCs allowing
the NP and PA epitopes to be co-dominant; however, memory cells can be activated by a
range of cells, thus allowing NP-specific cells to be activated more readily (67). Other
epitopes are subdominant to the NP and PA response including PB1703-711, PB1-F262-70,
NS2114-121, M1128-135, HA332-340, and HA211-225 (22, 222). However, these dominant and
subdominant epitopes change depending on the mouse model and varying between
human individuals with some epitopes being similar among similar alleles.
Activation of naïve T cells results in massive proliferation (228). The activated
cells lose the express of IL-7R in return for co-stimulatory molecules, such as CD40L, to
increase the activation of APCs and B cells, as well as FasL and high affinity IL-2R (2).
The effector cells also express high levels of killer cell lectin-like receptor G1 (KLRG1)
(187). Once terminally differentiated into an effector cell there is lowered proliferation
38
and a short life expectancy due to increases in pro-apoptotic factors, such as Bim1, at the
peak of activity (68). The pro-apoptotic factors and binding of FasL assist in the
contraction phase of an immune response following clearance of the pathogen (86, 247).
A small subset of T cells will differentiate into a memory phenotype through changes in
inflammation, cytokine milieu, and amount of antigen present, although the exact model
for differentiation preference is still debated (162, 165, 239). Two memory phenotypes
can be acquired: effector memory or central memory. These two populations are
classified based in part on the surface markers and localization following clearance of the
pathogen (165, 338). Effector memory cells are generally characterized as
CD44hi
CD62Llo
CCR7lo
and remain at the site of infection. These cells are the first
responders in the instance of reinfection, expressing high levels of cytokines but have
limited proliferation capabilities (68, 322). Central memory cells are generally
characterized as CD44hi
CD62Lhi
CCR7hi
and remain in secondary lymphoid organs.
Upon reinfection, these cells undergo massive proliferation and express multiple
cytokines (68, 165).
The CD4+ and CD8+ T cell response can recover from infection in the absence
of the other but with the consequence of delayed viral clearance (89, 315). This suggests
that both cell types are needed to establish a robust immune response and for the
development of immunological memory. In the absence of both CD8+ T cells and B
cells, CD4+ T cells alone are unable to control influenza virus infection (223).
Alternatively, MHC II knockout mice or CD4-depleted mice generate a similar CD8
response to wild type mice but lack the ability to produce a similar magnitude of CD8
39
influenza virus specific memory response, showing a role for CD4+ T cells in the
generation of memory CD8+ T cells (21, 259).
Overview of Indoleamine 2, 3- Dioxygenase (IDO)
IDO is a 45kDa intracellular enzyme that provides the first and rate limiting step
in the kynurenine pathway, where it catabolizes tryptophan (trp) into kynurenine (kyn)
(300). The structure of IDO contains 2 domains, mostly comprised of α-helixes, named
the small and large domains (300). The active site is located in a heme-containing pocket
at the intersection of the two domains. Key residues in the enzymatic function of IDO
are F226, F227, and R231 (300). Mutation of these residues results in severely decreased
enzymatic activity (300). The main function of IDO is to oxygenate the C-2 and C-3
double bond of the indole ring of trp through binding of O2 (300, 313). First, IDO
interacts with an O2 molecule through the ferrous ion of the heme group (313). The O2
molecule binds to trp producing a dixetane intermediate which is released from the
ferrous ion (300). Electron shifting produces N-formylkynurenine from the dixetane
intermediate (313). N-formylkynurenine is converted to kynurenine in the presence of
H2O with the release of formic acid (313).
IDO was first described in the mid-1970s as a new class of enzymes which utilize
superoxide anions as a substrate (145), with the first link to disease following detection of
pulmonary IDO activity in mice following intraperitoneal injection of lipopolysaccharide
(LPS) (138, 351). However, the impact of IDO activity was not fully appreciated until it
was shown to provide protection against T cell mediated allogeneic fetal rejection (226).
IDO is expressed by a variety of cells including plasmacytoid and monocyte-derived
40
dendritic cells (59, 275), macrophages and microglia cells (122, 224), epithelial and
endothelial cells (331), and astrocytes (301). IDO activity is found at high levels in
multiple tissues including the epididymis, uterus, spleen, small intestines, prostate, and
many types of cancerous cells with lower levels of expression in lung and brain tissue
(70); however, these sites can produce high levels following IDO induction (123, 352).
The promoter region of IDO contains interferon-sensitive response elements
(ISRE) that are stimulated in response to type I and type II interferons (254). IFN-γ is
considered one of the strongest inducers of IDO activity which lends to the potential role
IDO has on the immune response against infection (312). Other molecules have been
associated with increased IDO activity, albeit to varying levels of activity. The regulatory
molecule, CTLA-4, expressed by Treg cells increases the activity of IDO in APCs (121).
Treg cells induce a positive feedback loop of IDO expression through binding of CTLA-4
to APCs inducing the expression of IDO which in turn increases the number of Treg
resulting in increased IDO expression (182). Tregs are pivotal in the function of IDO
suppression, and their role is discussed below. Besides IFN-γ, other immune mediators
stimulate IDO activity including CpG motifs through TLR9 stimulation (344), type I
IFNs (340), LPS (30), and TNF-α (341). IFN-γ treated HeLa cells showed enhanced IDO
expression with the addition of TNF-α or IL-1 (12). The IDO expression synergy is
partially mediated by up-regulation of the IFNGR from TNF-α and IL-1 stimulation and
subsequent NF-κB activation (280). The activity of IDO can be suppressed with the
pharmacological competitive inhibitor, 1-methyl-D, L-tryptophan (1MT) (160). 1MT
induces little to no toxicity on the tissue or cells and can be used in vivo through oral
administration or in vitro (4, 46, 148, 160).
41
In recent years a similar enzyme to IDO1, Indoleamine 2, 3-dioxygenase-like 1
(INDOL1) or IDO2, has been discovered that has a similar structure (about 43%
similarity) and function; however it is differentially regulated (15). Both enzymes are
located on chromosome 8 as adjacent genes in both mice and humans suggesting that the
development of both enzymes was due to gene duplication (14, 214). Although IDO1
and IDO2 have a similar function, IDO1 has a lower Vm compared to IDO2 allowing
IDO1 to metabolize trp faster than IDO2 because of a higher substrate affinity (212).
Furthermore, the tissue expression and potential signaling pathways vary (214). While
both enzymes can be expressed by APCs and in tissues such as lungs, brain and the male
and female reproductive system, IDO2 has been shown to be more highly expressed and
distributed in the kidney, placenta, and liver (108, 214). A recent study showed that in
the absence of IDO1, using IDO1 -/- mice, IDO2 expression is increased apparently to
compensate for the lack of regulation in immune privileged sites, such as the epididymis
(108). Both enzymes can be transcribed using the full length sequence or as truncated
forms using an alternative 5’ exons leading to the possibility of various promoter sites
(15, 214). It has recently been reported that there is a difference in the isoform that 1-
methyl-tryptophan can block, with IDO1 being better inhibited by the L-isoform and
IDO2 utilizing the D-isoform more readily (15, 214). However, this preference is not
absolute as the opposite preference has also been reported (353). Furthermore, new
inhibitors, INCB024360 and Amg-1, are emerging to selectively inhibit IDO1 which will
aid in distinguishing the differences between the roles IDO1 and IDO2 (188, 212, 288).
42
Mechanism of IDO Immune Suppression
IDO activity results in an immunosuppressive environment through the
catabolism of trp and providing the first step in the production of kyn and its metabolites,
which are discussed in more detail below. The depletion of trp causes T cell arrest in the
G1 phase of the cell cycle (186). This mechanism is mediated through the general
controlled nonrepressed 2 (GCN2) kinase (225). GCN2 is activated by accumulation of
uncharged tRNA, in this case the depletion of trp (225). The activation of GCN2 leads to
the down regulation of the TCR zeta chains inhibiting TCR signaling (96). The trp-
deprived T cells are more susceptible to Fas-mediated apoptosis (186). In pDCs, GCN2
activation phosphorylates eIF2α which up-regulates NF-κB, IFNGR, and C/EBP
homology protein (CHOP) while reducing expression of IL-6 (276, 288). The kyn
produced from trp metabolism can bind and activate the aryl hydrocarbon receptor (AhR)
present on naïve T cells and, in combination with trp starvation, sways the T cells to a
Treg (CD4+Foxp3+CD25+) phenotype (215). Because IDO can be up-regulated from
binding of CTLA-4, it also has roles in Treg differentitation (121). As previously
described, binding of CTLA-4 to DCs increases the production of type I and II
interferons resulting in a positive feedback of increased IDO expression (97). There is a
fine line in the differentiation of naïve CD4+ cells to the Th17 or Treg phenotype. Th17
cells are distinguished by the production of IL-17, IL-23, and the expression of the
transcription factor RORγT (154), while Treg cells express high levels of CD25, GITR,
secrete IL-10 and TGF-β, and most express the transcription factor FoxP3 (13, 28). The
cytokine milieu drives the differentiation. In the presence of TGF-β, TCR activation
drives CD4+ cells to become Treg cells, while TGF-β and IL-6 provide the signals for
43
Th17 differentiation (172). These are the classical ways of Treg and Th17
differentiation; however, other mechanisms have been described (13, 60, 107, 334).
Activation of IDO suppresses the secretion of IL-6, thus creating an environment for Treg
production and suppression of the immune response (11). In the presence of 1MT, IL-6
production is increased producing an enhanced pro-inflammatory environment (98).
Interestingly, the reverse has also been demonstrated where IL-6 expression regulates the
degradation of the IDO protein (93). IDO1 contains two immunoreceptor tyrosine-
based inhibitory motifs (ITIMS) which are phosphorylated in the presence of
inflammation, in particular IL-6 (241). In pDCs, the phosphorylated ITIMS interact with
suppressor of cytokine signaling 3 (SOCS3) which mediates the proteasomal degradation
of IDO1 (242). Alternatively, in a TGF-β predominant environment, the ITIMS are
phosphorylated by Fyn rather than Src kinase and result in noncanonical NF-κB
activation which continues to produce TGF-β maintaining a regulatory environment (93,
206).
Studies are emerging showing the frequency and role of Tregs during a natural
influenza virus infection. The CD4+Foxp3+ Treg population peaks in number and
frequency prior to the peak CD8+ T cell response around day 7-8 post-infection, but peak
activation of the Treg cells is at the peak CD8 response, day 11 post-infection (29).
Furthermore, the induced Tregs proliferate in the presence of influenza virus infected
DCs, suggesting that these cells are influenza virus specific (29). Moreover, a recently
published study showed the dampening effect of Treg induction on the generation of
memory influenza-specific CD8+ T cell (42). There was an increased frequency of
NP366- and PA224-specific CD8+ T cells in the lungs of mice following memory challenge
44
when the Foxp3+ Treg were depleted prior to challenge compared to isotype-depleted
controls (42). But the Treg depleted mice produced enhanced pathology compared to
control mice (42). IDO activity is present in the lungs of influenza virus infected mice
peaking at day 10-11 post-infection which correlates with the time frame of Treg
development and activation during influenza virus infections (29, 351).
Kynurenine Pathway Metabolites
Kyn can be broken down further into other metabolites through additional
enzymes which are associated with neurological activities (16). Kynurenine
aminotransferase produces kynurenic acid (KA), which has been link to neuronal activity
and being a neuroprotectant (57, 220). High levels of this compound were associated
with sedation and provided protection during brain injuries (47). Alternatively, high
concentrations of KA have been associated with individuals suffering from schizophrenia
(235), suggesting a possible effect of long term exposure to KA on brain functioning. An
alternative pathway leads kyn toward the production of nicotinic acid dinucleotide
(NAD). This pathway utilizes kynurenine 3-hydroxylase or kynureninase to produce 3-
hydroxykynurenine (3-HK) or anthranilic acid (AA), respectively (57). Kynureninase
also hydrolyses 3-HK into 3-hydroxyanthranillic acid (3-HAA). AA is also oxidized to
3-HAA but mediated by anthranilic acid 3-hydrolase. 3-HAA is a neurotoxin and has
been shown to be both a free radical generator in the presence of copper as well as an
antioxidant, depending on the microenvironment (117, 219). 3-HAA has also been
implicated in blocking NF-κB signaling of macrophages. Furthermore, evidence suggests
that 3-HAA has a suppressive effect on T cell proliferation and activation through
45
inhibition of PDK1 activation (139). 3-HAA selectively targets Th1 cells to undergo
apoptosis through caspase-8 activation (94) and skewing toward a Th2-type response
(252). 3-hydroxyanthranilic acid oxygenase (3-HAO) produces quinolinic acid (QA)
from 3-HAA (57). QA has also been shown to have a negative effect on T cell activation
(95). Similar to 3-HAA, QA produced by pDCs induces apoptosis in Th1 cells (19) and
inhibits the activation of CD8+, CD4+ T cells, and NK cells (105). At high
concentrations (57), QA can be toxic which has associated it with neurodegenerative
diseases, such as Alzheimer’s disease (122) and Huntington’s disease (267). QA is
broken down by quinolinic acid phosphoribosyltransferase (QPRT) into nicotinic acid
mononuleotide (NaMN) (57). An additional adenylate is transferred to the NaMN which
is processed to NAD (57).
IDO’s Role in Infectious Disease Pathogenesis
While IDO has been shown to promote immune evasion of cancer, studies are
emerging now focused on pathogen regulation of IDO activity. Modulation of the
immune response has been seen with viruses, bacteria, parasites, and fungi. Although the
association of IDO activity varies between pathogens, ultimately IDO (1) helps dampen
the immune system, (2) produces a regulatory environment causing the pathogen to
remain stealth from the immune system, or (3) blocks essential trp availability to a
pathogen. Although only a handful of diseases have been studied in regard to IDO
activity, in the future, most likely more associations will be observed. Alternatively,
these studies show potential for IDO inhibition to counteract the immune suppression and
result in enhanced clearance or immune response to infections or vaccinations.
46
IDO activity has been associated with suppression of the immune response
following infection. IDO activity is strongly up-regulated in murine lungs, bronchiolar
and alveolar epithelial cells, and alveolar macrophages following infection with various
respiratory pathogens, including influenza virus, Histoplasma capsulatum (H.
capsulatum), Mycobacterium tuberculosis (TB), and Rhodococcus equi (R. equi) (33,
128, 141, 352). During influenza virus infections, inhibition of IDO using 1MT resulted
in an enhanced Th1 response but with no effect on viral load (103). IDO inhibition
following infection with H. capsulatum reduced fungal burden in the lungs and
inflammation in the lungs and spleen (128). Although work has emerged showing IDO
induction in the lungs during TB infections, the complete role of IDO in this system is
still unknown. In vitro studies of TB infection show an enhancement in T cell killing
ability following IDO inhibition in DCs, which was related to the production of picolinic
acid, a kynurenine metabolite (33). In vivo quinolinic acid (QA) is produced over
picolinic acid, resulting in no effect in mice (33). Besides DC expression of IDO,
epithelial cell expression of IFN-γ induced IDO provides a strong protection from TB
infection (75). Mice expressing mutant IFN-γ receptors only in nonhematopoietic cells
resulted in enhanced bacterial load, faster death, and increased inflammation (75).
Increased inflammation in the absence of IDO expression was also observed during R.
equi infection (141). In this model, IDO knockout mice had no difference in bacterial
load, but had reduced numbers of TGF-β expressing cells and Treg cells, which
ultimately enhanced the inflammation present in the liver during infection (141). IDO
activity has also been shown to be up-regulated in bladder tissue, heart, and intestinal
goblet cells during uropathogenic E. coli (UPEC), acute viral myocarditis, and Trichuris
47
muris (T. muris) infections, respectively (18, 147, 192). In bladder tissue specific IDO -/-
mice, UPEC infections enhanced inflammation but in turn, reduced the bacterial survival
(192). Furthermore, acute viral myocarditis induced expression of IDO in the spleen and
heart and IDO inhibition with 1MT or with knockout mice, increased type I interferon
response and reduced the viral load enhancing survival of the animals (147). Finally,
IDO activity has been linked to the regulation of epithelial cell turnover during T. muris
infections of the intestines in SCID mice (18). Colonic epithelial cells and goblet
expressed IDO and blockade of IDO increased the sloughing of the T. muris infected
cells (18). These studies illustrate the benefit of immune dampening to suppress a T cell
response thus reducing pathology caused by a pathogen but at the cost of enhanced
clearance.
IDO produces a regulatory environment that certain pathogens exploit to maintain
a chronic infection. HIV infected individuals have increased IDO activity in lymphoid
tissues over uninfected individuals (9, 287) which correlated with the skewing of naïve
CD4+ T cells to a Treg phenotype from a protective Th17 response (98). In the SIV
model, IDO inhibition with 1MT in combination with antiretroviral therapy (ART)
reduced the viral load in the lymph nodes (36). Alternatively, a recent publication
showed no changes in T cell activation or viral rebound when 1MT was administered
following ART therapy, suggesting that 1MT may be more effective during ART therapy
rather than as a subsequent treatment (87). Furthermore, in a study using the mouse
equivalent of AIDS, IDO was active during infection, but IDO knockout mice did not
affect the disease progression or outcome as compared to wild type mice (194). The
increased IDO activity was also evident in isolated PBMCs from HIV-infected
48
individuals where CD4+ T cell proliferation were increased following ex vivo treatment
with 1MT to block IDO activity (35). It was determined that the IDO-mediated
suppression was derived from the HIV gp120 protein interacting with pDCs in the culture
(35). When pDCs were isolated from HIV-uninfected individuals and exposed to HIV,
the pDCs increased activation markers on CD4+ and CD8+ T cells in an interferon
dependent manner, but reduce the T cells proliferation through cell cycle arrest and up-
regulation of CHOP (34). So, evidence suggests that IDO may provide a pivotal role in T
cell activation and concurrent suppression during HIV infections. In the lymphoid
tissues, IL-32 production from immune cells, i.e. CD4+ T cells, macrophages, DCs, and
B cells, increased the activity of IDO and resulted in immune impairment and enhanced
virus replication (287). 1MT treatment during HIV induced encephalitis in SCID mice,
reconstituted with human PBMCs, and increased the number of HIV specific CD8+ T
cells and reduced the amount of infected macrophages (257).
Furthermore, IDO-mediated suppression also occurs during chronic hepatitis B
(HBV) and hepatitis C virus (HCV) infections. PBMCs collected from chronically HBV-
infected individuals showed increased IDO expression and activity with positive
correlation with viral load and T cell presence (58). Alternatively, in vitro, IDO
expression in human hepatocytes following HBV infection reduced the viral load (199).
Cells expressing an inactive IDO protein or supplemented with tryptophan restored HBV
replication (199). Similar results were observed during HCV infection of chimpanzees
where increased IDO expression in the liver correlated with a chronic infection (181).
The regulatory environment has also been observed with multiple protozoan and
bacterial infections leading to the development of a chronic infection state. Leishmania
49
species (L. major, L. infantum, L. donovani) infection shift the immune system to an
inadequate response through the up-regulation of IDO (195). The major source of IDO
activity is Leishmania infected DCs, which drive the stimulation and proliferation of Treg
cells located at the site of infection (299). Interestingly, the increased IDO activity is not
dependent on a live infection and can be induced by Leishmania lysate (82). A recent
study measured the ability of exogenous OVA-specific CD8 T cells to proliferate if
stimulated in a L. major infected mouse (196). The study showed that L. major infections
induced IDO expression in the draining lymph nodes and suppressed the proliferation of
the OVA-specific CD8 T cells (196). This suppression was reversed is the presence of
1MT and the Th17 cell population was increased with reduced parasite burden (196).
Alternative to IDO activity suppressing the immune response in favor of the
pathogen, IDO expression and the subsequent removal of trp from the microenvironment
is detrimental to the growth of some pathogens, including Toxoplasma gondii (T. gondii),
Trypanosoma cruzi (T. cruzi), and herpes simplex type 2 virus (3, 127, 173). T. gondii
infections induce the expression of IFN-γ which in turn up-regulates IDO activity (106).
The presence of IDO during infection reduces the growth of T. gondii through depletion
of trp (250). IDO mutant cells that were stimulated with IFN-γ were unable to suppress
the growth of the parasite (316). A recent study showed that in IDO knockout mice or
mice treated with 1MT had reduced levels of T. gondii surface antigen gene 2 mRNA
expression and inflammation during an intranasal infection with T. gondii as compared to
controls (227). Alternatively, IDO activity can be regulated by the oxygen supply in
tissues (269). IDO expression is reduced in hypoxic regions which reduced the
suppression of T. gondii growth (269). During T. cruzi infections, IDO activity is
50
systemically up-regulated and is a key player in the ability of T. cruzi to replicate in
macrophages (173). IDO inhibition with 1MT during infection increases the parasite
burden in mice and reduces the ability of the animal to fight the infection (173). Also,
herpes simplex type 2 virus induces IDO activity in an IFNγ dependent manner in human
cervical cells reducing the virus replication (3). The replication suppression can be
reversed through administration of L-tryptophan to the cells (3). Likewise, a limitation of
West Nile Virus (WNV) spread has been associated with IDO expression (350). WNV
infected human monocyte-derived macrophages induced the expression of IDO in
uninfected cells through the stimulation of TNF-α and signaling through the NF-kB
pathway (350). Overexpression of IDO reduced viral replication and this effect was
reversed with the addition of tryptophan (350).
Finally, work is emerging providing a role for IDO manipulation in the context of
enhanced vaccination as well as utilizing IDO expression as a biomarker of disease
progression. In a study testing the inflammatory response of the Bacillus Calmette–
Guérin (BCG) vaccine against subsequent TB infections showed that mock vaccinated
macaques had significant increases in IDO activity in TB lesions compared to BCG
vaccinated animals (211). BCG vaccination resulted in higher levels of chemokines and
reduced bacterial load following challenge (211). This study suggests the ability of a
vaccine to modulate IDO activity following challenge and since TB utilizes IDO to
provide a regulatory environment, reduction in IDO activity enhanced pathogen
clearance. IDO activity has also been associated with increased T cell memory
generation following vaccination with an inactivated influenza virus in the presence of α-
galactoceramide (α-GalCer) (125). IDO was induced following vaccination which
51
resulted in reduced initial T cell generation, but enhancing memory T cell generation
through up-regulation of Bcl-2 (125). In addition, decreased IDO activity was observed
following vaccination with a DNA-pox virus vaccine against SIV (327). After challenge,
the vaccinated macaques showed reduced levels of immune suppressive molecules, such
as Tregs, TGF-β, and IDO in mucosal sites which helped reduce the viral load in these
tissues, although there was no effect on the depletion of CD4+ T cell (327). Additionally,
a recent study evaluated the efficacy of a recombinant HBV vaccine in individuals
undergoing hemodialysis (90). The individuals receiving dialysis had increased IDO
activity prior to vaccination as compared to healthy individuals which resulted in a
dampened antibody response to vaccination, as determined by antibodies to the hepatitis
B surface antigen (90). Suppression of IDO in individuals with an impaired ability to
produce a robust adaptive immune response, like those seen undergoing hemodialysis,
may be a method to enhance vaccine efficacy. Alternatively, when this hypothesis was
tested in mice, albeit without the impaired immune response, IDO inhibition using 1MT
during vaccination with a hepatitis B surface protein resulted in reduced antibody
production (91). Modulation of IDO expression is also being examined against cancer.
Recently, a study showed systemic delivery of a Salmonella Typhimurium vector
containing a shRNA against IDO1 infiltrated the tumor and reduce the host IDO
expression (32). The reduction in IDO expression resulted in increased recruitment of
neutrophils to the tumor site with enhanced reactive oxygen species production (32).
Apart from modulating IDO activity during vaccination, the expression of IDO
has being linked to disease severity and could potentially be utilized as a biomarker. A
recent study examined the levels of IDO activity in individuals diagnosed with visceral
52
leishmaniasis. The study found that individuals that were treated for the infection had
IDO activity comparable to uninfected control, but there was enhanced IDO activity in
individuals still infected with leishmania (114). The expression of IDO is also being
examined as a biomarker for severity of sepsis (151, 308). Plasma samples derived from
individuals with varying severities of sepsis, including septic shock, severe sepsis, and
sepsis, showed increased IDO activity with increasing severity as compared healthy
controls (308). Individuals with a high kyn/trp ratio (greater than or equal to
120μmol/mmol) were associated with an increased risk of death compared to individuals
that survived the septic infection (151). These studies suggest the use of IDO activity to
improve diagnostics and prognosis of diseases and potentially lead to better treatment
regimens.
Conclusions
Influenza virus impacts humans worldwide and new approaches need to be
evaluated to enhance the efficacy of vaccination. The current vaccine provides a strong
humoral response against homologous challenges but flounders if the vaccine strain does
not match the circulating strain of influenza virus. There is a push to enhance the T cell
immunity following vaccination to provide increased cross-protection. Since IDO is
known for dampening T cell responses and has a history of immune modulation during
various infections, it is a logical approach to determine the effect of IDO inhibition on the
immune response, in particular to enhance the T cell response. Furthermore, the usage of
the IDO inhibitor, 1MT, is already in clinical trials which would accelerate the approval
for IDO inhibition during vaccination and disease intervention strategies.
53
References
1. Centers for Disease Control and Prevention. Updated CDC Estimates of 2009
H1N1 Influenza Cases, Hospitalizations and Deaths in the United States, April
2009 – April 10, 2010, http://www.cdc.gov/h1n1flu/estimates_2009_h1n1.htm.
2. Abbas, A. K., A. H. Lichtman, and S. Pillai. 2007. Cellular and molecular
immunology, 6th ed. Saunders Elsevier, Philadelphia.
3. Adams, O., K. Besken, C. Oberdorfer, C. R. MacKenzie, D. Russing, and W.
Daubener. 2004. Inhibition of human herpes simplex virus type 2 by interferon
gamma and tumor necrosis factor alpha is mediated by indoleamine 2,3-
dioxygenase. Microbes Infect 6:806-812.
4. Agaugue, S., L. Perrin-Cocon, F. Coutant, P. Andre, and V. Lotteau. 2006. 1-
Methyl-tryptophan can interfere with TLR signaling in dendritic cells
independently of IDO activity. J Immunol 177:2061-2071.
5. Agostini, L., F. Martinon, K. Burns, M. F. McDermott, P. N. Hawkins, and J.
Tschopp. 2004. NALP3 forms an IL-1beta-processing inflammasome with
increased activity in Muckle-Wells autoinflammatory disorder. Immunity 20:319-
325.
6. Alexander, D. J. 2000. A review of avian influenza in different bird species. Vet
Microbiol 74:3-13.
7. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001.
Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like
receptor 3. Nature 413:732-738.
54
8. Allen, I. C., M. A. Scull, C. B. Moore, E. K. Holl, E. McElvania-TeKippe, D.
J. Taxman, E. H. Guthrie, R. J. Pickles, and J. P. Ting. 2009. The NLRP3
inflammasome mediates in vivo innate immunity to influenza A virus through
recognition of viral RNA. Immunity 30:556-565.
9. Andersson, J., A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G.
M. Shearer, and C. A. Chougnet. 2005. The prevalence of regulatory T cells in
lymphoid tissue is correlated with viral load in HIV-infected patients. J Immunol
174:3143-3147.
10. Anker, W. J., A. K. Bakker, and N. Masurel. 1978. Cross-protection in mice
after immunization with H2N2, H3N2, and Heq2Neq2 influenza virus strains.
Infect Immun 21:96-101.
11. Baban, B., P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H.
Munn, and A. L. Mellor. 2009. IDO activates regulatory T cells and blocks their
conversion into Th17-like T cells. J Immunol 183:2475-2483.
12. Babcock, T. A., and J. M. Carlin. 2000. Transcriptional activation of
indoleamine dioxygenase by interleukin 1 and tumor necrosis factor alpha in
interferon-treated epithelial cells. Cytokine 12:588-594.
13. Bacchetta, R., S. Gregori, and M. G. Roncarolo. 2005. CD4+ regulatory T
cells: mechanisms of induction and effector function. Autoimmun Rev 4:491-496.
14. Ball, H. J., A. Sanchez-Perez, S. Weiser, C. J. Austin, F. Astelbauer, J. Miu,
J. A. McQuillan, R. Stocker, L. S. Jermiin, and N. H. Hunt. 2007.
Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans
and mice. Gene 396:203-213.
55
15. Ball, H. J., H. J. Yuasa, C. J. D. Austin, S. Weiser, and N. H. Hunt. 2009.
Indoleamine 2,3-dioxygenase-2; a new enzyme in the kynurenine pathway. The
International Journal of Biochemistry & Cell Biology 41:467-471.
16. Baran, H., G. Amann, B. Lubec, and G. Lubec. 1997. Kynurenic acid and
kynurenine aminotransferase in heart. Pediatric research 41:404-410.
17. Barr, J. N., and R. Fearns. 2010. How RNA viruses maintain their genome
integrity. J Gen Virol 91:1373-1387.
18. Bell, L. V., and K. J. Else. 2011. Regulation of colonic epithelial cell turnover by
IDO contributes to the innate susceptibility of SCID mice to Trichuris muris
infection. Parasite Immunol 33:244-249.
19. Belladonna, M. L., U. Grohmann, P. Guidetti, C. Volpi, R. Bianchi, M. C.
Fioretti, R. Schwarcz, F. Fallarino, and P. Puccetti. 2006. Kynurenine pathway
enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO.
J Immunol 177:130-137.
20. Belshe, R. B., R. Walker, J. J. Stoddard, G. Kemble, H. F. Maassab, and P.
M. Mendelman. 2008. Influenza vaccine-live. In S. A. Potkin, W. A. Orenstein,
and P. A. Offit (ed.), Vaccines. Elsevier.
21. Belz, G. T., D. Wodarz, G. Diaz, M. A. Nowak, and P. C. Doherty. 2002.
Compromised influenza virus-specific CD8(+)-T-cell memory in CD4(+)-T-cell-
deficient mice. J Virol 76:12388-12393.
22. Belz, G. T., W. Xie, J. D. Altman, and P. C. Doherty. 2000. A previously
unrecognized H-2D(b)-restricted peptide prominent in the primary influenza A
56
virus-specific CD8(+) T-cell response is much less apparent following secondary
challenge. J Virol 74:3486-3493.
23. Belz, G. T., W. Xie, and P. C. Doherty. 2001. Diversity of epitope and cytokine
profiles for primary and secondary influenza a virus-specific CD8+ T cell
responses. J Immunol 166:4627-4633.
24. Bergmann, M., A. Garcia-Sastre, E. Carnero, H. Pehamberger, K. Wolff, P.
Palese, and T. Muster. 2000. Influenza virus NS1 protein counteracts PKR-
mediated inhibition of replication. J Virol 74:6203-6206.
25. Betakova, T. 2007. M2 protein-a proton channel of influenza A virus. Current
pharmaceutical design 13:3231-3235.
26. Betakova, T., F. Ciampor, and A. J. Hay. 2005. Influence of residue 44 on the
activity of the M2 proton channel of influenza A virus. J Gen Virol 86:181-184.
27. Betakova, T., and A. J. Hay. 2007. Evidence that the CM2 protein of influenza
C virus can modify the pH of the exocytic pathway of transfected cells. J Gen
Virol 88:2291-2296.
28. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L.
Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the
generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-
238.
29. Betts, R. J., N. Prabhu, A. W. Ho, F. C. Lew, P. E. Hutchinson, O. Rotzschke,
P. A. Macary, and D. M. Kemeny. 2012. Influenza A virus infection results in a
robust, antigen-responsive, and widely disseminated Foxp3+ regulatory T cell
response. J Virol 86:2817-2825.
57
30. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine
dioxygenase by interferon in mice: a study with different recombinant interferons
and various cytokines. Biochem Biophys Res Commun 152:237-242.
31. Biswas, S. K., P. L. Boutz, and D. P. Nayak. 1998. Influenza virus
nucleoprotein interacts with influenza virus polymerase proteins. J Virol 72:5493-
5501.
32. Blache, C. A., E. R. Manuel, T. I. Kaltcheva, A. N. Wong, J. D. Ellenhorn, B.
R. Blazar, and D. J. Diamond. 2012. Systemic delivery of Salmonella
typhimurium transformed with IDO shRNA enhances intratumoral vector
colonization and suppresses tumor growth. Cancer Res 72:6447-6456.
33. Blumenthal, A., G. Nagalingam, J. H. Huch, L. Walker, G. J. Guillemin, G.
A. Smythe, S. Ehrt, W. J. Britton, and B. M. Saunders. 2012. M. tuberculosis
induces potent activation of IDO-1, but this is not essential for the immunological
control of infection. PLoS One 7:e37314.
34. Boasso, A., A. W. Hardy, S. A. Anderson, M. J. Dolan, and G. M. Shearer.
2008. HIV-induced type I interferon and tryptophan catabolism drive T cell
dysfunction despite phenotypic activation. PLoS One 3:e2961.
35. Boasso, A., J. P. Herbeuval, A. W. Hardy, S. A. Anderson, M. J. Dolan, D.
Fuchs, and G. M. Shearer. 2007. HIV inhibits CD4+ T-cell proliferation by
inducing indoleamine 2,3-dioxygenase in plasmacytoid dendritic cells. Blood
109:3351-3359.
36. Boasso, A., M. Vaccari, D. Fuchs, A. W. Hardy, W. P. Tsai, E. Tryniszewska,
G. M. Shearer, and G. Franchini. 2009. Combined effect of antiretroviral
58
therapy and blockade of IDO in SIV-infected rhesus macaques. J Immunol
182:4313-4320.
37. Boivin, S., S. Cusack, R. W. Ruigrok, and D. J. Hart. 2010. Influenza A virus
polymerase: structural insights into replication and host adaptation mechanisms. J
Biol Chem 285:28411-28417.
38. Bottcher, E., T. Matrosovich, M. Beyerle, H. D. Klenk, W. Garten, and M.
Matrosovich. 2006. Proteolytic activation of influenza viruses by serine proteases
TMPRSS2 and HAT from human airway epithelium. J Virol 80:9896-9898.
39. Boyman, O., S. Letourneau, C. Krieg, and J. Sprent. 2009. Homeostatic
proliferation and survival of naive and memory T cells. Eur J Immunol 39:2088-
2094.
40. Bridges, C. B., J. M. Katz, R. A. Levandowski, and N. J. Cox. 2008.
Inactivated influenza vaccines. In S. A. Potkin, W. A. Orenstein, and P. A. Offit
(ed.), Vaccines. Elsevier.
41. Brincks, E. L., A. Katewa, T. A. Kucaba, T. S. Griffith, and K. L. Legge.
2008. CD8 T cells utilize TRAIL to control influenza virus infection. J Immunol
181:4918-4925.
42. Brincks, E. L., A. D. Roberts, T. Cookenham, S. Sell, J. E. Kohlmeier, M. A.
Blackman, and D. L. Woodland. 2013. Antigen-specific memory regulatory
CD4+Foxp3+ T cells control memory responses to influenza virus infection. J
Immunol 190:3438-3446.
59
43. Brown, D. M., A. M. Dilzer, D. L. Meents, and S. L. Swain. 2006. CD4 T cell-
mediated protection from lethal influenza: perforin and antibody-mediated
mechanisms give a one-two punch. J Immunol 177:2888-2898.
44. Brown, D. M., E. Roman, and S. L. Swain. 2004. CD4 T cell responses to
influenza infection. Semin Immunol 16:171-177.
45. Bruns, K., N. Studtrucker, A. Sharma, T. Fossen, D. Mitzner, A. Eissmann,
U. Tessmer, R. Roder, P. Henklein, V. Wray, and U. Schubert. 2007.
Structural characterization and oligomerization of PB1-F2, a proapoptotic
influenza A virus protein. J Biol Chem 282:353-363.
46. Cady, S. G., and M. Sono. 1991. 1-Methyl-DL-tryptophan, beta-(3-
benzofuranyl)-DL-alanine (the oxygen analog of tryptophan), and beta-[3-
benzo(b)thienyl]-DL-alanine (the sulfur analog of tryptophan) are competitive
inhibitors for indoleamine 2,3-dioxygenase. Arch Biochem Biophys 291:326-333.
47. Carpenedo, R., A. Chiarugi, P. Russi, G. Lombardi, V. Carla, R. Pellicciari,
L. Mattoli, and F. Moroni. 1994. Inhibitors of kynurenine hydroxylase and
kynureninase increase cerebral formation of kynurenate and have sedative and
anticonvulsant activities. Neuroscience 61:237-243.
48. Catalfamo, M., T. Karpova, J. McNally, S. V. Costes, S. J. Lockett, E. Bos, P.
J. Peters, and P. A. Henkart. 2004. Human CD8+ T cells store RANTES in a
unique secretory compartment and release it rapidly after TcR stimulation.
Immunity 20:219-230.
60
49. Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid
dendritic cells activated by influenza virus and CD40L drive a potent TH1
polarization. Nat Immunol 1:305-310.
50. Centers for Disease, C. 2013. Vaccine Virus Selection for the 2012-2013
Influenza Season, Seasonal Influenza (Flu),
http://www.cdc.gov/flu/about/season/vaccine-selection.htm.
51. Centers for Disease, C. 2013. What You Should Know for the 2013-2014
Influenza Season, Seasonal Influenza (Flu),
http://www.cdc.gov/flu/about/season/flu-season-2013-2014.htm#strains.
52. Centers for Disease, C., and Prevention. 2013. Emergence of avian influenza
A(H7N9) virus causing severe human illness - China, February-April 2013.
MMWR Morb Mortal Wkly Rep 62:366-371.
53. Centers for Disease, C., and Prevention. 2012. Influenza Antiviral Drug
Resistance, http://www.cdc.gov/flu/about/qa/antiviralresistance.htm.
54. Chakrabarti, A. K., and G. Pasricha. 2013. An insight into the PB1F2 protein
and its multifunctional role in enhancing the pathogenicity of the influenza A
viruses. Virology 440:97-104.
55. Chen, B. J., G. P. Leser, D. Jackson, and R. A. Lamb. 2008. The influenza
virus M2 protein cytoplasmic tail interacts with the M1 protein and influences
virus assembly at the site of virus budding. J Virol 82:10059-10070.
56. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta,
R. O'Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W.
61
Yewdell. 2001. A novel influenza A virus mitochondrial protein that induces cell
death. Nat Med 7:1306-1312.
57. Chen, Y., and G. J. Guillemin. 2009. Kynurenine pathway metabolites in
humans: disease and healthy States. International journal of tryptophan research :
IJTR 2:1-19.
58. Chen, Y. B., S. D. Li, Y. P. He, X. J. Shi, Y. Chen, and J. P. Gong. 2009.
Immunosuppressive effect of IDO on T cells in patients with chronic hepatitis B*.
Hepatology research : the official journal of the Japan Society of Hepatology
39:463-468.
59. Chung, D. J., M. Rossi, E. Romano, J. Ghith, J. Yuan, D. H. Munn, and J. W.
Young. 2009. Indoleamine 2,3-dioxygenase-expressing mature human monocyte-
derived dendritic cells expand potent autologous regulatory T cells. Blood
114:555-563.
60. Collison, L. W., V. Chaturvedi, A. L. Henderson, P. R. Giacomin, C. Guy, J.
Bankoti, D. Finkelstein, K. Forbes, C. J. Workman, S. A. Brown, J. E. Rehg,
M. L. Jones, H. T. Ni, D. Artis, M. J. Turk, and D. A. Vignali. 2010. IL-35-
mediated induction of a potent regulatory T cell population. Nat Immunol
11:1093-1101.
61. Conenello, G. M., J. R. Tisoncik, E. Rosenzweig, Z. T. Varga, P. Palese, and
M. G. Katze. 2010. A Single N66S Mutation in the PB1-F2 Protein of Influenza
A Virus Increases Virulence by Inhibiting the Early Interferon Response In Vivo.
J Virol.
62
62. Conenello, G. M., D. Zamarin, L. A. Perrone, T. Tumpey, and P. Palese.
2007. A single mutation in the PB1-F2 of H5N1 (HK/97) and 1918 influenza A
viruses contributes to increased virulence. PLoS Pathog 3:1414-1421.
63. Copeland, C. S., R. W. Doms, E. M. Bolzau, R. G. Webster, and A. Helenius.
1986. Assembly of influenza hemagglutinin trimers and its role in intracellular
transport. J Cell Biol 103:1179-1191.
64. Cordero, E., T. Aydillo, M. C. Farinas, J. R. Pano-Pardo, J. Pachon, D.
Viasus, M. Riera, F. Lopez-Medrano, A. Payeras, A. Moreno, J. Rodriguez-
Bano, J. A. Oteo, J. Martinez-Montauti, J. Torre-Cisneros, F. Segura, J.
Carratala, and A. S. G. o. t. S. f. R. i. I. D. Novel Influenza. 2012.
Immunosuppressed patients with pandemic influenza A 2009 (H1N1) virus
infection. European journal of clinical microbiology & infectious diseases :
official publication of the European Society of Clinical Microbiology 31:547-556.
65. Cros, J. F., A. Garcia-Sastre, and P. Palese. 2005. An unconventional NLS is
critical for the nuclear import of the influenza A virus nucleoprotein and
ribonucleoprotein. Traffic 6:205-213.
66. Cross, K. J., W. A. Langley, R. J. Russell, J. J. Skehel, and D. A. Steinhauer.
2009. Composition and functions of the influenza fusion peptide. Protein and
peptide letters 16:766-778.
67. Crowe, S. R., S. J. Turner, S. C. Miller, A. D. Roberts, R. A. Rappolo, P. C.
Doherty, K. H. Ely, and D. L. Woodland. 2003. Differential antigen
presentation regulates the changing patterns of CD8+ T cell immunodominance in
primary and secondary influenza virus infections. J Exp Med 198:399-410.
63
68. Cui, W., and S. M. Kaech. 2010. Generation of effector CD8+ T cells and their
conversion to memory T cells. Immunol Rev 236:151-166.
69. D'Cruz, L. M., M. P. Rubinstein, and A. W. Goldrath. 2009. Surviving the
crash: transitioning from effector to memory CD8+ T cell. Semin Immunol
21:92-98.
70. Dai, X., and B. T. Zhu. 2010. Indoleamine 2,3-dioxygenase tissue distribution
and cellular localization in mice: implications for its biological functions. The
journal of histochemistry and cytochemistry : official journal of the
Histochemistry Society 58:17-28.
71. Davidson, B. L., and P. B. McCray, Jr. 2011. Current prospects for RNA
interference-based therapies. Nature reviews. Genetics 12:329-340.
72. Dawood, F. S., A. D. Iuliano, C. Reed, M. I. Meltzer, D. K. Shay, P. Y. Cheng,
D. Bandaranayake, R. F. Breiman, W. A. Brooks, P. Buchy, D. R. Feikin, K.
B. Fowler, A. Gordon, N. T. Hien, P. Horby, Q. S. Huang, M. A. Katz, A.
Krishnan, R. Lal, J. M. Montgomery, K. Molbak, R. Pebody, A. M. Presanis,
H. Razuri, A. Steens, Y. O. Tinoco, J. Wallinga, H. Yu, S. Vong, J. Bresee,
and M. A. Widdowson. 2012. Estimated global mortality associated with the first
12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling
study. Lancet Infect Dis 12:687-695.
73. De Filette, M., W. Min Jou, A. Birkett, K. Lyons, B. Schultz, A. Tonkyro, S.
Resch, and W. Fiers. 2005. Universal influenza A vaccine: optimization of M2-
based constructs. Virology 337:149-161.
64
74. Desmet, E. A., K. A. Bussey, R. Stone, and T. Takimoto. 2013. Identification
of the N-terminal domain of influenza PA responsible for the suppression of host
protein synthesis. J Virol.
75. Desvignes, L., and J. D. Ernst. 2009. Interferon-gamma-responsive
nonhematopoietic cells regulate the immune response to Mycobacterium
tuberculosis. Immunity 31:974-985.
76. Dias, A., D. Bouvier, T. Crepin, A. A. McCarthy, D. J. Hart, F. Baudin, S.
Cusack, and R. W. Ruigrok. 2009. The cap-snatching endonuclease of influenza
virus polymerase resides in the PA subunit. Nature 458:914-918.
77. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.
Innate antiviral responses by means of TLR7-mediated recognition of single-
stranded RNA. Science 303:1529-1531.
78. Doherty, P. C., D. J. Topham, and R. A. Tripp. 1996. Establishment and
persistence of virus-specific CD4+ and CD8+ T cell memory. Immunol Rev
150:23-44.
79. Domachowske, J. B., H. Pankow-Culot, M. Bautista, Y. Feng, C. Claeys, M.
Peeters, B. L. Innis, and V. Jain. 2013. A Randomized Trial of Candidate
Inactivated Quadrivalent Influenza Vaccine versus Trivalent Influenza Vaccines
in Children Aged 3-17 Years. J Infect Dis 207:1878-1887.
80. Donelan, N. R., C. F. Basler, and A. Garcia-Sastre. 2003. A recombinant
influenza A virus expressing an RNA-binding-defective NS1 protein induces high
levels of beta interferon and is attenuated in mice. J Virol 77:13257-13266.
65
81. Donnelly, R. P., F. Sheikh, S. V. Kotenko, and H. Dickensheets. 2004. The
expanded family of class II cytokines that share the IL-10 receptor-2 (IL-10R2)
chain. J Leukoc Biol 76:314-321.
82. Donovan, M. J., V. Tripathi, M. A. Favila, N. S. Geraci, M. C. Lange, W.
Ballhorn, and M. A. McDowell. 2012. Indoleamine 2,3-dioxygenase (IDO)
induced by Leishmania infection of human dendritic cells. Parasite Immunol
34:464-472.
83. Dowdle, W. R., J. C. Downie, and W. G. Laver. 1974. Inhibition of virus
release by antibodies to surface antigens of influenza viruses. J Virol 13:269-275.
84. Drake, J. W. 1993. Rates of spontaneous mutation among RNA viruses. Proc
Natl Acad Sci U S A 90:4171-4175.
85. Ducatez, M. F., C. M. Olinger, A. A. Owoade, Z. Tarnagda, M. C. Tahita, A.
Sow, S. De Landtsheer, W. Ammerlaan, J. B. Ouedraogo, A. D. Osterhaus, R.
A. Fouchier, and C. P. Muller. 2007. Molecular and antigenic evolution and
geographical spread of H5N1 highly pathogenic avian influenza viruses in
western Africa. J Gen Virol 88:2297-2306.
86. Dudani, R., M. Russell, H. van Faassen, L. Krishnan, and S. Sad. 2008.
Mutation in the Fas pathway impairs CD8+ T cell memory. J Immunol 180:2933-
2941.
87. Dunham, R. M., S. N. Gordon, M. Vaccari, M. Piatak, Y. Huang, S. G.
Deeks, J. Lifson, G. Franchini, and J. M. McCune. 2013. Preclinical evaluation
of HIV eradication strategies in the simian immunodeficiency virus-infected
66
rhesus macaque: a pilot study testing inhibition of indoleamine 2,3-dioxygenase.
AIDS Res Hum Retroviruses 29:207-214.
88. Ebrahimi, S. M., and M. Tebianian. 2011. Influenza A viruses: why focusing
on M2e-based universal vaccines. Virus Genes 42:1-8.
89. Eichelberger, M., W. Allan, M. Zijlstra, R. Jaenisch, and P. C. Doherty.
1991. Clearance of influenza virus respiratory infection in mice lacking class I
major histocompatibility complex-restricted CD8+ T cells. J Exp Med 174:875-
880.
90. Eleftheriadis, T., V. Liakopoulos, G. Antoniadi, I. Stefanidis, and G.
Galaktidou. 2011. Indoleamine 2,3-dioxygenase is increased in hemodialysis
patients and affects immune response to hepatitis B vaccination. Vaccine
29:2242-2247.
91. Eleftheriadis, T., T. Sparopoulou, G. Antoniadi, V. Liakopoulos, I.
Stefanidis, and G. Galaktidou. 2011. Suppression of humoral immune response
to hepatitis B surface antigen vaccine in BALB/c mice by 1-methyl-tryptophan
co-administration. Daru : journal of Faculty of Pharmacy, Tehran University of
Medical Sciences 19:236-239.
92. Elton, D., M. Simpson-Holley, K. Archer, L. Medcalf, R. Hallam, J.
McCauley, and P. Digard. 2001. Interaction of the influenza virus nucleoprotein
with the cellular CRM1-mediated nuclear export pathway. J Virol 75:408-419.
93. Fallarino, F., U. Grohmann, and P. Puccetti. 2012. Indoleamine 2,3-
dioxygenase: from catalyst to signaling function. Eur J Immunol 42:1932-1937.
67
94. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.
C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.
Cell Death Differ 9:1069-1077.
95. Fallarino, F., U. Grohmann, C. Vacca, C. Orabona, A. Spreca, M. C. Fioretti,
and P. Puccetti. 2003. T cell apoptosis by kynurenines. Adv Exp Med Biol
527:183-190.
96. Fallarino, F., U. Grohmann, S. You, B. C. McGrath, D. R. Cavener, C.
Vacca, C. Orabona, R. Bianchi, M. L. Belladonna, C. Volpi, P. Santamaria,
M. C. Fioretti, and P. Puccetti. 2006. The combined effects of tryptophan
starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and
induce a regulatory phenotype in naive T cells. J Immunol 176:6752-6761.
97. Fallarino, F., C. Orabona, C. Vacca, R. Bianchi, S. Gizzi, C. Asselin-Paturel,
M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti. 2005. Ligand and
cytokine dependence of the immunosuppressive pathway of tryptophan
catabolism in plasmacytoid dendritic cells. Int Immunol 17:1429-1438.
98. Favre, D., J. Mold, P. W. Hunt, B. Kanwar, P. Loke, L. Seu, J. D. Barbour,
M. M. Lowe, A. Jayawardene, F. Aweeka, Y. Huang, D. C. Douek, J. M.
Brenchley, J. N. Martin, F. M. Hecht, S. G. Deeks, and J. M. McCune. 2010.
Tryptophan catabolism by indoleamine 2,3-dioxygenase 1 alters the balance of
TH17 to regulatory T cells in HIV disease. Sci Transl Med 2:32ra36.
99. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park,
T. Yuen, S. C. Sealfon, A. Garcia-Sastre, and T. M. Moran. 2006. Influenza
68
virus evades innate and adaptive immunity via the NS1 protein. J Virol 80:6295-
6304.
100. Fiers, W., M. De Filette, K. El Bakkouri, B. Schepens, K. Roose, M.
Schotsaert, A. Birkett, and X. Saelens. 2009. M2e-based universal influenza A
vaccine. Vaccine 27:6280-6283.
101. Fiore, A. E., C. B. Bridges, and N. J. Cox. 2009. Seasonal influenza vaccines.
Curr Top Microbiol Immunol 333:43-82.
102. Fiore, A. E., T. M. Uyeki, K. Broder, L. Finelli, G. L. Euler, J. A. Singleton,
J. K. Iskander, P. M. Wortley, D. K. Shay, J. S. Bresee, and N. J. Cox. 2010.
Prevention and control of influenza with vaccines: recommendations of the
Advisory Committee on Immunization Practices (ACIP), 2010. MMWR Recomm
Rep 59:1-62.
103. Fox, J. M., L. K. Sage, L. Huang, J. Barber, K. D. Klonowski, A. L. Mellor,
M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2, 3-
dioxygenase (IDO) enhances the T cell response to influenza virus infection. J
Gen Virol.
104. Franca, M., D. E. Stallknecht, and E. W. Howerth. 2013. Expression and
distribution of sialic acid influenza virus receptors in wild birds. Avian pathology
: journal of the W.V.P.A 42:60-71.
105. Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and G. B.
Ferrara. 2002. Tryptophan-derived catabolites are responsible for inhibition of T
and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J
Exp Med 196:459-468.
69
106. Fujigaki, S., M. Takemura, H. Hamakawa, M. Seishima, and K. Saito. 2003.
The mechanism of interferon-gamma induced anti Toxoplasma gondii by
indoleamine 2,3-dioxygenase and/or inducible nitric oxide synthase vary among
tissues. Adv Exp Med Biol 527:97-103.
107. Fujimoto, M., M. Nakano, F. Terabe, H. Kawahata, T. Ohkawara, Y. Han, B.
Ripley, S. Serada, T. Nishikawa, A. Kimura, S. Nomura, T. Kishimoto, and
T. Naka. 2011. The influence of excessive IL-6 production in vivo on the
development and function of Foxp3+ regulatory T cells. J Immunol 186:32-40.
108. Fukunaga, M., Y. Yamamoto, M. Kawasoe, Y. Arioka, Y. Murakami, M.
Hoshi, and K. Saito. 2012. Studies on tissue and cellular distribution of
indoleamine 2,3-dioxygenase 2: the absence of IDO1 upregulates IDO2
expression in the epididymis. The journal of histochemistry and cytochemistry :
official journal of the Histochemistry Society 60:854-860.
109. Gabriel, G., A. Herwig, and H. D. Klenk. 2008. Interaction of polymerase
subunit PB2 and NP with importin alpha1 is a determinant of host range of
influenza A virus. PLoS Pathog 4:e11.
110. Gack, M. U., R. A. Albrecht, T. Urano, K. S. Inn, I. C. Huang, E. Carnero,
M. Farzan, S. Inoue, J. U. Jung, and A. Garcia-Sastre. 2009. Influenza A virus
NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral
RNA sensor RIG-I. Cell Host Microbe 5:439-449.
111. Gack, M. U., Y. C. Shin, C. H. Joo, T. Urano, C. Liang, L. Sun, O. Takeuchi,
S. Akira, Z. Chen, S. Inoue, and J. U. Jung. 2007. TRIM25 RING-finger E3
70
ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446:916-
920.
112. Galarza, J. M., Q. Peng, L. Shi, and D. F. Summers. 1996. Influenza A virus
RNA-dependent RNA polymerase: analysis of RNA synthesis in vitro. J Virol
70:2360-2368.
113. Gambotto, A., S. M. Barratt-Boyes, M. D. de Jong, G. Neumann, and Y.
Kawaoka. 2008. Human infection with highly pathogenic H5N1 influenza virus.
Lancet 371:1464-1475.
114. Gangneux, J. P., Y. Poinsignon, L. Donaghy, L. Amiot, K. Tarte, C. Mary,
and F. Robert-Gangneux. 2013. Indoleamine 2,3-dioxygenase activity as a
potential biomarker of immune suppression during visceral leishmaniasis. Innate
immunity.
115. Garten, R. J., C. T. Davis, C. A. Russell, B. Shu, S. Lindstrom, A. Balish, W.
M. Sessions, X. Xu, E. Skepner, V. Deyde, M. Okomo-Adhiambo, L.
Gubareva, J. Barnes, C. B. Smith, S. L. Emery, M. J. Hillman, P. Rivailler, J.
Smagala, M. de Graaf, D. F. Burke, R. A. Fouchier, C. Pappas, C. M.
Alpuche-Aranda, H. Lopez-Gatell, H. Olivera, I. Lopez, C. A. Myers, D.
Faix, P. J. Blair, C. Yu, K. M. Keene, P. D. Dotson, Jr., D. Boxrud, A. R.
Sambol, S. H. Abid, K. St George, T. Bannerman, A. L. Moore, D. J.
Stringer, P. Blevins, G. J. Demmler-Harrison, M. Ginsberg, P. Kriner, S.
Waterman, S. Smole, H. F. Guevara, E. A. Belongia, P. A. Clark, S. T.
Beatrice, R. Donis, J. Katz, L. Finelli, C. B. Bridges, M. Shaw, D. B.
Jernigan, T. M. Uyeki, D. J. Smith, A. I. Klimov, and N. J. Cox. 2009.
71
Antigenic and genetic characteristics of swine-origin 2009 A(H1N1) influenza
viruses circulating in humans. Science 325:197-201.
116. Ge, X., V. Tan, P. L. Bollyky, N. E. Standifer, E. A. James, and W. W. Kwok.
2010. Assessment of seasonal influenza A virus-specific CD4 T-cell responses to
2009 pandemic H1N1 swine-origin influenza A virus. J Virol 84:3312-3319.
117. Goldstein, L. E., M. C. Leopold, X. Huang, C. S. Atwood, A. J. Saunders, M.
Hartshorn, J. T. Lim, K. Y. Faget, J. A. Muffat, R. C. Scarpa, L. T. Chylack,
Jr., E. F. Bowden, R. E. Tanzi, and A. I. Bush. 2000. 3-Hydroxykynurenine and
3-hydroxyanthranilic acid generate hydrogen peroxide and promote alpha-
crystallin cross-linking by metal ion reduction. Biochemistry 39:7266-7275.
118. Gomez-Puertas, P., C. Albo, E. Perez-Pastrana, A. Vivo, and A. Portela.
2000. Influenza virus matrix protein is the major driving force in virus budding. J
Virol 74:11538-11547.
119. Goto, H., and Y. Kawaoka. 1998. A novel mechanism for the acquisition of
virulence by a human influenza A virus. Proc Natl Acad Sci U S A 95:10224-
10228.
120. Grienke, U., M. Schmidtke, S. von Grafenstein, J. Kirchmair, K. R. Liedl,
and J. M. Rollinger. 2012. Influenza neuraminidase: a druggable target for
natural products. Nat Prod Rep 29:11-36.
121. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni,
P. Candeloro, M. L. Belladonna, R. Bianchi, M. C. Fioretti, and P. Puccetti.
2002. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat Immunol 3:1097-
1101.
72
122. Guillemin, G. J., B. J. Brew, C. E. Noonan, O. Takikawa, and K. M. Cullen.
2005. Indoleamine 2,3 dioxygenase and quinolinic acid immunoreactivity in
Alzheimer's disease hippocampus. Neuropathology and applied neurobiology
31:395-404.
123. Guillemin, G. J., G. Smythe, O. Takikawa, and B. J. Brew. 2005. Expression
of indoleamine 2,3-dioxygenase and production of quinolinic acid by human
microglia, astrocytes, and neurons. Glia 49:15-23.
124. Guilligay, D., F. Tarendeau, P. Resa-Infante, R. Coloma, T. Crepin, P. Sehr,
J. Lewis, R. W. Ruigrok, J. Ortin, D. J. Hart, and S. Cusack. 2008. The
structural basis for cap binding by influenza virus polymerase subunit PB2.
Nature structural & molecular biology 15:500-506.
125. Guillonneau, C., J. D. Mintern, F. X. Hubert, A. C. Hurt, G. S. Besra, S.
Porcelli, I. G. Barr, P. C. Doherty, D. I. Godfrey, and S. J. Turner. 2009.
Combined NKT cell activation and influenza virus vaccination boosts memory
CTL generation and protective immunity. Proc Natl Acad Sci U S A 106:3330-
3335.
126. Gupta, R. K., R. George, and J. S. Nguyen-Van-Tam. 2008. Bacterial
pneumonia and pandemic influenza planning. Emerg Infect Dis 14:1187-1192.
127. Gupta, S. L., J. M. Carlin, P. Pyati, W. Dai, E. R. Pfefferkorn, and M. J.
Murphy, Jr. 1994. Antiparasitic and antiproliferative effects of indoleamine 2,3-
dioxygenase enzyme expression in human fibroblasts. Infect Immun 62:2277-
2284.
73
128. Hage, C. A., D. J. Horan, M. Durkin, P. Connolly, Z. Desta, T. C. Skaar, K.
S. Knox, and L. J. Wheat. 2013. Histoplasma capsulatum preferentially induces
IDO in the lung. Medical mycology : official publication of the International
Society for Human and Animal Mycology 51:270-279.
129. Hale, B. G., R. A. Albrecht, and A. Garcia-Sastre. 2010. Innate immune
evasion strategies of influenza viruses. Future Microbiol 5:23-41.
130. Hale, B. G., D. Jackson, Y. H. Chen, R. A. Lamb, and R. E. Randall. 2006.
Influenza A virus NS1 protein binds p85beta and activates phosphatidylinositol-3-
kinase signaling. Proc Natl Acad Sci U S A 103:14194-14199.
131. Hale, B. G., R. E. Randall, J. Ortin, and D. Jackson. 2008. The multifunctional
NS1 protein of influenza A viruses. J Gen Virol 89:2359-2376.
132. Hamada, H., E. Bassity, A. Flies, T. M. Strutt, L. Garcia-Hernandez Mde, K.
K. McKinstry, T. Zou, S. L. Swain, and R. W. Dutton. 2013. Multiple
redundant effector mechanisms of CD8+ T cells protect against influenza
infection. J Immunol 190:296-306.
133. Hamming, O. J., H. H. Gad, S. Paludan, and R. Hartmann. 2010. Lambda
Interferons: New cytokines with Old Functions. Pharmaceuticals 3:795-809.
134. Harper, S. A., K. Fukuda, N. J. Cox, and C. B. Bridges. 2003. Using live,
attenuated influenza vaccine for prevention and control of influenza:
supplemental recommendations of the Advisory Committee on Immunization
Practices (ACIP). MMWR Recomm Rep 52:1-8.
74
135. Harris, A., G. Cardone, D. C. Winkler, J. B. Heymann, M. Brecher, J. M.
White, and A. C. Steven. 2006. Influenza virus pleiomorphy characterized by
cryoelectron tomography. Proc Natl Acad Sci U S A 103:19123-19127.
136. Hatta, M., and Y. Kawaoka. 2003. The NB protein of influenza B virus is not
necessary for virus replication in vitro. J Virol 77:6050-6054.
137. Hay, A. J., B. Lomniczi, A. R. Bellamy, and J. J. Skehel. 1977. Transcription
of the influenza virus genome. Virology 83:337-355.
138. Hayaishi, O., and R. Yoshida. 1978. Specific induction of pulmonary
indoleamine 2,3-dioxygenase by bacterial lipopolysaccharide. Ciba Foundation
symposium:199-203.
139. Hayashi, T., J. H. Mo, X. Gong, C. Rossetto, A. Jang, L. Beck, G. I. Elliott, I.
Kufareva, R. Abagyan, D. H. Broide, J. Lee, and E. Raz. 2007. 3-
Hydroxyanthranilic acid inhibits PDK1 activation and suppresses experimental
asthma by inducing T cell apoptosis. Proc Natl Acad Sci U S A 104:18619-
18624.
140. He, X. S., T. H. Holmes, C. Zhang, K. Mahmood, G. W. Kemble, D. B. Lewis,
C. L. Dekker, H. B. Greenberg, and A. M. Arvin. 2006. Cellular immune
responses in children and adults receiving inactivated or live attenuated influenza
vaccines. J Virol 80:11756-11766.
141. Heller, M. C., C. P. Drew, K. A. Jackson, S. Griffey, and J. L. Watson. 2010.
A potential role for indoleamine 2,3-dioxygenase (IDO) in Rhodococcus equi
infection. Vet Immunol Immunopathol 138:174-182.
75
142. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T.
Horiuchi, H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral
compounds activate immune cells via the TLR7 MyD88-dependent signaling
pathway. Nat Immunol 3:196-200.
143. Herrler, G., I. Durkop, H. Becht, and H. D. Klenk. 1988. The glycoprotein of
influenza C virus is the haemagglutinin, esterase and fusion factor. J Gen Virol 69
( Pt 4):839-846.
144. Hewitt, E. W. 2003. The MHC class I antigen presentation pathway: strategies
for viral immune evasion. Immunology 110:163-169.
145. Hirata, F., and O. Hayaishi. 1975. Studies on indoleamine 2,3-dioxygenase. I.
Superoxide anion as substrate. J Biol Chem 250:5960-5966.
146. Horvath, C. M. 2004. The Jak-STAT pathway stimulated by interferon alpha or
interferon beta. Science's STKE : signal transduction knowledge environment
2004:tr10.
147. Hoshi, M., K. Matsumoto, H. Ito, H. Ohtaki, Y. Arioka, Y. Osawa, Y.
Yamamoto, H. Matsunami, A. Hara, M. Seishima, and K. Saito. 2012. L-
tryptophan-kynurenine pathway metabolites regulate type I IFNs of acute viral
myocarditis in mice. J Immunol 188:3980-3987.
148. Hou, D. Y., A. J. Muller, M. D. Sharma, J. DuHadaway, T. Banerjee, M.
Johnson, A. L. Mellor, G. C. Prendergast, and D. H. Munn. 2007. Inhibition
of indoleamine 2,3-dioxygenase in dendritic cells by stereoisomers of 1-methyl-
tryptophan correlates with antitumor responses. Cancer Res 67:792-801.
76
149. Hrincius, E. R., R. Dierkes, D. Anhlan, V. Wixler, S. Ludwig, and C.
Ehrhardt. 2011. Phosphatidylinositol-3-kinase (PI3K) is activated by influenza
virus vRNA via the pathogen pattern receptor Rig-I to promote efficient type I
interferon production. Cell Microbiol 13:1907-1919.
150. Huang, S., J. Chen, Q. Chen, H. Wang, Y. Yao, J. Chen, and Z. Chen. 2013.
A second CRM1-dependent nuclear export signal in the influenza A virus NS2
protein contributes to the nuclear export of viral ribonucleoproteins. J Virol
87:767-778.
151. Huttunen, R., J. Syrjanen, J. Aittoniemi, S. S. Oja, A. Raitala, J. Laine, M.
Pertovaara, R. Vuento, H. Huhtala, and M. Hurme. 2010. High activity of
indoleamine 2,3 dioxygenase enzyme predicts disease severity and case fatality in
bacteremic patients. Shock 33:149-154.
152. Ichinohe, T., I. K. Pang, and A. Iwasaki. 2010. Influenza virus activates
inflammasomes via its intracellular M2 ion channel. Nat Immunol 11:404-410.
153. Ito, T., J. N. Couceiro, S. Kelm, L. G. Baum, S. Krauss, M. R. Castrucci, I.
Donatelli, H. Kida, J. C. Paulson, R. G. Webster, and Y. Kawaoka. 1998.
Molecular basis for the generation in pigs of influenza A viruses with pandemic
potential. J Virol 72:7367-7373.
154. Ivanov, II, B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J.
Lafaille, D. J. Cua, and D. R. Littman. 2006. The orphan nuclear receptor
RORgammat directs the differentiation program of proinflammatory IL-17+ T
helper cells. Cell 126:1121-1133.
77
155. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive
immune responses. Nat Immunol 5:987-995.
156. Iwatsuki-Horimoto, K., T. Horimoto, T. Noda, M. Kiso, J. Maeda, S.
Watanabe, Y. Muramoto, K. Fujii, and Y. Kawaoka. 2006. The cytoplasmic
tail of the influenza A virus M2 protein plays a role in viral assembly. J Virol
80:5233-5240.
157. Janssen, E. M., E. E. Lemmens, T. Wolfe, U. Christen, M. G. von Herrath,
and S. P. Schoenberger. 2003. CD4+ T cells are required for secondary
expansion and memory in CD8+ T lymphocytes. Nature 421:852-856.
158. Jegerlehner, A., N. Schmitz, T. Storni, and M. F. Bachmann. 2004. Influenza
A vaccine based on the extracellular domain of M2: weak protection mediated via
antibody-dependent NK cell activity. J Immunol 172:5598-5605.
159. Jewell, N. A., T. Cline, S. E. Mertz, S. V. Smirnov, E. Flano, C. Schindler, J.
L. Grieves, R. K. Durbin, S. V. Kotenko, and J. E. Durbin. 2010. Lambda
interferon is the predominant interferon induced by influenza A virus infection in
vivo. J Virol 84:11515-11522.
160. Jia, L., K. Schweikart, J. Tomaszewski, J. G. Page, P. E. Noker, S. A.
Buhrow, J. M. Reid, M. M. Ames, and D. H. Munn. 2008. Toxicology and
pharmacokinetics of 1-methyl-d-tryptophan: absence of toxicity due to saturating
absorption. Food Chem Toxicol 46:203-211.
161. Johnson, N. P., and J. Mueller. 2002. Updating the accounts: global mortality of
the 1918-1920 "Spanish" influenza pandemic. Bull Hist Med 76:105-115.
78
162. Joshi, N. S., W. Cui, A. Chandele, H. K. Lee, D. R. Urso, J. Hagman, L.
Gapin, and S. M. Kaech. 2007. Inflammation directs memory precursor and
short-lived effector CD8(+) T cell fates via the graded expression of T-bet
transcription factor. Immunity 27:281-295.
163. Julkunen, I., K. Melen, M. Nyqvist, J. Pirhonen, T. Sareneva, and S.
Matikainen. 2000. Inflammatory responses in influenza A virus infection.
Vaccine 19 Suppl 1:S32-37.
164. Julkunen, I., T. Sareneva, J. Pirhonen, T. Ronni, K. Melen, and S.
Matikainen. 2001. Molecular pathogenesis of influenza A virus infection and
virus-induced regulation of cytokine gene expression. Cytokine Growth Factor
Rev 12:171-180.
165. Kaech, S. M., and W. Cui. 2012. Transcriptional control of effector and memory
CD8+ T cell differentiation. Nat Rev Immunol 12:749-761.
166. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat
Immunol 7:131-137.
167. Kawaoka, Y., S. Krauss, and R. G. Webster. 1989. Avian-to-human
transmission of the PB1 gene of influenza A viruses in the 1957 and 1968
pandemics. J Virol 63:4603-4608.
168. Kawaoka, Y., and R. G. Webster. 1988. Sequence requirements for cleavage
activation of influenza virus hemagglutinin expressed in mammalian cells. Proc
Natl Acad Sci U S A 85:324-328.
169. Keawcharoen, J., J. van den Broek, A. Bouma, T. Tiensin, A. D. Osterhaus,
and H. Heesterbeek. 2011. Wild birds and increased transmission of highly
79
pathogenic avian influenza (H5N1) among poultry, Thailand. Emerg Infect Dis
17:1016-1022.
170. Kilbourne, E. D. 2006. Influenza pandemics of the 20th century. Emerg Infect
Dis 12:9-14.
171. Kim, H. R., Y. J. Lee, C. K. Park, J. K. Oem, O. S. Lee, H. M. Kang, J. G.
Choi, and Y. C. Bae. 2012. Highly pathogenic avian influenza (H5N1) outbreaks
in wild birds and poultry, South Korea. Emerg Infect Dis 18:480-483.
172. Kindt, T. J., R. A. Goldsby, B. A. Osborne, and J. Kuby. 2007. Kuby
immunology, 6th ed. W.H. Freeman, New York.
173. Knubel, C. P., F. F. Martinez, R. E. Fretes, C. Diaz Lujan, M. G. Theumer,
L. Cervi, and C. C. Motran. 2010. Indoleamine 2,3-dioxigenase (IDO) is critical
for host resistance against Trypanosoma cruzi. FASEB J 24:2689-2701.
174. Kobayashi, M., T. Toyoda, and A. Ishihama. 1996. Influenza virus PB1 protein
is the minimal and essential subunit of RNA polymerase. Arch Virol 141:525-
539.
175. Koopmans, M., B. Wilbrink, M. Conyn, G. Natrop, H. van der Nat, H.
Vennema, A. Meijer, J. van Steenbergen, R. Fouchier, A. Osterhaus, and A.
Bosman. 2004. Transmission of H7N7 avian influenza A virus to human beings
during a large outbreak in commercial poultry farms in the Netherlands. Lancet
363:587-593.
176. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen, N. K.
Shah, J. A. Langer, F. Sheikh, H. Dickensheets, and R. P. Donnelly. 2003.
80
IFN-lambdas mediate antiviral protection through a distinct class II cytokine
receptor complex. Nat Immunol 4:69-77.
177. Krumbholz, A., A. Philipps, H. Oehring, K. Schwarzer, A. Eitner, P.
Wutzler, and R. Zell. 2011. Current knowledge on PB1-F2 of influenza A
viruses. Med Microbiol Immunol 200:69-75.
178. La Gruta, N. L., W. T. Rothwell, T. Cukalac, N. G. Swan, S. A. Valkenburg,
K. Kedzierska, P. G. Thomas, P. C. Doherty, and S. J. Turner. 2010. Primary
CTL response magnitude in mice is determined by the extent of naive T cell
recruitment and subsequent clonal expansion. J Clin Invest 120:1885-1894.
179. Lafferty, E. I., S. T. Qureshi, and M. Schnare. 2010. The role of toll-like
receptors in acute and chronic lung inflammation. Journal of inflammation 7:57.
180. Lamb, R. A., and P. W. Choppin. 1983. The gene structure and replication of
influenza virus. Annu Rev Biochem 52:467-506.
181. Larrea, E., J. I. Riezu-Boj, L. Gil-Guerrero, N. Casares, R. Aldabe, P.
Sarobe, M. P. Civeira, J. L. Heeney, C. Rollier, B. Verstrepen, T. Wakita, F.
Borras-Cuesta, J. J. Lasarte, and J. Prieto. 2007. Upregulation of indoleamine
2,3-dioxygenase in hepatitis C virus infection. J Virol 81:3662-3666.
182. Larsson, M., E. M. Shankar, K. F. Che, A. Saeidi, R. Ellegard, M. Barathan,
V. Velu, and A. Kamarulzaman. 2013. Molecular signatures of T-cell inhibition
in HIV-1 infection. Retrovirology 10:31.
183. Latz, E. 2010. The inflammasomes: mechanisms of activation and function. Curr
Opin Immunol 22:28-33.
81
184. Le Goffic, R., J. Pothlichet, D. Vitour, T. Fujita, E. Meurs, M. Chignard, and
M. Si-Tahar. 2007. Cutting Edge: Influenza A virus activates TLR3-dependent
inflammatory and RIG-I-dependent antiviral responses in human lung epithelial
cells. J Immunol 178:3368-3372.
185. Lee, B. O., J. Moyron-Quiroz, J. Rangel-Moreno, K. L. Kusser, L. Hartson,
F. Sprague, F. E. Lund, and T. D. Randall. 2003. CD40, but not CD154,
expression on B cells is necessary for optimal primary B cell responses. J
Immunol 171:5707-5717.
186. Lee, G. K., H. J. Park, M. Macleod, P. Chandler, D. H. Munn, and A. L.
Mellor. 2002. Tryptophan deprivation sensitizes activated T cells to apoptosis
prior to cell division. Immunology 107:452-460.
187. Lefrancois, L., and J. J. Obar. 2010. Once a killer, always a killer: from
cytotoxic T cell to memory cell. Immunol Rev 235:206-218.
188. Liu, X., N. Shin, H. K. Koblish, G. Yang, Q. Wang, K. Wang, L. Leffet, M. J.
Hansbury, B. Thomas, M. Rupar, P. Waeltz, K. J. Bowman, P. Polam, R. B.
Sparks, E. W. Yue, Y. Li, R. Wynn, J. S. Fridman, T. C. Burn, A. P. Combs,
R. C. Newton, and P. A. Scherle. 2010. Selective inhibition of IDO1 effectively
regulates mediators of antitumor immunity. Blood 115:3520-3530.
189. Londhe, V., N. McNamara, H. Lemjabbar, and C. Basbaum. 2003. Viral
dsRNA activates mucin transcription in airway epithelial cells. FEBS letters
553:33-38.
190. Londrigan, S. L., S. G. Turville, M. D. Tate, Y. M. Deng, A. G. Brooks, and
P. C. Reading. 2011. N-linked glycosylation facilitates sialic acid-independent
82
attachment and entry of influenza A viruses into cells expressing DC-SIGN or L-
SIGN. J Virol 85:2990-3000.
191. Loo, Y. M., J. Fornek, N. Crochet, G. Bajwa, O. Perwitasari, L. Martinez-
Sobrido, S. Akira, M. A. Gill, A. Garcia-Sastre, M. G. Katze, and M. Gale,
Jr. 2008. Distinct RIG-I and MDA5 signaling by RNA viruses in innate
immunity. J Virol 82:335-345.
192. Loughman, J. A., and D. A. Hunstad. 2012. Induction of indoleamine 2,3-
dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial
infection. J Infect Dis 205:1830-1839.
193. Louria, D. B., H. L. Blumenfeld, J. T. Ellis, E. D. Kilbourne, and D. E.
Rogers. 1959. Studies on influenza in the pandemic of 1957-1958. II. Pulmonary
complications of influenza. J Clin Invest 38:213-265.
194. MA, O. C., and W. R. Green. 2013. The role of indoleamine 2,3-dioxygenase in
LP-BPM5 murine retroviral disease progression. Virol J 10:154.
195. Makala, L. H. 2012. The Role of Indoleamine 2, 3 Dioxygenase in Regulating
Host Immunity to Leishmania Infection. J Biomed Sci 19:5.
196. Makala, L. H., B. Baban, H. Lemos, A. R. El-Awady, P. R. Chandler, D. Y.
Hou, D. H. Munn, and A. L. Mellor. 2011. Leishmania major attenuates host
immunity by stimulating local indoleamine 2,3-dioxygenase expression. J Infect
Dis 203:715-725.
197. Mallia, P., and S. L. Johnston. 2007. Influenza infection and COPD.
International journal of chronic obstructive pulmonary disease 2:55-64.
83
198. Manicassamy, B., R. A. Medina, R. Hai, T. Tsibane, S. Stertz, E. Nistal-
Villan, P. Palese, C. F. Basler, and A. Garcia-Sastre. 2010. Protection of mice
against lethal challenge with 2009 H1N1 influenza A virus by 1918-like and
classical swine H1N1 based vaccines. PLoS Pathog 6:e1000745.
199. Mao, R., J. Zhang, D. Jiang, D. Cai, J. M. Levy, A. Cuconati, T. M. Block, J.
T. Guo, and H. Guo. 2011. Indoleamine 2,3-dioxygenase mediates the antiviral
effect of gamma interferon against hepatitis B virus in human hepatocyte-derived
cells. J Virol 85:1048-1057.
200. Marshall, N. B., and S. L. Swain. 2011. Cytotoxic CD4 T cells in antiviral
immunity. J Biomed Biotechnol 2011:954602.
201. Martin, K., and A. Helenius. 1991. Nuclear transport of influenza virus
ribonucleoproteins: the viral matrix protein (M1) promotes export and inhibits
import. Cell 67:117-130.
202. Masopust, D., V. Vezys, E. J. Usherwood, L. S. Cauley, S. Olson, A. L.
Marzo, R. L. Ward, D. L. Woodland, and L. Lefrancois. 2004. Activated
primary and memory CD8 T cells migrate to nonlymphoid tissues regardless of
site of activation or tissue of origin. J Immunol 172:4875-4882.
203. Matheu, M. P., J. R. Teijaro, K. B. Walsh, M. L. Greenberg, D. Marsolais, I.
Parker, H. Rosen, M. B. Oldstone, and M. D. Cahalan. 2013. Three phases of
CD8 T cell response in the lung following H1N1 influenza infection and
sphingosine 1 phosphate agonist therapy. PLoS One 8:e58033.
84
204. Matrosovich, M. N., T. Y. Matrosovich, T. Gray, N. A. Roberts, and H. D.
Klenk. 2004. Human and avian influenza viruses target different cell types in
cultures of human airway epithelium. Proc Natl Acad Sci U S A 101:4620-4624.
205. Matrosovich, M. N., T. Y. Matrosovich, T. Gray, N. A. Roberts, and H. D.
Klenk. 2004. Neuraminidase is important for the initiation of influenza virus
infection in human airway epithelium. J Virol 78:12665-12667.
206. Matta, B. M., A. Castellaneta, and A. W. Thomson. 2010. Tolerogenic
plasmacytoid DC. Eur J Immunol 40:2667-2676.
207. McAuley, J. L., F. Hornung, K. L. Boyd, A. M. Smith, R. McKeon, J.
Bennink, J. W. Yewdell, and J. A. McCullers. 2007. Expression of the 1918
influenza A virus PB1-F2 enhances the pathogenesis of viral and secondary
bacterial pneumonia. Cell Host Microbe 2:240-249.
208. McCown, M. F., and A. Pekosz. 2006. Distinct domains of the influenza a virus
M2 protein cytoplasmic tail mediate binding to the M1 protein and facilitate
infectious virus production. J Virol 80:8178-8189.
209. McGill, J., J. W. Heusel, and K. L. Legge. 2009. Innate immune control and
regulation of influenza virus infections. J Leukoc Biol 86:803-812.
210. McGill, J., N. Van Rooijen, and K. L. Legge. 2008. Protective influenza-
specific CD8 T cell responses require interactions with dendritic cells in the
lungs. J Exp Med 205:1635-1646.
211. Mehra, S., X. Alvarez, P. J. Didier, L. A. Doyle, J. L. Blanchard, A. A.
Lackner, and D. Kaushal. 2013. Granuloma correlates of protection against
85
tuberculosis and mechanisms of immune modulation by Mycobacterium
tuberculosis. J Infect Dis 207:1115-1127.
212. Meininger, D., L. Zalameda, Y. Liu, L. P. Stepan, L. Borges, J. D. McCarter,
and C. L. Sutherland. 2011. Purification and kinetic characterization of human
indoleamine 2,3-dioxygenases 1 and 2 (IDO1 and IDO2) and discovery of
selective IDO1 inhibitors. Biochim Biophys Acta 1814:1947-1954.
213. Mendel, D. B., C. Y. Tai, P. A. Escarpe, W. Li, R. W. Sidwell, J. H. Huffman,
C. Sweet, K. J. Jakeman, J. Merson, S. A. Lacy, W. Lew, M. A. Williams, L.
Zhang, M. S. Chen, N. Bischofberger, and C. U. Kim. 1998. Oral
administration of a prodrug of the influenza virus neuraminidase inhibitor GS
4071 protects mice and ferrets against influenza infection. Antimicrob Agents
Chemother 42:640-646.
214. Metz, R., J. B. Duhadaway, U. Kamasani, L. Laury-Kleintop, A. J. Muller,
and G. C. Prendergast. 2007. Novel tryptophan catabolic enzyme IDO2 is the
preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase
inhibitory compound D-1-methyl-tryptophan. Cancer Res 67:7082-7087.
215. Mezrich, J. D., J. H. Fechner, X. Zhang, B. P. Johnson, W. J. Burlingham,
and C. A. Bradfield. 2010. An interaction between kynurenine and the aryl
hydrocarbon receptor can generate regulatory T cells. J Immunol 185:3190-3198.
216. Min, J. Y., and R. M. Krug. 2006. The primary function of RNA binding by the
influenza A virus NS1 protein in infected cells: Inhibiting the 2'-5' oligo (A)
synthetase/RNase L pathway. Proc Natl Acad Sci U S A 103:7100-7105.
86
217. Mordstein, M., G. Kochs, L. Dumoutier, J. C. Renauld, S. R. Paludan, K.
Klucher, and P. Staeheli. 2008. Interferon-lambda contributes to innate
immunity of mice against influenza A virus but not against hepatotropic viruses.
PLoS Pathog 4:e1000151.
218. Morens, D. M., J. K. Taubenberger, and A. S. Fauci. 2008. Predominant role
of bacterial pneumonia as a cause of death in pandemic influenza: implications for
pandemic influenza preparedness. J Infect Dis 198:962-970.
219. Morita, T., K. Saito, M. Takemura, N. Maekawa, S. Fujigaki, H. Fujii, H.
Wada, S. Takeuchi, A. Noma, and M. Seishima. 2001. 3-Hydroxyanthranilic
acid, an L-tryptophan metabolite, induces apoptosis in monocyte-derived cells
stimulated by interferon-gamma. Annals of clinical biochemistry 38:242-251.
220. Moroni, F., P. Russi, G. Lombardi, M. Beni, and V. Carla. 1988. Presence of
kynurenic acid in the mammalian brain. J Neurochem 51:177-180.
221. Mould, J. A., R. G. Paterson, M. Takeda, Y. Ohigashi, P. Venkataraman, R.
A. Lamb, and L. H. Pinto. 2003. Influenza B virus BM2 protein has ion channel
activity that conducts protons across membranes. Developmental cell 5:175-184.
222. Mount, A. M., and G. T. Belz. 2010. Mouse models of viral infection: influenza
infection in the lung. Methods Mol Biol 595:299-318.
223. Mozdzanowska, K., M. Furchner, K. Maiese, and W. Gerhard. 1997. CD4+ T
cells are ineffective in clearing a pulmonary infection with influenza type A virus
in the absence of B cells. Virology 239:217-225.
87
224. Munn, D. H., E. Shafizadeh, J. T. Attwood, I. Bondarev, A. Pashine, and A.
L. Mellor. 1999. Inhibition of T cell proliferation by macrophage tryptophan
catabolism. J Exp Med 189:1363-1372.
225. Munn, D. H., M. D. Sharma, B. Baban, H. P. Harding, Y. Zhang, D. Ron, and
A. L. Mellor. 2005. GCN2 kinase in T cells mediates proliferative arrest and
anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 22:633-
642.
226. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B.
Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal
rejection by tryptophan catabolism. Science 281:1191-1193.
227. Murakami, Y., M. Hoshi, A. Hara, M. Takemura, Y. Arioka, Y. Yamamoto,
H. Matsunami, T. Funato, M. Seishima, and K. Saito. 2012. Inhibition of
increased indoleamine 2,3-dioxygenase activity attenuates Toxoplasma gondii
replication in the lung during acute infection. Cytokine 59:245-251.
228. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. Sourdive, A. J. Zajac, J.
D. Miller, J. Slansky, and R. Ahmed. 1998. Counting antigen-specific CD8 T
cells: a reevaluation of bystander activation during viral infection. Immunity
8:177-187.
229. Nakagawa, Y., K. Oda, and S. Nakada. 1996. The PB1 subunit alone can
catalyze cRNA synthesis, and the PA subunit in addition to the PB1 subunit is
required for viral RNA synthesis in replication of the influenza virus genome. J
Virol 70:6390-6394.
88
230. Nayak, D. P., R. A. Balogun, H. Yamada, Z. H. Zhou, and S. Barman. 2009.
Influenza virus morphogenesis and budding. Virus Res 143:147-161.
231. Neirynck, S., T. Deroo, X. Saelens, P. Vanlandschoot, W. M. Jou, and W.
Fiers. 1999. A universal influenza A vaccine based on the extracellular domain of
the M2 protein. Nat Med 5:1157-1163.
232. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998.
Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF
and inhibits 3'end formation of cellular pre-mRNAs. Mol Cell 1:991-1000.
233. Newcomb, L. L., R. L. Kuo, Q. Ye, Y. Jiang, Y. J. Tao, and R. M. Krug. 2009.
Interaction of the influenza a virus nucleocapsid protein with the viral RNA
polymerase potentiates unprimed viral RNA replication. J Virol 83:29-36.
234. Nguyen, H. T., A. M. Fry, and L. V. Gubareva. 2012. Neuraminidase inhibitor
resistance in influenza viruses and laboratory testing methods. Antiviral therapy
17:159-173.
235. Nilsson, L. K., K. R. Linderholm, G. Engberg, L. Paulson, K. Blennow, L. H.
Lindstrom, C. Nordin, A. Karanti, P. Persson, and S. Erhardt. 2005. Elevated
levels of kynurenic acid in the cerebrospinal fluid of male patients with
schizophrenia. Schizophrenia research 80:315-322.
236. O'Neill, R. E., R. Jaskunas, G. Blobel, P. Palese, and J. Moroianu. 1995.
Nuclear import of influenza virus RNA can be mediated by viral nucleoprotein
and transport factors required for protein import. J Biol Chem 270:22701-22704.
89
237. O'Neill, R. E., J. Talon, and P. Palese. 1998. The influenza virus NEP (NS2
protein) mediates the nuclear export of viral ribonucleoproteins. EMBO J 17:288-
296.
238. O’Connell, P. M. 2013. FDA approves new quadrivalent influenza vaccine. AAP
News.
239. Obar, J. J., and L. Lefrancois. 2010. Early signals during CD8 T cell priming
regulate the generation of central memory cells. J Immunol 185:263-272.
240. Onoguchi, K., M. Yoneyama, A. Takemura, S. Akira, T. Taniguchi, H.
Namiki, and T. Fujita. 2007. Viral infections activate types I and III interferon
genes through a common mechanism. J Biol Chem 282:7576-7581.
241. Orabona, C., M. L. Belladonna, C. Vacca, R. Bianchi, F. Fallarino, C. Volpi,
S. Gizzi, M. C. Fioretti, U. Grohmann, and P. Puccetti. 2005. Cutting edge:
silencing suppressor of cytokine signaling 3 expression in dendritic cells turns
CD28-Ig from immune adjuvant to suppressant. J Immunol 174:6582-6586.
242. Orabona, C., M. T. Pallotta, C. Volpi, F. Fallarino, C. Vacca, R. Bianchi, M.
L. Belladonna, M. C. Fioretti, U. Grohmann, and P. Puccetti. 2008. SOCS3
drives proteasomal degradation of indoleamine 2,3-dioxygenase (IDO) and
antagonizes IDO-dependent tolerogenesis. Proc Natl Acad Sci U S A 105:20828-
20833.
243. Oshansky, C. M., J. A. Pickens, K. C. Bradley, L. P. Jones, G. M. Saavedra-
Ebner, J. P. Barber, J. M. Crabtree, D. A. Steinhauer, S. M. Tompkins, and
R. A. Tripp. 2011. Avian influenza viruses infect primary human bronchial
90
epithelial cells unconstrained by sialic acid alpha2,3 residues. PLoS One
6:e21183.
244. Palese, P., and R. W. Compans. 1976. Inhibition of influenza virus replication in
tissue culture by 2-deoxy-2,3-dehydro-N-trifluoroacetylneuraminic acid (FANA):
mechanism of action. J Gen Virol 33:159-163.
245. Palese, P., and M. L. Shaw. 2007. Orthomyxoviridae: The Viruses and Their
Replication, p. 1647-1689. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.),
Fields' virology, 5th ed, vol. 2. Wolters Kluwer Health/Lippincott Williams &
Wilkins, Philadelphia.
246. Paterson, D., and E. Fodor. 2012. Emerging roles for the influenza A virus
nuclear export protein (NEP). PLoS Pathog 8:e1003019.
247. Pellegrini, M., G. Belz, P. Bouillet, and A. Strasser. 2003. Shutdown of an
acute T cell immune response to viral infection is mediated by the proapoptotic
Bcl-2 homology 3-only protein Bim. Proc Natl Acad Sci U S A 100:14175-
14180.
248. Pello, S. J., and G. H. Olsen. 2013. Emerging and reemerging diseases of avian
wildlife. The veterinary clinics of North America. Exotic animal practice 16:357-
381.
249. Perez, J. T., A. Varble, R. Sachidanandam, I. Zlatev, M. Manoharan, A.
Garcia-Sastre, and B. R. tenOever. 2010. Influenza A virus-generated small
RNAs regulate the switch from transcription to replication. Proc Natl Acad Sci U
S A 107:11525-11530.
91
250. Pfefferkorn, E. R., M. Eckel, and S. Rebhun. 1986. Interferon-gamma
suppresses the growth of Toxoplasma gondii in human fibroblasts through
starvation for tryptophan. Mol Biochem Parasitol 20:215-224.
251. Pinto, L. H., L. J. Holsinger, and R. A. Lamb. 1992. Influenza virus M2 protein
has ion channel activity. Cell 69:517-528.
252. Platten, M., P. P. Ho, S. Youssef, P. Fontoura, H. Garren, E. M. Hur, R.
Gupta, L. Y. Lee, B. A. Kidd, W. H. Robinson, R. A. Sobel, M. L. Selley, and
L. Steinman. 2005. Treatment of autoimmune neuroinflammation with a
synthetic tryptophan metabolite. Science 310:850-855.
253. Plotch, S. J., M. Bouloy, I. Ulmanen, and R. M. Krug. 1981. A unique
cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs
to generate the primers that initiate viral RNA transcription. Cell 23:847-858.
254. Popov, A., and J. L. Schultze. 2008. IDO-expressing regulatory dendritic cells in
cancer and chronic infection. J Mol Med 86:145-160.
255. Portela, A., and P. Digard. 2002. The influenza virus nucleoprotein: a
multifunctional RNA-binding protein pivotal to virus replication. J Gen Virol
83:723-734.
256. Potter, C. W. 2001. A history of influenza. J Appl Microbiol 91:572-579.
257. Potula, R., L. Poluektova, B. Knipe, J. Chrastil, D. Heilman, H. Dou, O.
Takikawa, D. H. Munn, H. E. Gendelman, and Y. Persidsky. 2005. Inhibition
of indoleamine 2,3-dioxygenase (IDO) enhances elimination of virus-infected
macrophages in an animal model of HIV-1 encephalitis. Blood 106:2382-2390.
92
258. Rehwinkel, J., C. P. Tan, D. Goubau, O. Schulz, A. Pichlmair, K. Bier, N.
Robb, F. Vreede, W. Barclay, E. Fodor, and C. Reis e Sousa. 2010. RIG-I
detects viral genomic RNA during negative-strand RNA virus infection. Cell
140:397-408.
259. Riberdy, J. M., J. P. Christensen, K. Branum, and P. C. Doherty. 2000.
Diminished primary and secondary influenza virus-specific CD8(+) T-cell
responses in CD4-depleted Ig(-/-) mice. J Virol 74:9762-9765.
260. Robb, N. C., M. Smith, F. T. Vreede, and E. Fodor. 2009. NS2/NEP protein
regulates transcription and replication of the influenza virus RNA genome. J Gen
Virol 90:1398-1407.
261. Robinson, J. H., and A. A. Delvig. 2002. Diversity in MHC class II antigen
presentation. Immunology 105:252-262.
262. Rogers, G. N., and J. C. Paulson. 1983. Receptor determinants of human and
animal influenza virus isolates: differences in receptor specificity of the H3
hemagglutinin based on species of origin. Virology 127:361-373.
263. Roman, E., E. Miller, A. Harmsen, J. Wiley, U. H. Von Andrian, G. Huston,
and S. L. Swain. 2002. CD4 effector T cell subsets in the response to influenza:
heterogeneity, migration, and function. J Exp Med 196:957-968.
264. Rossman, J. S., and R. A. Lamb. 2011. Influenza virus assembly and budding.
Virology 411:229-236.
265. Ruigrok, R. W., T. Crepin, and D. Kolakofsky. 2011. Nucleoproteins and
nucleocapsids of negative-strand RNA viruses. Curr Opin Microbiol 14:504-510.
93
266. Rust, M. J., M. Lakadamyali, F. Zhang, and X. Zhuang. 2004. Assembly of
endocytic machinery around individual influenza viruses during viral entry.
Nature structural & molecular biology 11:567-573.
267. Sanberg, P. R., S. F. Calderon, M. Giordano, J. M. Tew, and A. B. Norman.
1989. The quinolinic acid model of Huntington's disease: locomotor
abnormalities. Exp Neurol 105:45-53.
268. Sanders, C. J., P. C. Doherty, and P. G. Thomas. 2010. Respiratory epithelial
cells in innate immunity to influenza virus infection. Cell Tissue Res.
269. Schmidt, S. K., S. Ebel, E. Keil, C. Woite, J. F. Ernst, A. E. Benzin, J. Rupp,
and W. Daubener. 2013. Regulation of IDO Activity by Oxygen Supply:
Inhibitory Effects on Antimicrobial and Immunoregulatory Functions. PLoS One
8:e63301.
270. Schmolke, M., and A. Garcia-Sastre. 2010. Evasion of innate and adaptive
immune responses by influenza A virus. Cell Microbiol 12:873-880.
271. Schmolke, M., B. Manicassamy, L. Pena, T. Sutton, R. Hai, Z. T. Varga, B.
G. Hale, J. Steel, D. R. Perez, and A. Garcia-Sastre. 2011. Differential
contribution of PB1-F2 to the virulence of highly pathogenic H5N1 influenza A
virus in mammalian and avian species. PLoS Pathog 7:e1002186.
272. Scholtissek, C., W. Rohde, V. Von Hoyningen, and R. Rott. 1978. On the
origin of the human influenza virus subtypes H2N2 and H3N2. Virology 87:13-
20.
273. Scott, P. 1993. IL-12: initiation cytokine for cell-mediated immunity. Science
260:496-497.
94
274. Seo, S. H., E. Hoffmann, and R. G. Webster. 2002. Lethal H5N1 influenza
viruses escape host anti-viral cytokine responses. Nat Med 8:950-954.
275. Sharma, M. D., B. Baban, P. Chandler, D. Y. Hou, N. Singh, H. Yagita, M.
Azuma, B. R. Blazar, A. L. Mellor, and D. H. Munn. 2007. Plasmacytoid
dendritic cells from mouse tumor-draining lymph nodes directly activate mature
Tregs via indoleamine 2,3-dioxygenase. J Clin Invest 117:2570-2582.
276. Sharma, M. D., D. Y. Hou, Y. Liu, P. A. Koni, R. Metz, P. Chandler, A. L.
Mellor, Y. He, and D. H. Munn. 2009. Indoleamine 2,3-dioxygenase controls
conversion of Foxp3+ Tregs to TH17-like cells in tumor-draining lymph nodes.
Blood 113:6102-6111.
277. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer, T. E.
Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, C. Ostrander,
D. Dong, J. Shin, S. Presnell, B. Fox, B. Haldeman, E. Cooper, D. Taft, T.
Gilbert, F. J. Grant, M. Tackett, W. Krivan, G. McKnight, C. Clegg, D.
Foster, and K. M. Klucher. 2003. IL-28, IL-29 and their class II cytokine
receptor IL-28R. Nat Immunol 4:63-68.
278. Shinya, K., M. Ebina, S. Yamada, M. Ono, N. Kasai, and Y. Kawaoka. 2006.
Avian flu: influenza virus receptors in the human airway. Nature 440:435-436.
279. Shinya, K., S. Hamm, M. Hatta, H. Ito, T. Ito, and Y. Kawaoka. 2004. PB2
amino acid at position 627 affects replicative efficiency, but not cell tropism, of
Hong Kong H5N1 influenza A viruses in mice. Virology 320:258-266.
95
280. Shirey, K. A., J. Y. Jung, G. S. Maeder, and J. M. Carlin. 2006. Upregulation
of IFN-gamma receptor expression by proinflammatory cytokines influences IDO
activation in epithelial cells. J Interferon Cytokine Res 26:53-62.
281. Shope, R. E. 1936. The Incidence of Neutralizing Antibodies for Swine Influenza
Virus in the Sera of Human Beings of Different Ages. J Exp Med 63:669-684.
282. Shope, R. E. 1931. Swine Influenza : I. Experimental Transmission and
Pathology. J Exp Med 54:349-359.
283. Shope, R. E. 1931. Swine Influenza : Iii. Filtration Experiments and Etiology. J
Exp Med 54:373-385.
284. Singh, N., A. Pandey, and S. K. Mittal. 2010. Avian influenza pandemic
preparedness: developing prepandemic and pandemic vaccines against a moving
target. Expert reviews in molecular medicine 12:e14.
285. Skehel, J. J., and D. C. Wiley. 2000. Receptor binding and membrane fusion in
virus entry: the influenza hemagglutinin. Annu Rev Biochem 69:531-569.
286. Smith-Garvin, J. E., G. A. Koretzky, and M. S. Jordan. 2009. T cell
activation. Annu Rev Immunol 27:591-619.
287. Smith, A. J., C. M. Toledo, S. W. Wietgrefe, L. Duan, T. W. Schacker, C. S.
Reilly, and A. T. Haase. 2011. The immunosuppressive role of IL-32 in
lymphatic tissue during HIV-1 infection. J Immunol 186:6576-6584.
288. Soliman, H., M. Mediavilla-Varela, and S. Antonia. 2010. Indoleamine 2,3-
dioxygenase: is it an immune suppressor? Cancer journal 16:354-359.
289. Spackman, E. 2008. A brief introduction to the avian influenza virus. Methods
Mol Biol 436:1-6.
96
290. Steel, J., A. C. Lowen, T. T. Wang, M. Yondola, Q. Gao, K. Haye, A. Garcia-
Sastre, and P. Palese. 2010. Influenza virus vaccine based on the conserved
hemagglutinin stalk domain. mBio 1.
291. Steinhauer, D. A., and J. J. Holland. 1987. Rapid evolution of RNA viruses.
Annu Rev Microbiol 41:409-433.
292. Steinhauer, D. A., and J. J. Skehel. 2002. Genetics of influenza viruses. Annu
Rev Genet 36:305-332.
293. Steinhauer, D. A., S. A. Wharton, J. J. Skehel, D. C. Wiley, and A. J. Hay.
1991. Amantadine selection of a mutant influenza virus containing an acid-stable
hemagglutinin glycoprotein: evidence for virus-specific regulation of the pH of
glycoprotein transport vesicles. Proc Natl Acad Sci U S A 88:11525-11529.
294. Stieneke-Grober, A., M. Vey, H. Angliker, E. Shaw, G. Thomas, C. Roberts,
H. D. Klenk, and W. Garten. 1992. Influenza virus hemagglutinin with
multibasic cleavage site is activated by furin, a subtilisin-like endoprotease.
EMBO J 11:2407-2414.
295. Stiver, G. 2003. The treatment of influenza with antiviral drugs. CMAJ :
Canadian Medical Association journal = journal de l'Association medicale
canadienne 168:49-56.
296. Suarez, D. L. 2008. Influenza A Virus, p. 4-5. In D. Swayne (ed.), Avian
Influenza. Blackwell Publishing, Ames, IA.
297. Subbarao, E. K., W. London, and B. R. Murphy. 1993. A single amino acid in
the PB2 gene of influenza A virus is a determinant of host range. J Virol 67:1761-
1764.
97
298. Subbarao, K., A. Klimov, J. Katz, H. Regnery, W. Lim, H. Hall, M. Perdue,
D. Swayne, C. Bender, J. Huang, M. Hemphill, T. Rowe, M. Shaw, X. Xu, K.
Fukuda, and N. Cox. 1998. Characterization of an avian influenza A (H5N1)
virus isolated from a child with a fatal respiratory illness. Science 279:393-396.
299. Suffia, I. J., S. K. Reckling, C. A. Piccirillo, R. S. Goldszmid, and Y. Belkaid.
2006. Infected site-restricted Foxp3+ natural regulatory T cells are specific for
microbial antigens. J Exp Med 203:777-788.
300. Sugimoto, H., S. Oda, T. Otsuki, T. Hino, T. Yoshida, and Y. Shiro. 2006.
Crystal structure of human indoleamine 2,3-dioxygenase: catalytic mechanism of
O2 incorporation by a heme-containing dioxygenase. Proc Natl Acad Sci U S A
103:2611-2616.
301. Suh, H. S., M. L. Zhao, M. Rivieccio, S. Choi, E. Connolly, Y. Zhao, O.
Takikawa, C. F. Brosnan, and S. C. Lee. 2007. Astrocyte indoleamine 2,3-
dioxygenase is induced by the TLR3 ligand poly(I:C): mechanism of induction
and role in antiviral response. J Virol 81:9838-9850.
302. Sun, J., R. Madan, C. L. Karp, and T. J. Braciale. 2009. Effector T cells
control lung inflammation during acute influenza virus infection by producing IL-
10. Nat Med 15:277-284.
303. Swain, S. L., K. K. McKinstry, and T. M. Strutt. 2012. Expanding roles for
CD4(+) T cells in immunity to viruses. Nat Rev Immunol 12:136-148.
304. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, and L. H.
Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage
commitment. Cell 100:655-669.
98
305. Takeda, K., and S. Akira. 2005. Toll-like receptors in innate immunity. Int
Immunol 17:1-14.
306. Takeuchi, O., and S. Akira. 2009. Cytoplasmic Pattern Receptors (RIG-I and
MDA-5) and Signaling in Viral Infections, p. p.29-38. In A. R. Brasier, A.
García-Sastre, and S. M. Lemon (ed.), Cellular signaling and innate immune
responses to RNA virus infections. ASM Press, Washington, D.C.
307. Tarendeau, F., J. Boudet, D. Guilligay, P. J. Mas, C. M. Bougault, S. Boulo,
F. Baudin, R. W. Ruigrok, N. Daigle, J. Ellenberg, S. Cusack, J. P. Simorre,
and D. J. Hart. 2007. Structure and nuclear import function of the C-terminal
domain of influenza virus polymerase PB2 subunit. Nature structural & molecular
biology 14:229-233.
308. Tattevin, P., D. Monnier, O. Tribut, J. Dulong, N. Bescher, F. Mourcin, F.
Uhel, Y. Le Tulzo, and K. Tarte. 2010. Enhanced indoleamine 2,3-dioxygenase
activity in patients with severe sepsis and septic shock. J Infect Dis 201:956-966.
309. Taubenberger, J. K., and D. M. Morens. 2006. 1918 Influenza: the mother of
all pandemics. Emerg Infect Dis 12:15-22.
310. Taubenberger, J. K., and D. M. Morens. 2010. Influenza: the once and future
pandemic. Public Health Rep 125 Suppl 3:16-26.
311. Taubenberger, J. K., and D. M. Morens. 2008. The pathology of influenza
virus infections. Annual review of pathology 3:499-522.
312. Taylor, M. W., and G. S. Feng. 1991. Relationship between interferon-gamma,
indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J 5:2516-2522.
99
313. Terentis, A. C., S. R. Thomas, O. Takikawa, T. K. Littlejohn, R. J. Truscott,
R. S. Armstrong, S. R. Yeh, and R. Stocker. 2002. The heme environment of
recombinant human indoleamine 2,3-dioxygenase. Structural properties and
substrate-ligand interactions. J Biol Chem 277:15788-15794.
314. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I
interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol
23:307-336.
315. Thomas, P. G., R. Keating, D. J. Hulse-Post, and P. C. Doherty. 2006. Cell-
mediated protection in influenza infection. Emerg Infect Dis 12:48-54.
316. Thomas, S. M., L. F. Garrity, C. R. Brandt, C. S. Schobert, G. S. Feng, M. W.
Taylor, J. M. Carlin, and G. I. Byrne. 1993. IFN-gamma-mediated
antimicrobial response. Indoleamine 2,3-dioxygenase-deficient mutant host cells
no longer inhibit intracellular Chlamydia spp. or Toxoplasma growth. J Immunol
150:5529-5534.
317. Tiley, L. S., M. Hagen, J. T. Matthews, and M. Krystal. 1994. Sequence-
specific binding of the influenza virus RNA polymerase to sequences located at
the 5' ends of the viral RNAs. J Virol 68:5108-5116.
318. Tong, S., Y. Li, P. Rivailler, C. Conrardy, D. A. Castillo, L. M. Chen, S.
Recuenco, J. A. Ellison, C. T. Davis, I. A. York, A. S. Turmelle, D. Moran, S.
Rogers, M. Shi, Y. Tao, M. R. Weil, K. Tang, L. A. Rowe, S. Sammons, X.
Xu, M. Frace, K. A. Lindblade, N. J. Cox, L. J. Anderson, C. E. Rupprecht,
and R. O. Donis. 2012. A distinct lineage of influenza A virus from bats. Proc
Natl Acad Sci U S A 109:4269-4274.
100
319. Topham, D. J., and P. C. Doherty. 1998. Clearance of an influenza A virus by
CD4+ T cells is inefficient in the absence of B cells. J Virol 72:882-885.
320. Topham, D. J., R. A. Tripp, and P. C. Doherty. 1997. CD8+ T cells clear
influenza virus by perforin or Fas-dependent processes. J Immunol 159:5197-
5200.
321. Trinchieri, G. 2010. Type I interferon: friend or foe? J Exp Med 207:2053-2063.
322. Tripp, R. A., S. Hou, and P. C. Doherty. 1995. Temporal loss of the activated
L-selectin-low phenotype for virus-specific CD8+ memory T cells. J Immunol
154:5870-5875.
323. Tumpey, T. M., C. F. Basler, P. V. Aguilar, H. Zeng, A. Solorzano, D. E.
Swayne, N. J. Cox, J. M. Katz, J. K. Taubenberger, P. Palese, and A. Garcia-
Sastre. 2005. Characterization of the reconstructed 1918 Spanish influenza
pandemic virus. Science 310:77-80.
324. Tumpey, T. M., T. R. Maines, N. Van Hoeven, L. Glaser, A. Solorzano, C.
Pappas, N. J. Cox, D. E. Swayne, P. Palese, J. M. Katz, and A. Garcia-Sastre.
2007. A two-amino acid change in the hemagglutinin of the 1918 influenza virus
abolishes transmission. Science 315:655-659.
325. Turner, D. L., K. L. Bickham, D. L. Farber, and L. Lefrancois. 2013. Splenic
priming of virus-specific CD8 T cells following influenza virus infection. J Virol
87:4496-4506.
326. Uze, G., and D. Monneron. 2007. IL-28 and IL-29: newcomers to the interferon
family. Biochimie 89:729-734.
101
327. Vaccari, M., A. Boasso, Z. M. Ma, V. Cecchinato, D. Venzon, M. N. Doster,
W. P. Tsai, G. M. Shearer, D. Fuchs, B. K. Felber, G. N. Pavlakis, C. J.
Miller, and G. Franchini. 2008. CD4+ T-cell loss and delayed expression of
modulators of immune responses at mucosal sites of vaccinated macaques
following SIV(mac251) infection. Mucosal immunology 1:497-507.
328. van der Vries, E., P. J. Collins, S. G. Vachieri, X. Xiong, J. Liu, P. A. Walker,
L. F. Haire, A. J. Hay, M. Schutten, A. D. Osterhaus, S. R. Martin, C. A.
Boucher, J. J. Skehel, and S. J. Gamblin. 2012. H1N1 2009 pandemic influenza
virus: resistance of the I223R neuraminidase mutant explained by kinetic and
structural analysis. PLoS Pathog 8:e1002914.
329. Van Epps, H. L. 2006. Influenza: exposing the true killer. J Exp Med 203:803.
330. van Riel, D., V. J. Munster, E. de Wit, G. F. Rimmelzwaan, R. A. Fouchier,
A. D. Osterhaus, and T. Kuiken. 2007. Human and avian influenza viruses
target different cells in the lower respiratory tract of humans and other mammals.
The American journal of pathology 171:1215-1223.
331. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-
gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via
indoleamine 2,3-dioxygenase. J Immunol 169:7039-7044.
332. Varga, Z. T., A. Grant, B. Manicassamy, and P. Palese. 2012. Influenza virus
protein PB1-F2 inhibits the induction of type I interferon by binding to MAVS
and decreasing mitochondrial membrane potential. J Virol 86:8359-8366.
333. Veit, M., and B. Thaa. 2011. Association of influenza virus proteins with
membrane rafts. Advances in virology 2011:370606.
102
334. Vignali, D. A., L. W. Collison, and C. J. Workman. 2008. How regulatory T
cells work. Nat Rev Immunol 8:523-532.
335. Wang, P., P. Palese, and R. E. O'Neill. 1997. The NPI-1/NPI-3 (karyopherin
alpha) binding site on the influenza a virus nucleoprotein NP is a nonconventional
nuclear localization signal. J Virol 71:1850-1856.
336. Wang, R., A. Song, J. Levin, D. Dennis, N. J. Zhang, H. Yoshida, L.
Koriazova, L. Madura, L. Shapiro, A. Matsumoto, H. Yoshida, T.
Mikayama, R. T. Kubo, S. Sarawar, H. Cheroutre, and S. Kato. 2008.
Therapeutic potential of a fully human monoclonal antibody against influenza A
virus M2 protein. Antiviral Res 80:168-177.
337. Wang, X., M. Li, H. Zheng, T. Muster, P. Palese, A. A. Beg, and A. Garcia-
Sastre. 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB
and induction of alpha/beta interferon. J Virol 74:11566-11573.
338. Wang, Y., H. X. Zhang, Y. P. Sun, Z. X. Liu, X. S. Liu, L. Wang, S. Y. Lu, H.
Kong, Q. L. Liu, X. H. Li, Z. Y. Lu, S. J. Chen, Z. Chen, S. S. Bao, W. Dai,
and Z. G. Wang. 2007. Rig-I-/- mice develop colitis associated with
downregulation of G alpha i2. Cell research 17:858-868.
339. Webster, R. G., W. G. Laver, and E. D. Kilbourne. 1968. Reactions of
antibodies with surface antigens of influenza virus. J Gen Virol 3:315-326.
340. Werner-Felmayer, G., E. R. Werner, D. Fuchs, A. Hausen, G. Reibnegger,
and H. Wachter. 1989. Characteristics of interferon induced tryptophan
metabolism in human cells in vitro. Biochim Biophys Acta 1012:140-147.
103
341. Werner-Felmayer, G., E. R. Werner, D. Fuchs, A. Hausen, G. Reibnegger,
and H. Wachter. 1989. Tumour necrosis factor-alpha and lipopolysaccharide
enhance interferon-induced tryptophan degradation and pteridine synthesis in
human cells. Biological chemistry Hoppe-Seyler 370:1063-1069.
342. Wharton, S. A., R. B. Belshe, J. J. Skehel, and A. J. Hay. 1994. Role of virion
M2 protein in influenza virus uncoating: specific reduction in the rate of
membrane fusion between virus and liposomes by amantadine. J Gen Virol 75 (
Pt 4):945-948.
343. Wilkinson, T. M., C. K. Li, C. S. Chui, A. K. Huang, M. Perkins, J. C.
Liebner, R. Lambkin-Williams, A. Gilbert, J. Oxford, B. Nicholas, K. J.
Staples, T. Dong, D. C. Douek, A. J. McMichael, and X. N. Xu. 2012.
Preexisting influenza-specific CD4(+) T cells correlate with disease protection
against influenza challenge in humans. Nat Med 18:274-280.
344. Wingender, G., N. Garbi, B. Schumak, F. Jungerkes, E. Endl, D. von
Bubnoff, J. Steitz, J. Striegler, G. Moldenhauer, T. Tuting, A. Heit, K. M.
Huster, O. Takikawa, S. Akira, D. H. Busch, H. Wagner, G. J. Hammerling,
P. A. Knolle, and A. Limmer. 2006. Systemic application of CpG-rich DNA
suppresses adaptive T cell immunity via induction of IDO. Eur J Immunol 36:12-
20.
345. Wong, D. D., K. T. Choy, R. W. Chan, S. F. Sia, H. P. Chiu, P. P. Cheung, M.
C. Chan, J. S. Peiris, and H. L. Yen. 2012. Comparable fitness and
transmissibility between oseltamivir-resistant pandemic 2009 and seasonal H1N1
104
influenza viruses with the H275Y neuraminidase mutation. J Virol 86:10558-
10570.
346. Wright, P. F., G. Neumann, and Y. Kawaoka. 2007. Orthomyxoviruses, p.
1691-1740. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields'
virology, 5th ed, vol. 2. Wolters Kluwer Health/Lippincott Williams & Wilkins,
Philadelphia :.
347. Xu, L., H. Yoon, M. Q. Zhao, J. Liu, C. V. Ramana, and R. I. Enelow. 2004.
Cutting edge: pulmonary immunopathology mediated by antigen-specific
expression of TNF-alpha by antiviral CD8+ T cells. J Immunol 173:721-725.
348. Yamashita, M., M. Krystal, and P. Palese. 1989. Comparison of the three large
polymerase proteins of influenza A, B, and C viruses. Virology 171:458-466.
349. Yassine, H. M., C. W. Lee, R. Gourapura, and Y. M. Saif. 2010. Interspecies
and intraspecies transmission of influenza A viruses: viral, host and
environmental factors. Animal health research reviews / Conference of Research
Workers in Animal Diseases 11:53-72.
350. Yeung, A. W., W. Wu, M. Freewan, R. Stocker, N. J. King, and S. R.
Thomas. 2012. Flavivirus infection induces indoleamine 2,3-dioxygenase in
human monocyte-derived macrophages via tumor necrosis factor and NF-kappaB.
J Leukoc Biol 91:657-666.
351. Yoshida, R., and O. Hayaishi. 1978. Induction of pulmonary indoleamine 2,3-
dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Proc Natl
Acad Sci U S A 75:3998-4000.
105
352. Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of
indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl
Acad Sci U S A 76:4084-4086.
353. Yuasa, H. J., H. J. Ball, C. J. Austin, and N. H. Hunt. 2010. 1-L-
methyltryptophan is a more effective inhibitor of vertebrate IDO2 enzymes than
1-D-methyltryptophan. Comp Biochem Physiol B Biochem Mol Biol 157:10-15.
354. Zamarin, D., M. B. Ortigoza, and P. Palese. 2006. Influenza A virus PB1-F2
protein contributes to viral pathogenesis in mice. J Virol 80:7976-7983.
355. Zhang, J., A. Pekosz, and R. A. Lamb. 2000. Influenza virus assembly and lipid
raft microdomains: a role for the cytoplasmic tails of the spike glycoproteins. J
Virol 74:4634-4644.
356. Zhu, X., W. Yu, R. McBride, Y. Li, L. M. Chen, R. O. Donis, S. Tong, J. C.
Paulson, and I. A. Wilson. 2013. Hemagglutinin homologue from H17N10 bat
influenza virus exhibits divergent receptor-binding and pH-dependent fusion
activities. Proc Natl Acad Sci U S A.
106
CHAPTER 3
INHIBITION OF INDOLEAMINE 2, 3-DIOXYGENASE (IDO) ENHANCES THE T
CELL RESPONSE TO INFLUENZA VIRUS INFECTION1
1Fox, J. M. , Sage, L. K., Huang, L., Barber, J., Klonowski, K. D., Mellor, A. L.,
Tompkins, S. M., Tripp, R. A. 2013. Journal of General Virology. 94:1441-1450
Reprinted here with permission of the publisher.
107
Abstract
Influenza infection induces an increase in the level of indoleamine 2, 3-
dioxygenase (IDO) activity in the lung parenchyma. IDO is the first and rate limiting
step in the kynurenine pathway where tryptophan is reduced to kynurenine and other
metabolites. The depletion of tryptophan, and production of associated metabolites,
attenuates the immune response to infection. The impact of IDO on the primary immune
response to influenza virus infection was determined using the IDO inhibitor 1-methyl-D,
L-tryptophan (1MT). C57BL/6 mice treated with 1MT and infected with A/HKx31
influenza virus had increased numbers of activated and functional CD4+, influenza-
specific CD8+ T cells, and effector memory cells in the lung. Inhibition of IDO increased
the Th1 response in CD4+ T cells as well as enhanced the Th17 response. These studies
show that inhibition of IDO engenders a more robust T cell response to influenza virus,
and suggests an approach for enhancing the immune response to influenza vaccination by
facilitating increased influenza-specific T cell response.
108
Introduction
Influenza virus is a worldwide health concern, particularly for persons at the extremes of
age, i.e. the young and elderly (20). While protection from influenza virus is mediated by
a neutralizing antibody response (6), a potent T cell response is required for elimination
of virally-infected cells, and for protection from heterologous virus infection as T cells
recognize conserved viral epitopes (15). Numerous studies have shown the importance
of T cell memory in protection from disease in mice (48, 50). Although the significance
of the T cell response is less understood for humans, there are studies showing influenza
infection is associated with increased frequencies of memory influenza specific CD8+ T
cells in the lungs compared to the circulating CD8+ T cells (14, 44), and evidence that
memory CD4+ T cells can reduce disease severity (53). Recently, several studies have
focused on developing vaccines to elicit potent T cell responses in an attempt to bypass
the need for yearly vaccination by providing cross-protective immunity (24, 39).
Several studies have addressed mechanisms that may facilitate the host response
to immunity, and have shown that inhibition of indoleamine 2, 3- dioxygenase (IDO) has
the potential to increase host responses (13, 36). IDO is an intracellular enzyme in the
kynurenine pathway that catabolizes tryptophan into kynurenine (23) and was initially
shown to provide protection from fetal rejection mediated through T cells (42). This
protection was attributed to reduction in tryptophan levels causing immune cells to arrest
in the cell cycle and T cells to become anergic (18, 41). Furthermore, IDO activity has
been shown to skew CD4 T cells toward a Treg phenotype over a pro-inflammatory
response (3). IDO activity is linked to immune attenuation and maintaining an
immunosuppressive environment, therefore inhibition of IDO has the potential to reverse
109
these effects as seen in the alloantigen memory T cell response (23, 49). Several studies
have focused on the role of IDO in the maintenance of cancerous cells and tumors and
resistance to T cell cytotoxicity (46, 52). In some studies, inhibition of IDO using 1-
methyl-tryptophan (1MT) was able to reduce the size and growth of tumors, but was
unable to provide complete tumor elimination alone (51, 54).
IDO expression is up-regulated through IFNγ signaling (4), suggesting IDO may
modulate the immune response to viral infection. During influenza virus infection in
mice, IDO activity has been shown to increase over time with peak activity coinciding
with the peak number of T cells within the respiratory tract (55). Thus, while coordinate
expression of IDO may serve to regulate the duration of immunity by modulating the T
cell response, it is also likely that IDO-mediated immune attenuation may also hinder the
quantity and/or quality of the T cell response. Recent studies have shown IDO to have an
attenuating role in the immune response to HIV (1), Leishmania major (37), and
Toxoplasma gondii (43).
IDO inhibition during combined NKT cell activation and influenza vaccination
has been shown to boost protective immunity (16, 24), however it remains unclear how
IDO impacts the immune response to influenza virus infection. To address this in this
study, 1MT was used to pharmacologically inhibit IDO activity in mice infected with
HKx31 (X31). The T cell response to infection was evaluated in lung airways. The
results show that IDO inhibition allows for an enhanced Th1 response, increased the
functional influenza virus-specific CD8+ T cell response, and produced higher quantities
of effector memory cells.
110
Material and Methods
Mice, virus propagation, and infection. Six-to-eight week old female C57BL/6 mice were
purchased from Charles River (Raleigh, NC) and all animal studies were approved by the
Animal Care and Use Committee of the University of Georgia. A/HKx31 (X31, H3N2)
influenza virus was propagated in the allantoic cavity of 9-day-old embroynated chicken
eggs at 37C for 72 hours. Titers were determined by an influenza plaque assay (38). All
mice were anesthetized by intraperitoneal (i.p.) injection of Avertin (2, 2, 2-
tribromoethanol) followed by intranasal (i.n.) infection with 103 PFU of X31 in 50 μl of
PBS at 8 to 10 weeks old.
Preparation and administration of 1-methyl-D, L-tryptophan (1MT). The D, L racemic
mixture of 1MT (Sigma-Aldrich, St. Louis, MO) was administered to the mice through
drinking water at a concentration of 2 mg/ml. The treated water was prepared by
dissolving the 1MT powder in water using NaOH. The pH was adjusted to 7. To coax
the mice to drink the water, aspartame was added to the water. The water was filter
sterilized and contained in autoclaved water bottles covered in aluminum foil. Control
animals received aspartame sweetened water only. 1MT-treated water was given to the
mice 3 days prior to infection and the animals remained on the treatment throughout the
course of the infection. Mice receiving the 1MT treatment were weighed during the three
days prior to infection to ensure consumption of the water. The water and water bottles
were changed every five-to-seven days.
111
Measuring IDO activity through the ratio of Kynurenine (kyn)-to-Tryptophan (trp) by
HPLC. Lungs and serum were collected from mice at 2, 4, 6, 8, 10, 12, and 14 days post-
infection (dpi). Lungs were harvested in PBS containing antibiotics and antimycotics and
homogenized using a tissue lyser (Qiagen, Valencia, CA). Clarified lung homogenate
and serum were aliquoted and frozen at -80C until processing. Concentration of kyn and
trp were determined by HPLC analysis using a standard curve (34). Briefly, proteins
were removed from the clarified lung homogenate and serum using trichloroacetic acid
and analyzed using a C18 reverse phase column (Restek, Bellefonte, PA).
Isolation and phenotyping of lymphocyte populations. At 10 dpi, mice were anesthetized
and bronchoalveolar leukocytes (BAL) were collected by instillation of 1 mL of PBS into
the lungs at three times for each mouse. Mediastinal lymph node (MLN) were removed
and placed into HBSS at 4C until processing. Single cells suspensions were prepared
from the MLN using a 100 micron cell strainer (BD Biosciences, San Jose, CA). Cells
were centrifuged and resuspended in complete tumor media (CTM). Cell numbers were
determined with a Coulter Counter (Beckman Coulter, Brea, CA). Single cell
suspensions were plated between 5x104 to 5x10
5 cells/well. The cells were resuspended
in staining wash buffer (SWB) (PBS + 1% BSA + 0.09% NaN3) followed by incubation
with Fc Block (BD Pharmingen, San Diego, CA) at 4C for 15 min. Cells were then
incubated with anti-CD3e (clone 145-2C11), anti-CD8 (clone 53-6.7), anti-CD4 (clone
RM4-5), anti-CD44 (clone IM7), and anti-CD62L (clone MEL-14) (BD Pharmingen) for
30 min at 4C. The cells were rinsed with SWB and fix with 1% paraformaldehyde in
PBS.
112
For intracellular cytokine staining, cells were stimulated with a cocktail of
influenza immunodominant peptides (NP366-374, PA224-233, PB1703-711) (1ug/ml), irrelevant
peptide (RSV M282-90) (1ug/ml), or DMSO for 4h in CTM at 37°C followed by surface
staining with anti-CD3, anti-CD8 , H2DbNP366-374 tetramer, H2D
bPA224-233 tetramer, or
H2KbPB1703-711 tetramer (NIH Tetramer Core Facility, Emory, Atlanta, GA) for 1 hour at
room temperature for the IFNγ response from CD8+ T cells. Cells were stimulated with
UV-inactivated X31 virus (1:100) or allantoic fluid for 6h in CTM at 37°C followed by
surface staining with anti-CD3 and anti-CD4 for intracellular staining of CD4 T cells for
IFNγ (clone XMG1.2), IL-6 (clone MP5-32C11), or IL-4 (clone 11B11) (BD
Pharmingen). Cultured cells were stained as described above, but were kept in the
presence of GolgiStop (BD Biosciences). Following surface staining, cells were rinsed
with SWB + GolgiStop and fix and permeabilized with the Foxp3
Fixation/Permeabilization solution (eBiosciences, San Diego, CA). The cells were rinsed
with Perm/Wash Buffer (BD Biosciences) and incubated with intracellular markers listed
above for 30 min at 4C. Cells were washed with Perm/Wash Buffer and resuspended in
PBS. All samples were run on a LSRII flow cytometer (BD Biosciences) and analyzed
using BD FACS Diva software (San Jose, CA) or FlowJo (Tree Star, Ashland, OR). All
populations were initially gated on CD3+ cells. Isotype control antibodies and mock
stimulation were used to set gates for analysis.
Determination of viral load from lung homogenate. At 1-10 days post-infection, mice
were anesthetized ip with Avertin and blood was collected from the brachial artery.
Lungs were harvested in PBS containing antibiotics and antimycotics and homogenized
113
using a tissue lyser (Qiagen, Valencia, CA). Lungs were centrifuged and supernatant was
aliquoted and frozen at -80C until assayed. Viral titers were determined using a TCID50
as previously described All TCID50s were done in quadruplicates. To determine M gene
copy number, lungs were harvested and processed as described above. RNA was isolated
using Trizol (Life Technologies, Grand Island, NY) followed by the addition of
chloroform. RNA was cleaned using the RNeasy kit following the manufacture’s
protocol (Qiagen). RNA concentrations were determined using the Nanodrop 1000
(Thermo Fisher). qRT-PCR was performed using the OneStep RT-PCR Kit (Qiagen)
using the CDC’s Universal Influenza Primer/Probe set. 1µg of RNA was added to each
reaction and ran in a MX3000P QPCR System (Stratagene). The samples were incubated
for 50°C for 30 min, 95°C for 15 min, then 45 cycles of 95°C for 15 sec and 55°C for 30
sec. M gene copy number was determined using a plasmid standard.
Statistical analysis. Statistics were performed using GraphPad Prism Version 5.01 (La
Jolla, CA). The data was analyzed using a two-tailed student’s t-test comparing 1MT
treatment to control treated mice at each time point. Significance was assigned when the
p value < 0.05.
Results
Influenza infection increases IDO activity in the lungs.
The presence of IDO is associated with attenuated T cell responses to infectious agents
(5, 37). As these pathogens drive expression of IFNγ, IDO activity is upregulated in
dendritic cells, macrophages, and epithelial cells (4, 28, 40). IDO activity has been
114
previously shown to be upregulated in the lungs of influenza infected mice (55);
however, the effect IDO has on the quantity and quality of the anti-influenza T cell
response has not been examined. In this study, we address the hypothesis that inhibition
of IDO activity during T cell priming will augment the magnitude and duration of the
pulmonary T cell response to influenza virus infection. To test this, IDO expression was
inhibited using 1MT, a competitive inhibitor of IDO (8). 1MT was administered via
drinking water three days prior to infection, and the mice remained on 1MT throughout
the course of the study. IDO activity was measured in mice receiving 1MT or vehicle
(sweetened water) by evaluating the ratio of kynurenine (kyn) to tryptophan (trp) in lung
homogenates and serum of influenza-infected mice at days 0, 2, 4, 6, 8, 10, 12 and 14 dpi
(Fig 1). The kyn/trp ratio directly measures IDO activity by comparing the concentrations
of metabolite to substrate produced. The serum kyn/trp ratios in mice receiving 1MT or
vehicle control were similar to day 10 pi, however there was a significant (p<0.05)
difference in kyn/trp ratios in the serum of control vs 1MT treated mice on day 12pi (Fig.
3.1a). Although the kyn/trp ratios were similar to day 10 pi, there was a trend towards
increased kyn/trp ratios in control compared to 1MT treated mice. In comparison, the
kyn/trp ratios were substantially higher in the lungs following influenza infection
compared to control treated mice, suggesting that infection modulates IDO activity (Fig.
3.1b), and at day 4 post- infection, there was a small but significant (p<0.05) difference in
IDO activity in the lungs (Fig. 3.1b). Notably, at day 10 pi, a significant (p<0.01)
increase in the kyn/trp ratios was evident in the lungs of control compared to 1MT-treated
mice (Fig. 3.1b). These findings are consistent with a previous report showing that IDO
activity peaks between day 10 and 11pi in the lungs after influenza infection (55), and
115
also demonstrates a temporal pharmacological inhibition of influenza induced IDO
activity through the administration of 1MT. Since IDO activity peaked at day 10, we
evaluated the cellular response at this time-point for the remainder of the study.
IDO inhibition does not affect leukocyte infiltration or viral clearance.
Since IDO has been shown to increase apoptosis and reduce cell proliferation (35, 40),
we sought to determine if IDO affected pulmonary leukocyte numbers. To examine the
effects of IDO inhibition on the overall frequency of cells responding to virus infection,
the number of leukocytes in the bronchoalveolar lavage (BAL) and draining mediastinal
lymph node (MLN) were determined at 10 dpi. It is known that following influenza virus
infection in mice, NK cells can be detected in the airways at day 3 post-influenza
infection, peaking by day 5 pi, whereby influenza-specific T cells begin to accumulate at
detectable frequencies in the lung airways at day 5 pi with their overall numbers peaking
at day 10 pi (12, 21, 31). In this study, 1MT treatment did not have any substantial effect
on the overall level or kinetics of pulmonary leukocyte recruitment (Fig. 3.2a). Similarly,
1MT treatment did not have any substantial effect on MLN cell numbers (Fig. 3.2b).
It was important to determine if IDO was selectively affecting the frequency
and/or function of specific pools of respondent leukocytes, as modulation of local
tryptophan levels has been shown to affect the survival and function of T cells (17).
Examination of the CD4+ and CD8+ T cell subpopulations isolated from the BAL of
1MT treated mice showed no significant difference as compared to vehicle treated mice
(Fig. 3.1c), while there was an increase in the CD4+ T cell population in the MLN in the
control treated mice (Fig. 3.1d).
116
Previous studies have shown that inhibition of IDO reduces the pathogen load
during Leishmania infections (37). Thus, we wanted to determine if 1MT treatment had
any effect on lung virus clearance. No differences in virus were evident between 1MT
and control treated mice by TCID50 (Fig. 3.3a) or M gene expression (Fig. 3.3b). As
differences in IDO activity were not detected until day 10 pi in lung homogenate (Fig.
3.1a), and there was no substantial difference in pulmonary CD8+ T cell numbers (Fig.
3.2c), it is not surprising that 1MT had no detectable effect on virus clearance.
Inhibition of IDO activity enhances the Th1 cytokine response.
The CD4+ T cell response to influenza infection in mice has been characterized as a Th1-
type response (9, 15), however IDO has been shown to activate regulatory T cells and
block their conversion into Th17-like cells (3). Thus, the effects of IDO on the
differentiation of Th1- or Th2-type CD4+ T cells were determined in the BAL. Cytokines
representative of Th1-, Th2-, and Th17-type responses were determined, i.e. IFNγ, IL-4,
and IL-6, respectively. The proportion and frequency of CD4+ T cells expressing IFNγ,
IL-6, or IL-4 was determined at day 10 pi (Fig. 3.4). There was a significant increase (p
< 0.05) in the percentage (Fig. 3.4b) and number (Fig. 3.4c) of CD4+ T cells expressing
IFNγ. There was also a significant increase in the percentage of CD4+ T cells expressing
IL-6 (Fig. 3.2d), although there was only a slight increase in the number of CD4+ T cells
expressing IL-6 (Fig. 3.2e). There was no change in the CD4+ IL-4 expressing
population, showing a specific role of IDO in the suppression of a Th1/Th17 response.
Together, these findings indicate that IDO inhibition through 1MT treatment enhances
117
the Th1-type response indicated by higher numbers of BAL CD4+ T cells expressing
IFNγ following infection with influenza virus.
IDO inhibition is associated with increased numbers of influenza-specific CD8+ T cells.
Total numbers of CD8+ T cells in the BAL of 1MT treated mice were not affected (Fig.
3.2c), thus virus-specific CD8+ T cell frequencies were determined following 1MT or
vehicle treatment. CD8+ T cells from the BAL were collected at day 10 post-infection
and stained with tetramers detecting reactivity to the influenza nucleoprotein (NP) (H-
2DbNP366-374 tetramer), acid polymerase (PA) (H-2D
bPA224-233), or basic polymerase 1
(H-2KbPB1703-711) (Fig. 3.5). NP and PA have been shown to be the dominate CD8+ T
cell epitopes in response to influenza with PB1 being subdominant to NP and PA (10, 11,
56). While there was no difference in the percent of influenza-specific CD8+ T cells
between 1MT and control treated mice (Fig. 3.5a), treatment with 1MT had increased
numbers of CD8+ T cells for each immune dominant influenza-specific epitope (Fig.
3.5b). There was a significant (p<0.05) increase in PA specific CD8+ T cells (Fig. 3.5b),
and a trend toward higher numbers of NP and PB1-specific CD8+ T cells (Fig. 3.5b).
There were no substantial differences in the frequency of influenza-specific CD8+ T cells
in the MLN in the 1MT and control treated groups (data not shown), suggesting that this
increase occurs at the site of infection.
Since IDO has a role in dampening the T cell response, and there were increases
in the number of influenza-specific CD8+ T cells in the BAL, the TCR Vβ diversity was
examined in 1 MT-treated and control mice at days 0, 6, 8, 10, 12, and 14 pi. Splenocytes
were stained for TCR Vβ 2, 6, 7, 8, and 8.1/8.2. No substantial variation was detected in
118
TCR Vβ usage among influenza specific CD8+ T cells from that previously shown (32)
(data not shown). These results support the finding that IDO inhibition increased the
numbers of pulmonary CD8+ T cells that are influenza virus-specific.
IDO affects influenza-specific CD8+ T cell functionality and the effector memory
population.
As IDO treatment was associated with an enhanced Th1-type response determined by
increased numbers of CD4+ T cells expressing IFNγ (Fig. 3.4b), and there were increases
in the number of PA-specific CD8+ T cells in the BAL (Fig. 3.5b), the effect of IDO
treatment on CD8+ T cell activation was evaluated. To determine if IDO inhibition was
linked to a concomitant increase in virus-specific CD8+ T cells, the percentage and
number of CD8+ T cells and influenza specific CD8+ T cells expressing IFNγ collected
from the BAL was analyzed 10 dpi (Fig. 3.6a, c-d). In contrast to the increased numbers
of CD4+ T cells expressing IFNγ in the BAL of 1MT treated mice (Fig. 3.4), inhibition
of IDO did not change the percentage of CD8+ T cells expressing IFNγ (Fig. 3.6c-d).
There were slightly higher numbers of BAL CD8+ T cells expressing IFNγ of 1MT
treated mice compared to control mice (Fig. 3.6d). CD8+ T cells were stained with H-
2DbNP366-374, H-2D
bPA224-233, and H-2K
bPB1703-711 tetramers and for intracellular IFNγ to
evaluate activation (Fig. 3.6b, e-f). Of the CD8+ T cells expressing IFNγ, there was a
significant (p<0.05) increase in the number of PA-specific T cells, while NP and PB1
CD8+ T cells showed no difference between the treatments (Fig. 3.6f). These findings
indicate that in the absence of IDO, the activated PA-specific CD8+ T cells are increased
over the NP and PB1. These results suggest that IDO modifies the CD8+ T cell
119
frequency, and IDO inhibition increases the number of functional influenza virus specific
CD8+ T cells, in particular a co-dominant epitope, at the site of infection.
Given the increase in CD4+ and CD8+ T cell activity with IDO inhibition, the
level of effector and central memory T cell populations were evaluated. To evaluate the
effector and central memory populations, CD4+ and CD8+ T cells were phenotyped for
expression of CD44 and CD62L, with CD44hi
CD62Llo
expression being indicative of
effector memory cells and CD44hi
CD62Lhi
expression representing central memory cells
(45). Ten days post-infection there was an increased frequency of CD8+ effector
memory cells in the absence of IDO activity (Fig. 3.7a-b). While there was no difference
between the CD4+ T cell effector memory populations (Fig. 3.7c-d), there was a
significant increase in the central memory population in control compared to 1MT treated
mice (Fig. 3.7d). These results support a role of IDO in the reduction of the production
of the effector memory population, particularly the CD8+ T cell population.
Discussion
The findings from this study show that IDO has an immune dampening role in the
response to influenza virus infection where IDO inhibition resulted in an overall
enhancement in the number of activated T cells in the lungs. IDO dampening of the IFNγ
response appeared greatest for the CD4+ T cell compartment with an enhanced Th1 and
Th17 response, although IFNγ expression by CD8+ T cells was also affected. In the
BAL, the most abundant functional CD8+ T cell response in the absence of IDO was
directed to the PA epitope (PA224-233) compared to the control treated mice. These
findings suggest that IDO might alter CD8+ T cell frequency while there is no detectable
120
shift in the TCR Vβ usage of the CD8+ T cells. This could possibly be attributed to
enhance trafficking of PA-specific T cells to the lungs related to a survival advantage.
Changes in the frequency have implications on the diversity of the T cell
population directed at influenza. There are multiple possibilities on how IDO affects the
influenza specific CD8+ T cell population. One potential mechanism is through changes
in antigen expression in antigen presenting cells (APCs). NP is commonly expressed by
most cells including dendritic cells and non-dendritic cells, while the PA peptide is
almost exclusively expressed on dendritic cells and this has been shown to affect the
peptide dominance between acute and secondary influenza infection (11). The
expression pattern for PB1, however, has not been established. Since both macrophages
and dendritic cells can express IDO through stimulation with IFN-γ (28), there is
potential for a differential expression pattern of influenza epitopes. This could be driven
through the immunoproteasome, which is also up-regulated through IFN-γ (47). The
immunoproteasome is responsible for the cleavage of proteins during infection for
peptide presentation through the MHC class I pathway (30) and IDO may be influencing
the expression of epitopes. Furthermore, it has been shown that immunodominance is
affected by the recruitment and expansion of CD8+ T cells (33). With reduced IDO
activity, there was increased activation of the influenza specific CD8+ T cells, suggesting
prolonged exposure to antigen or continued activation of T cell arriving “late” to the
immune response. The continued activation can be due in part to the reduced production
of Treg cells as a result of IDO inhibition (3).
Although inhibition of IDO increased the amount of virus-specific cells
expressing IFNγ, surprisingly 1MT treatment did not affect lung viral titers as noted for
121
other pathogens (37). One explanation may relate to the tempo of IDO expression.
Accordingly, there are likely two phases of IDO activity in response to influenza virus
infection, the first during initial infection of respiratory epithelial cells, followed by a
larger induction related to IFNγ produced by CD4+ and CD8+ T cells. IFNγ is an
extremely potent activator of IDO (4), and the second wave of IDO activity is more
robust and can be easily detected by examination of kyn levels or the ratio of kyn/trp. As
the first induction of IDO likely occurs during infection of respiratory epithelial cells, this
lower level of IDO activity has limited effects on the early response to infection, thus no
immediate impact on virus clearance. Another possibility may be linked to the location of
T cell activation. Findings from our lab show IDO to be active in the MLNs of influenza-
infected mice. It is possible that the T cell response is affected by the expression of IDO
in the lymph node, rather than in the lungs, which would help explain the lack of
differences in viral titers. Furthermore, influenza infection of epithelial cells induces
IDO (29); however, the role IDO has in lung epithelial cells has not been thoroughly
examined. IDO may be involved in cell survival, as it does have antioxidant properties,
which could reduce the damage caused by superoxides produced during infection (27).
In addition, increased tryptophan availability has been shown to aid in pathogen
proliferation (25), and this may also facilitate influenza replication.
Interestingly, there was no difference in the level of serum IgG titers between
1MT treated and control mice (data not shown), and the immunoglobulin isotype was the
same between the two groups (data not shown). These findings suggest that IDO has no
detectable effect on the B cell response to infection. This is consistent with an earlier
study that showed IDO treatment of peripheral blood derived B cells had no effect on B
122
cells or their proliferation (22). Furthermore, treatment with 1MT did not change the
expression of IFNγ from splenocytes 21 dpi by ELISPOT detection following influenza
peptide stimulation compared to control treated mice (data not shown). Since there was
an increase in the CD8+ T cell effector memory population, the effect in the memory
population may be more evident in the resident lung cells (not evaluated in this study).
In this study, increased IDO activity was induced following influenza virus
infection, a feature that had a dampening effect on the immune response. Specifically,
1MT-treated mice had higher numbers Th1-CD4+ T cells and effector memory CD8+ T
cells. IDO activity peaked in the lungs at day 10 post-infection, a finding consistent with
an earlier study (55). Early leukocyte recruitment to the lungs was not substantially
affected by IDO inhibition (data not shown). There are several possibilities for this that
relate to trp catabolism, particularly in the MLN. IDO metabolites have been shown to
induce apoptosis of T cells (26) and to sway the CD4+ T cells to a regulatory phenotype
(19). The production of regulatory T cells in the MLN could suppress the pulmonary T
cell recruitment. Preliminary work in our lab shows that 1MT treatment decreases the
number of cytotoxic Treg cells in the BAL. The lack of Treg suppression and production
of Trp metabolites may contribute to altered leukocyte trafficking, proliferation, and
increased survival of cells in the airways. Another possibility that is related to Treg
production is the inability of inhibitory molecules to produce an effect on the system.
The PD-1/PD-L pathway has been linked to IDO expression and activity (2). Tregs
activated by IDO up-regulate the expression of PD-L1/PD-L2 on dendritic cells (46).
The lack of PD-L expression will increase the activation and survival of the effector T
cell population (7).
123
The results from this study show that regulating IDO can enhance aspects of the
adaptive immune response to influenza infection. This is attractive as regulating IDO
activity during vaccination may facilitate vaccine efficacy. These observations support
the concept that controlling IDO activity during vaccination with the live, attenuated
influenza virus may be a means to augment vaccine efficacy and the robustness of the T
cell response, an attribute that could potentially facilitate heterosubtypic immunity.
Acknowledgements
We thank Dr. Phillip Chandler for his technical assistance with 1MT preparation and
administration, Spencer Poore and Scott Johnson for assistance with animal work, and the
NIH Tetramer Core Facility for generating the tetramers. This work was supported by
the National Institutes of Health U01 grant AI083005-01.
References
1. Andersson, J., A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G.
M. Shearer, and C. A. Chougnet. 2005. The prevalence of regulatory T cells in
lymphoid tissue is correlated with viral load in HIV-infected patients. J Immunol
174:3143-3147.
2. Baban, B., P. R. Chandler, B. A. Johnson, 3rd, L. Huang, M. Li, M. L.
Sharpe, L. M. Francisco, A. H. Sharpe, B. R. Blazar, D. H. Munn, and A. L.
Mellor. 2011. Physiologic control of IDO competence in splenic dendritic cells. J
Immunol 187:2329-2335.
124
3. Baban, B., P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H.
Munn, and A. L. Mellor. 2009. IDO activates regulatory T cells and blocks their
conversion into Th17-like T cells. J Immunol 183:2475-2483.
4. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine
dioxygenase by interferon in mice: a study with different recombinant interferons
and various cytokines. Biochem Biophys Res Commun 152:237-242.
5. Boasso, A., J. P. Herbeuval, A. W. Hardy, S. A. Anderson, M. J. Dolan, D.
Fuchs, and G. M. Shearer. 2007. HIV inhibits CD4+ T-cell proliferation by
inducing indoleamine 2,3-dioxygenase in plasmacytoid dendritic cells. Blood
109:3351-3359.
6. Bridges, C. B., J. M. Katz, R. A. Levandowski, and N. J. Cox. 2008.
Inactivated influenza vaccines. In S. A. Potkin, W. A. Orenstein, and P. A. Offit
(ed.), Vaccines. Elsevier.
7. Brown, J. A., D. M. Dorfman, F. R. Ma, E. L. Sullivan, O. Munoz, C. R.
Wood, E. A. Greenfield, and G. J. Freeman. 2003. Blockade of programmed
death-1 ligands on dendritic cells enhances T cell activation and cytokine
production. J Immunol 170:1257-1266.
8. Cady, S. G., and M. Sono. 1991. 1-Methyl-DL-tryptophan, beta-(3-
benzofuranyl)-DL-alanine (the oxygen analog of tryptophan), and beta-[3-
benzo(b)thienyl]-DL-alanine (the sulfur analog of tryptophan) are competitive
inhibitors for indoleamine 2,3-dioxygenase. Arch Biochem Biophys 291:326-333.
125
9. Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid
dendritic cells activated by influenza virus and CD40L drive a potent TH1
polarization. Nat Immunol 1:305-310.
10. Crowe, S. R., S. C. Miller, and D. L. Woodland. 2006. Identification of
protective and non-protective T cell epitopes in influenza. Vaccine 24:452-456.
11. Crowe, S. R., S. J. Turner, S. C. Miller, A. D. Roberts, R. A. Rappolo, P. C.
Doherty, K. H. Ely, and D. L. Woodland. 2003. Differential antigen
presentation regulates the changing patterns of CD8+ T cell immunodominance in
primary and secondary influenza virus infections. J Exp Med 198:399-410.
12. Culley, F. J. 2009. Natural killer cells in infection and inflammation of the lung.
Immunology 128:151-163.
13. Dai, H., and Z. Dai. 2008. The role of tryptophan catabolism in acquisition and
effector function of memory T cells. Curr Opin Organ Transplant 13:31-35.
14. de Bree, G. J., E. M. van Leeuwen, T. A. Out, H. M. Jansen, R. E. Jonkers,
and R. A. van Lier. 2005. Selective accumulation of differentiated CD8+ T cells
specific for respiratory viruses in the human lung. J Exp Med 202:1433-1442.
15. Doherty, P. C., D. J. Topham, R. A. Tripp, R. D. Cardin, J. W. Brooks, and
P. G. Stevenson. 1997. Effector CD4+ and CD8+ T-cell mechanisms in the
control of respiratory virus infections. Immunol Rev 159:105-117.
16. Fallarini, S., T. Paoletti, L. Panza, and G. Lombardi. 2008. Alpha-
galactosylceramide modulates the induction of indoleamine 2,3-dioxygenase in
antigen presenting cells. Biochem Pharmacol 76:738-750.
126
17. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.
C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.
Cell Death Differ 9:1069-1077.
18. Fallarino, F., U. Grohmann, S. You, B. C. McGrath, D. R. Cavener, C.
Vacca, C. Orabona, R. Bianchi, M. L. Belladonna, C. Volpi, P. Santamaria,
M. C. Fioretti, and P. Puccetti. 2006. The combined effects of tryptophan
starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and
induce a regulatory phenotype in naive T cells. J Immunol 176:6752-6761.
19. Favre, D., J. Mold, P. W. Hunt, B. Kanwar, P. Loke, L. Seu, J. D. Barbour,
M. M. Lowe, A. Jayawardene, F. Aweeka, Y. Huang, D. C. Douek, J. M.
Brenchley, J. N. Martin, F. M. Hecht, S. G. Deeks, and J. M. McCune. 2010.
Tryptophan catabolism by indoleamine 2,3-dioxygenase 1 alters the balance of
TH17 to regulatory T cells in HIV disease. Sci Transl Med 2:32ra36.
20. Fiore, A. E., T. M. Uyeki, K. Broder, L. Finelli, G. L. Euler, J. A. Singleton,
J. K. Iskander, P. M. Wortley, D. K. Shay, J. S. Bresee, and N. J. Cox. 2010.
Prevention and control of influenza with vaccines: recommendations of the
Advisory Committee on Immunization Practices (ACIP), 2010. MMWR Recomm
Rep 59:1-62.
21. Flynn, K. J., G. T. Belz, J. D. Altman, R. Ahmed, D. L. Woodland, and P. C.
Doherty. 1998. Virus-specific CD8+ T cells in primary and secondary influenza
pneumonia. Immunity 8:683-691.
22. Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and G. B.
Ferrara. 2002. Tryptophan-derived catabolites are responsible for inhibition of T
127
and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J
Exp Med 196:459-468.
23. Grohmann, U., F. Fallarino, and P. Puccetti. 2003. Tolerance, DCs and
tryptophan: much ado about IDO. Trends Immunol 24:242-248.
24. Guillonneau, C., J. D. Mintern, F. X. Hubert, A. C. Hurt, G. S. Besra, S.
Porcelli, I. G. Barr, P. C. Doherty, D. I. Godfrey, and S. J. Turner. 2009.
Combined NKT cell activation and influenza virus vaccination boosts memory
CTL generation and protective immunity. Proc Natl Acad Sci U S A 106:3330-
3335.
25. Gupta, S. L., J. M. Carlin, P. Pyati, W. Dai, E. R. Pfefferkorn, and M. J.
Murphy, Jr. 1994. Antiparasitic and antiproliferative effects of indoleamine 2,3-
dioxygenase enzyme expression in human fibroblasts. Infect Immun 62:2277-
2284.
26. Hayashi, T., J. H. Mo, X. Gong, C. Rossetto, A. Jang, L. Beck, G. I. Elliott, I.
Kufareva, R. Abagyan, D. H. Broide, J. Lee, and E. Raz. 2007. 3-
Hydroxyanthranilic acid inhibits PDK1 activation and suppresses experimental
asthma by inducing T cell apoptosis. Proc Natl Acad Sci U S A 104:18619-
18624.
27. Hirata, F., and O. Hayaishi. 1975. Studies on indoleamine 2,3-dioxygenase. I.
Superoxide anion as substrate. J Biol Chem 250:5960-5966.
28. Hwu, P., M. X. Du, R. Lapointe, M. Do, M. W. Taylor, and H. A. Young.
2000. Indoleamine 2,3-dioxygenase production by human dendritic cells results in
the inhibition of T cell proliferation. J Immunol 164:3596-3599.
128
29. Jacoby, D. B., and A. M. Choi. 1994. Influenza virus induces expression of
antioxidant genes in human epithelial cells. Free Radic Biol Med 16:821-824.
30. Kloetzel, P. M. 2001. Antigen processing by the proteasome. Nat Rev Mol Cell
Biol 2:179-187.
31. Kreijtz, J. H., R. A. Fouchier, and G. F. Rimmelzwaan. 2011. Immune
responses to influenza virus infection. Virus Res 162:19-30.
32. La Gruta, N. L., K. Kedzierska, K. Pang, R. Webby, M. Davenport, W.
Chen, S. J. Turner, and P. C. Doherty. 2006. A virus-specific CD8+ T cell
immunodominance hierarchy determined by antigen dose and precursor
frequencies. Proc Natl Acad Sci U S A 103:994-999.
33. La Gruta, N. L., W. T. Rothwell, T. Cukalac, N. G. Swan, S. A. Valkenburg,
K. Kedzierska, P. G. Thomas, P. C. Doherty, and S. J. Turner. 2010. Primary
CTL response magnitude in mice is determined by the extent of naive T cell
recruitment and subsequent clonal expansion. J Clin Invest 120:1885-1894.
34. Laich, A., G. Neurauter, B. Widner, and D. Fuchs. 2002. More rapid method
for simultaneous measurement of tryptophan and kynurenine by HPLC. Clin
Chem 48:579-581.
35. Lee, G. K., H. J. Park, M. Macleod, P. Chandler, D. H. Munn, and A. L.
Mellor. 2002. Tryptophan deprivation sensitizes activated T cells to apoptosis
prior to cell division. Immunology 107:452-460.
36. Liu, Z., H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai. 2007.
Suppression of memory CD8 T cell generation and function by tryptophan
catabolism. J Immunol 178:4260-4266.
129
37. Makala, L. H., B. Baban, H. Lemos, A. R. El-Awady, P. R. Chandler, D. Y.
Hou, D. H. Munn, and A. L. Mellor. 2011. Leishmania major attenuates host
immunity by stimulating local indoleamine 2,3-dioxygenase expression. J Infect
Dis 203:715-725.
38. Matrosovich, M., T. Matrosovich, W. Garten, and H. D. Klenk. 2006. New
low-viscosity overlay medium for viral plaque assays. Virol J 3:63.
39. Mueller, S. N., W. A. Langley, E. Carnero, A. Garcia-Sastre, and R. Ahmed.
2010. Immunization with live attenuated influenza viruses that express altered
NS1 proteins results in potent and protective memory CD8+ T-cell responses. J
Virol 84:1847-1855.
40. Munn, D. H., E. Shafizadeh, J. T. Attwood, I. Bondarev, A. Pashine, and A.
L. Mellor. 1999. Inhibition of T cell proliferation by macrophage tryptophan
catabolism. J Exp Med 189:1363-1372.
41. Munn, D. H., M. D. Sharma, B. Baban, H. P. Harding, Y. Zhang, D. Ron, and
A. L. Mellor. 2005. GCN2 kinase in T cells mediates proliferative arrest and
anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 22:633-
642.
42. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B.
Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal
rejection by tryptophan catabolism. Science 281:1191-1193.
43. Murakami, Y., M. Hoshi, A. Hara, M. Takemura, Y. Arioka, Y. Yamamoto,
H. Matsunami, T. Funato, M. Seishima, and K. Saito. 2012. Inhibition of
130
increased indoleamine 2,3-dioxygenase activity attenuates Toxoplasma gondii
replication in the lung during acute infection. Cytokine.
44. Oshansky, C. M., and P. G. Thomas. 2012. The human side of influenza. J
Leukoc Biol 92:83-96.
45. Roberts, A. D., K. H. Ely, and D. L. Woodland. 2005. Differential contributions
of central and effector memory T cells to recall responses. J Exp Med 202:123-
133.
46. Sharma, M. D., B. Baban, P. Chandler, D. Y. Hou, N. Singh, H. Yagita, M.
Azuma, B. R. Blazar, A. L. Mellor, and D. H. Munn. 2007. Plasmacytoid
dendritic cells from mouse tumor-draining lymph nodes directly activate mature
Tregs via indoleamine 2,3-dioxygenase. J Clin Invest 117:2570-2582.
47. Tanaka, K., and M. Kasahara. 1998. The MHC class I ligand-generating
system: roles of immunoproteasomes and the interferon-gamma-inducible
proteasome activator PA28. Immunol Rev 163:161-176.
48. Taylor, P. M., and B. A. Askonas. 1986. Influenza nucleoprotein-specific
cytotoxic T-cell clones are protective in vivo. Immunology 58:417-420.
49. Terness, P., T. M. Bauer, L. Rose, C. Dufter, A. Watzlik, H. Simon, and G.
Opelz. 2002. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-
dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan
metabolites. J Exp Med 196:447-457.
50. Thomas, P. G., R. Keating, D. J. Hulse-Post, and P. C. Doherty. 2006. Cell-
mediated protection in influenza infection. Emerg Infect Dis 12:48-54.
131
51. Uyttenhove, C., L. Pilotte, I. Theate, V. Stroobant, D. Colau, N. Parmentier,
T. Boon, and B. J. Van den Eynde. 2003. Evidence for a tumoral immune
resistance mechanism based on tryptophan degradation by indoleamine 2,3-
dioxygenase. Nat Med 9:1269-1274.
52. Wainwright, D. A., I. V. Balyasnikova, A. L. Chang, A. U. Ahmed, K. S.
Moon, B. Auffinger, A. L. Tobias, Y. Han, and M. S. Lesniak. 2012. IDO
expression in brain tumors increases the recruitment of regulatory T cells and
negatively impacts survival. Clin Cancer Res.
53. Wilkinson, T. M., C. K. Li, C. S. Chui, A. K. Huang, M. Perkins, J. C.
Liebner, R. Lambkin-Williams, A. Gilbert, J. Oxford, B. Nicholas, K. J.
Staples, T. Dong, D. C. Douek, A. J. McMichael, and X. N. Xu. 2012.
Preexisting influenza-specific CD4(+) T cells correlate with disease protection
against influenza challenge in humans. Nat Med 18:274-280.
54. Yang, H. J., M. C. Yen, C. C. Lin, C. M. Lin, Y. L. Chen, T. Y. Weng, T. T.
Huang, C. L. Wu, and M. D. Lai. 2010. A combination of the metabolic enzyme
inhibitor APO866 and the immune adjuvant L-1-methyl tryptophan induces
additive antitumor activity. Exp Biol Med (Maywood) 235:869-876.
55. Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of
indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl
Acad Sci U S A 76:4084-4086.
56. Zhong, W., P. A. Reche, C. C. Lai, B. Reinhold, and E. L. Reinherz. 2003.
Genome-wide characterization of a viral cytotoxic T lymphocyte epitope
repertoire. J Biol Chem 278:45135-45144.
132
Figure 3.1. Influenza infection increases IDO activity in the lungs and sera. Mice were
treated with 1MT or control three days prior to infection. On day 0, i.e. 3 days after
treatment, mice were i.n. infected with 103 PFU X31 in PBS. (a) Serum, and (b) lung
homogenate were collected every other day from day 0 (uninfected animals) until day 14
pi. Each time point represents the mean and SEM of 3-5 mice/group and shows two
independent experiments. (**p value <0.01 and *p value < 0.05)
133
Figure 3.2. 1MT treatment does not affect total frequency of T cells infiltrating the
lungs. Mice were treated with 1MT or control three days prior to infection and
subsequently infected with 103 PFU of X31 i.n. (a) BAL and (b) MLN cells numbers
from day 10 pi. Number of CD8+ and CD4+ T cells in the (c) BAL and (d) MLN.
Representative data from one experiment is shown from 3 independent experiments. (*p
value < 0.05)
134
Figure 3.3. IDO inhibition does not change viral titers. Mice were treated with 1MT or
control three days prior to infection. On day 0, mice were anesthetized and intranasally
infected with 103 PFU X31 in PBS. Lungs were harvested and homogenized in PBS
containing antibiotic and antimycotic. (a) Clarified homogenate was titered by TCID50
on MDCK in the presence of trypsin as previously described. (b) Viral antigen was
determined by qRT-PCR on the M gene and quantified using a standard curve. The limit
of detection (LD) of the assay is denoted with a dashed line.
135
Figure 3.4. 1MT treatment enhances the Th1 response. Mice were treated with 1MT or
control, as described, and infected with 103 PFU X31 i.n. Ten days post-infection, BAL
cells were stimulated for 6h with UV-inactivated influenza virus and subsequently
stained for intracellular expression of IFNγ, IL-6, and IL-4. (a) Representative dot plots
of CD4+ T cells expressing IFNγ, IL-6, and IL-4. (b, d ,f) Proportion and (c, e, g)
frequency of CD4+ T cells expressing (b, c) IFNγ, (d, e) IL-6, and (f, g) IL-4.
136
Representative data from one experiment is shown from 3 independent experiments. (**p
value <0.01 and *p value < 0.05)
137
Figure 3.5. IDO inhibition enhances the influenza specific response. Mice were treated
with 1MT or control, as described, and infected with 103 PFU X31 i.n. On day 10 pi,
BAL cells were analyzed for virus-specific CD8+ T cell numbers as determined by
tetramers specific to NP366-374, PA224-233, or PB1703-711. (a) Proportion and (b) frequency
of CD8+ T cells are shown Representative data from one experiment is shown from 3
independent experiments. (*p value < 0.05)
138
Figure 3.6. IDO inhibition increases the frequency of functional PA-specific CD8+ T
cells. Mice were treated with 1MT or control, as described, and infected with 103 PFU
139
X31 i.n. Ten days post-infection, single cells from the BAL were stimulated for 4h with
influenza immunodominant peptides and subsequently stained for intracellular expression
of IFNγ. (a, b) Representative dot plots of (a) CD8+ T cells and (b) influenza-specific
CD8+ T cells expressing IFNγ. (c) Percentage and (d) frequency of CD8+ T cells
expressing IFNγ. (e) Percentage and (f) frequency of influenza-specific CD8+ T cells
expressing IFNγ. Representative data from one experiment is shown from 3 independent
experiments. (*p value < 0.05)
140
Figure 3.7. Inhibition of IDO activity increases the presence of CD8+ effector memory
cells. Mice were treated with 1MT or control three days prior to infection. On day 0,
mice were i.n. infected with 103 PFU X3. (a, b) CD8+ and (c, d) CD4+ T cells collected
10 dpi from the BAL were stained for the presence of CD44 and CD62L. Representative
data from one experiment is shown from 2 independent experiments. (*p value < 0.05)
141
CHAPTER 4
INTERFERON LAMBDA UPREGULATES IDO1 EXPRESSION IN RESPIRATORY
EPITHELIAL CELLS FOLLOWING INFLUENZA VIRUS INFECTION2
2Fox, J. M., Crabtree, J. M., Sage, L. K., Tompkins, S. M., Tripp, R.A. To be resubmitted
to Journal of Immunology
142
Abstract
Influenza infection causes an increase in indoleamine 2, 3-dioxygenase (IDO)
activity in the lung parenchyma. IDO catabolizes tryptophan into kynurenine leading to
immune dampening. Multiple cell types express IDO, and while IFNγ up-regulates IDO
in dendritic cells and macrophages, it is unclear how IDO is affected in respiratory
epithelial cells during influenza infection. In this study, the role of IFNλ in IDO
regulation was investigated following influenza infection of respiratory epithelial cells.
IDO1 expression increased concurrently with IFNλ expression. Recombinant IFNλ up-
regulated IDO1 activity, IFNλ neutralizing antibodies decreased IDO1 expression during
influenza infection, and IDO1 inhibition was associated with decreased lung viral titers.
Furthermore, kynurenine was released from the cells basal-laterally. These studies show
a role for IDO in the host response to influenza infection, and provide insight into novel
approaches for enhancing vaccine responses and therapeutic approaches.
143
Introduction
Influenza is a significant worldwide health concern. During respiratory infection,
influenza mainly infects the respiratory epithelium which supports virus replication as
well as initiates the antiviral state in response to infection (23). Virus infection of the
epithelium stimulates the production of type I and type III IFNs (IFNλ) with IFNλ being
the main IFN expressed in response to influenza infection in mice (12).
Interferon lambda consists of three subtypes, IFNλ-1, IFNλ-2, IFNλ-3 (7).
Although IFNλ and type I IFNs have similar activities, a primary difference is the
receptor utilization (27). IFNλ binds to the IFNλR, which consists of the IFNLR1 (IL-
28Rα) and IL-10R2 (7). The IL-10R2 is ubiquitously expressed on the surface of most
cells, while IFNLR1 is mainly expressed on epithelial cell lining the respiratory and
gastrointestinal tract (25), as well as by plasmacytoid dendritic cells (pDCs) in mice (17).
In contrast, type I IFNs utilizes IFN-αR1 and IFN-αR2 which are present on most cell
types (8). Since the complete IFNλ receptor is found on epithelial cells, its role in
antiviral immunity is unique to these cell types. After binding to their receptors, type I
and type III IFNs have similar signaling pathways through dimerization of Stat1 and
Stat2 which can in turn recognize IFNγ activation site sequence and IFN-stimulated
response elements (7).
Indoleamine 2, 3-dioxygenase (IDO) is an intracellular enzyme in the kynurenine
pathway that catabolizes tryptophan (trp) into kynurenine (kyn3) which leads to immune
suppression and attenuation (18). IDO is expressed by dendritic cells, macrophages (9),
and epithelial cells (26). Since respiratory epithelial cells are a primary target for
influenza replication, it is critical to understand the role IDO has during influenza
144
infections. The IDO gene contains an IFN-stimulated response element in its promoter
(20), is highly up-regulated by stimulation with IFNγ, and modestly up-regulated by type
I IFNs (5); however, the effect of type III IFNs has not been evaluated.
To understand the relationship between IFN and IDO during the early stages of
the host response to influenza infection, mouse and human respiratory epithelial cell
models were investigated. The findings indicated that IDO1 was up-regulated following
influenza virus infection and by concomitant IFNλ expression. Inhibition of IDO activity
using 1-methyl-D, L- tryptophan (1MT) resulted in decreased viral burden and viability
in the epithelial cells. Furthermore, kyn, metabolite of IDO, was secreted basally from
influenza infected cells. These results define a role for IFNλ during influenza infection,
and show that IFNλ directly stimulates IDO activity.
Material and Methods
Cell culture and viruses. MLE-15 cells were cultured in HITES media [RMPI 1640
media (Cellgro, Manassas, VA) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis,
MO), 10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1%
ITS (insulin-transferring-selenium; Gibco)] with 4% FBS (culture media). Madin Darby
Canine Kidney (MDCK) cells were cultured in DMEM (HyClone, Logan, UT) with 5%
FBS. Human lung epithelial (Beas2B) cells were cultured in BronchialLife Basal media
supplemented with B/T LifeFactors (LifeLine Cell Technology, Frederick, MD). Normal
human bronchial epithelial (NHBE) cells (LifeLine Cell Technology) were cultured and
maintained as previously described (13, 19). NHBE cells were maintained at an air-
liquid-interface at 37°C with 5% CO2 until fully differentiated. Basal media was
145
changed every 2 days and apical surface was rinsed with PBS after two weeks at air.
A/WSN/33 (H1N1; WSN) and A/HK/X31 (H3N2; X31) influenza viruses were
propagated in the allantoic cavity of 9-day-old embryonated chicken eggs. Titers were
determined by a standard plaque assay on MDCK cells in the presence of 5% FBS or
trypsin at 37C for WSN and X31, respectively (15).
WSN infection of epithelial cells and stimulation with rIFNλ. MLE-15 and Beas2B cells
were cultured on 24-well plates at 6 x 105 cells/well or 2 x 10
5 cells/well, respectively.
Cells were rinsed once with PBS followed by infection with WSN in infection media
(HITES media + 4% FBS for MLE-15 cells and BronchialLife Basal media with
supplements + 2% FBS for Beas2B cells) for 1 hour at 37C. Cells were rinsed 3 times
with PBS and fresh infection media was added to the cells. The cells were incubated at
37C for the indicated amount of time. Differentiated NHBE cells were cultured on a
transwell plate, as described above. Cells were rinsed 3 times with PBS followed by
infection with WSN apically in BronchialLife Basal media without supplements for 1
hour at 37°C. After infection, cells were rinsed 3 times with PBS, the final rinse was
removed and the cells were incubated at 37°C for indicated times. RNA was harvested as
described below and supernatant was collected and stored at -80C. IFNλ activity was
blocked during infection on MLE-15 cells using an IFNλ2/3 neutralizing antibody (nAb)
(R&D Systems, Minneapolis, MN) at 9μg/ml. IFNλ expression was silenced in MLE-15
cells with a siRNA targeting IL28b (IFNλ3; siIL28b) (ON-TARGETplus Il28b siRNA
SMARTpool; Thermo Scientific, Pittsburgh, PA). Briefly, MLE-15 cells were transfected
16h prior to infection with WSN using Dharmafect 1 following manufacturer’s protocol
146
with the siRNA at a concentration of 100nM. A non-targeting control (siNEG; Thermo
Scientific) was included at the same concentration. IDO activity was blocked during
infection using 1-methyl-D, L-tryptophan (1MT; Sigma-Aldrich) at 750uM. Viral titers
were determined from cell culture supernatant at times indicated using a TCID50 method
as previously described (24), with dilutions prepared in DMEM (Hyclone) with 5% FBS.
The TCID50 was calculated using the Reed and Meunch method (22). MLE-15 cells
were stimulated with recombinant IFNλ3 (rIFNλ; eBiosciences, San Diego, CA) prepared
in culture media with an unstimulated control. Differentiated NHBE cells were apically
stimulated with recombinant IFNλ1 (rIFNλ1; eBiosciences) or IFNλ2 (rIFNλ2;
eBiosciences) in BronchialLife Basal media without supplements for 1 hour at 37°C.
After stimulation, cells were rinsed 3 times with PBS, the final rinse was removed and
the cells were incubated at 37°C for indicated times.
qPCR for detection of mRNA. RNA was isolated at respective time-points from samples
using the RNeasy mini kit (Qiagen, Valencia, CA) following the manufacture’s protocol
and stored at -20C. Isolated RNA was DNase treated using DNase I recombinant
(Roche, Indianapolis, IN) following manufacture’s protocol. DNase treated RNA was
quantified using the Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was
synthesized using Verso cDNA kits (Thermo Scientific, Lafayette, CO) following the
manufacture’s protocol using equivalent concentrations of RNA for each experiment.
qPCR was used to detect murine (Mm) IDO1 (Forward-
GCACGACATAGCTACCAGTCT, Reverse- CCACAAAGTCACGCATCCTCTTAA,
Probe-5’-6FAM-AAAGCCAAGGAAATTT-MGBNFQ-3’), Mm IDO2 (Forward-
147
CTTCATCCTAGTGACAGTCTTGGT, Reverse-GCCTCCATTCCCTGAACCA, Probe-
5’-6FAM-CACTGCTGCCTTCTC-MGBNFQ-3’), Mm IFNλ2/3 (Forward-
CAGTGGAAGCAAAGGATTGCCACA, Reverse-
AACTGCACCTCAGGTCCTTCTCAA, Probe-5’-6FAM-
AAAGGCCAAGGATGCCATCGAGAAGA-MGBNFQ-3’). The cycling times were
95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 52°C for 1 min, and 68°C for
1 min. All samples were normalized to a housekeeping gene, HPRT (Applied
Biosystems, Foster City, CA) or GAPDH. mRNA expression was determined using 2^(-
ΔΔCt).
Evaluating IDO activity by measuring kyn concentrations. The cells were either infected
with WSN as previously described or stimulated with rIFNλ in phenol red free culture
media. Exogenous trp (50M; Sigma-Aldrich) was added to each well 24 h prior to
collection of supernatant. At 24 h post addition of trp, cellular supernatant was collected
and stored at -80C. For NHBE cells, exogenous trp (50M; Sigma-Aldrich) was added
to the basal media 24h prior to collection. At time of collection, the apical surface was
rinsed with PBS and the basal media was obtained and stored at -80°. Concentration of
kyn was determined using a kyn colorimetric assay with a standard curve of kyn
concentrations in PBS (Sigma-Aldrich). Briefly, proteins were removed by addition of
30% tricholoracetic acid (TCA; VWR, Radnor, PA) and incubated at 50°C for 30 min to
hydrolyze n-formylkynurenine to kyn. Samples were then centrifuged at 2400 rpm for 10
min at 4°C. Supernatants were incubated with Erlich’s reagent for 10 min. Absorbance
was read at 490nm using an Epoch microplate reader (BioTek, Winooski, VT).
148
Quantification of IFNλ and IFNα. IFNλ was quantified from infected cell supernatant
using a VeriKine-DIY Mouse interferon lambda 2/3 ELISA (PBL Interferon Source,
Piscataway, NJ) following the manufacture’s protocol. IFNα was quantified using the
Mouse IFN-alpha FlowCytomix Simplex Kit (eBiosciences, San Diego, CA) following
the manufacture’s protocol. Samples were run on a LSRII (BD Biosciences, San Jose,
CA) and analyzed using the provided software. IFNλ and IFNα was quantified from
human cells (Beas2B and NHBE) using the VeriKine-DIY Human Interleukin-
29/Interferon Lambda ELISA and VeriKine Human Interferon Alpha ELISA Kit (PBL
Interferon Source) following the manufacture’s protocol.
Evaluation of cell death following infection. MLE-15 cells were infected with WSN, as
described above, and cell supernatant collected at the indicated time points. Adenylate
kinase release was detected using the ToxiLight kit (Lonza, Allendale, NJ) following
manufacturer’s instructions. Complete lysis controls were treated with 1% triton-x 100
(Sigma-Aldrich) in PBS for 10 min. Percent cell death was calculated using the equation
[(I- UI)/(C-UI)]*100, where I= infected sample, UI= uninfected samples of the same
treatment as infected sample, C= complete lysis control.
Statistical Analysis. Statistics were performed using GraphPad Prism Version 5.04 (La
Jolla, CA). Significance was assigned when the *p < 0.05, **p<0.01, ***p<0.001,
****p<0.0001 using either a student’s t-test or ANOVA with a Bonferroni post-hoc test,
as listed in the figure legends.
149
Results
Influenza infection up-regulates expression of IDO1 over IDO2.
A paucity of information is available regarding IDO expression during influenza
infection. To address this, MLE-15 cells were infected with WSN, and IDO1 and IDO2
mRNA evaluated over the course of infection (Fig. 4.1A). At 48h post-infection (hpi),
IDO1 and IDO2 were significantly up-regulated compared to uninfected controls;
however, IDO1 was preferentially expressed over IDO2 (Fig. 4.1A). To corroborate this
finding, a different influenza virus, X31, was used (Fig. 4.2A). MLE-15 cells infected
with X31 were examined at 24 and 48 hpi for IDO1 and IDO2 expression. Similar to the
WSN infection, IDO1 was more highly expressed than IDO2; however, the kinetics of
IDO1 expression was shifted where IDO1 peaked at 24 hpi rather than 48 hpi (Fig. 4.2A).
These findings likely reflect differences in virus replication between WSN and X31.
To determine if the level of IDO up-regulation correlated with virus replication,
MLE-15 cells were infected at varying MOI of WSN, and mRNA expression and IDO
activity was evaluated. IDO activity was determined by the level of the IDO metabolite,
kynurenine (kyn), produced from IDO-mediated trp catabolism. The results showed
IDO1 mRNA expression increased with increasing MOI (Fig. 4.3A). At an MOI of 0.1,
IDO1 mRNA expression was reduced and this may be linked to loss of cell viability due
to higher infectious dose (data not shown). Importantly, as the MOI increased there was
also an increase in IDO activity which was significant at 48 hpi and 72 hpi (Fig 4.1B).
These findings indicate that influenza infection induces increased IDO1 expression and
activity in MLE-15 cells.
150
Since the IDO1 mRNA expression and activity were initially determined in a
mouse cell line, we want to validate the increase in IDO activity following influenza
infection utilizing a more relevant human bronchial epithelial cell line, Beas2B cells and
fully differentiated normal human bronchial epithelial (NHBE) cells. Similar to the
MLE-15 cells, there was an increase in IDO activity in the Beas2B cells with increasing
MOI at 48 hpi and 72 hpi, which was significant for the highest MOI compared to
uninfected controls (Fig. 4.1C). Furthermore, WSN infection of the NHBE cells
increased the concentration of kyn present in the basal media (Fig. 4.1D). There was no
detectable kyn present in the NHBE apical washes (data not shown), suggesting that the
effect of IDO induction following influenza infection is reducing the trp concentration on
the basal-lateral side of the lung airways. These results indicate that IDO1 mRNA
expression and activity are increased across mouse and human lung epithelial cells
following influenza infection.
Peak IDO1 and IFNλ expression coincide.
During influenza virus infection antiviral IFNs are expressed. To determine the
pattern of IFN expression, MLE-15 cells were infected with WSN and IFNλ and IFNα
levels were determined at 24, 48, and 72 hpi (Fig. 4.4A). At 24 hpi, IFNλ was primarily
detected in the MLE-15 cell supernatant; however, at 48 hpi, the concentration of IFNλ
peaked and was significantly higher than IFNα. Interestingly, peak IDO1 mRNA
expression also occurred at 48 hpi (Fig. 4.1A), a feature consistent with the hypothesis
that IFNλ drives IDO1 expression. No IFNγ mRNA was present in the cells at any time
point post-infection (data not shown), indicating that IDO1 was not up-regulated by
151
IFNγ. To correlate increased IDO activity with increasing MOI (Fig. 4.3B), the amount
of IFNλ produced in cell supernatant was analyzed. Increased MOI resulted in increased
IFNλ in the supernatant (Fig. 4.3B). The significant increase in IFNλ production over
IFNα was also seen during WSN infection in Beas2B and NHBE cells at each time point
(Fig. 4.4B & C). Peak IFNλ expression also occurred at 48 hpi (Fig. 4.4B), which is
consistent with increased IDO activity (Fig. 4.1C & D). These results suggest that IFNλ
produced during influenza infection upregulates the expression and activity of IDO.
To confirm that IFNλ expression drives IDO expression, the level of IFNλ mRNA
expression in MLE-15 cells was assessed following infection with X31. IFNλ mRNA
expression peaked at 24 hpi (Fig. 4.2B), a finding consistent with peak IDO1 expression
(Fig. 4.2A). These results suggest that IFNλ from infected MLE-15 cells may be
signaling neighboring cells through their IFNλR to express IDO1.
IFNλ up-regulates IDO1.
It is established that type I and type II IFNs can induce IDO activity (5).
However, as IFNλ was predominantly expressed following WSN infection, recombinant
IFNλ (rIFNλ) was evaluated for its ability to stimulate IDO expression. Since the
Beas2B cells had similar results as the NHBE cells (Fig. 4.1 & 4.4), we evaluated IFNλ
stimulation of IDO in the MLE-15 and NHBE cells. Stimulation of the MLE-15 cells for
24h with rIFNλ3 had a significant increase in IDO1 mRNA expression compared to
unstimulated cells (Fig. 4.5A). The IDO1 increase was dose-dependent (Fig. 4.5A). IFNλ
mediated up-regulation of IDO1 had minimal effect on IDO2, a finding that is consistent
with influenza results (Fig. 4.1A). Notably, there was also a dose-response effect in IDO
152
activity following IFNλ stimulation (Fig. 4.5B) where increasing concentrations of IFNλ
were associated with increased IDO activity. Similar results were observed in the NHBE
cells. rIFNλ1 (IL-29) or rIFNλ2 (IL-28a) stimulation was able to significantly increase
IDO activity as compared to unstimulated cells (Fig. 4.5C). As previously seen during
WSN infection (Fig. 4.1D), IFNλ stimulation also increased the kyn levels in the basal
media with limited concentrations present in the apical washes (Fig. 4.5C). These
findings show that IFNλ can directly stimulate IDO activity primarily through IDO1.
Since the recombinant IFNλ stimulated IDO1 expression, it was important to
confirm that IFNλ is a source of IDO1 stimulation during influenza infection. Since IFNλ
induced IDO activity in the mouse and human cells, only the MLE-15 cells were used for
the remainder of the study. MLE-15 cells were infected with WSN in the presence or
absence of an IFNλ2/3 neutralizing antibody (nAb). The presence of nAb decreased
IDO1 expression (Fig 4.6A), however there was still IDO1 mRNA compared to
uninfected cells suggesting there is likely another factor affecting IDO1 expression. We
validated the role of IFNλ in IDO induction by silencing IFNλ3 using small interfering
RNA (siRNA). Treatment with the siRNA targeting IFNλ3 (siIFNλ3) significantly
reduced the relative gene expression of IFNλ compared to non-targeting control (siNEG)
(Fig. 4.6B). When the MLE-15 cells were infected with WSN after transfection with
siIFNλ3, there was a significant reduction in IDO1 mRNA expression compared to
siNEG treated cells (Fig. 4.6C). These results show that IFNλ is partly responsible for
the up-regulation of IDO during an influenza infection. Other factors may be involved in
IDO up-regulation, such as type I IFNs. Also it is possible that when both type I and type
III IFNs are present, they may act synergistically to increase IDO1 expression.
153
Inhibition of IDO decreases viral load and increases cell death.
Since IDO is upregulated during influenza infection of MLE-15 cells, a feature
linked to IFNλ expression, it was important to evaluate the consequence of IDO
expression on virus clearance. To test this, MLE-15 cells were infected with WSN in the
presence or absence of 1-methyl-D, L-tryptophan (1MT). 1MT blocks IDO activity
through competitive inhibition and the racemic mixture will inhibit both IDO1 and IDO2
activity (14, 21). The concentration of 1MT used was able to inhibit IDO during
influenza infection based on IDO activity and caused minimal cellular cytotoxicity (2-3%
increase in cell death compared to untreated uninfected controls; data not shown). When
IDO was inhibited during influenza infection, there was decreased viral load at 24 hpi
and a significant decrease in viral titers at 48 hpi compared to untreated controls (Fig.
4.7A). To confirm that the decrease in viral titers was not associated with increased cell
death, cellular supernatants were tested for the presence of adenylate kinase and
compared to uninfected and completely lysed cells. At 24 and 48 hpi, there were no
significant differences between cells receiving 1MT versus control media (Fig. 4.7B).
However, at 72 hpi, there was a significant increase in the amount of cell death with cells
receiving 1MT (Fig. 4.7B). To confirm that inhibition of IDO reduced viral load and it
was not an effect of 1MT treatment, transduced MLE-15 cells expressing a short hairpin
RNA (shRNA) targeting either IDO1 (shIDO1) or a non-silencing control (shNEG) were
infected with WSN and viral load was determined. MLE-15 cells expressing shIDO1 had
significantly reduced viral loads at 48 hpi, which continued to be reduced compared to
shNEG cells through 72 hpi (Fig. 4.7C). These results show that the absence of IDO
154
decreases viral burden early during infection and reduces cellular viability at later time
points post-infection.
Discussion
Respiratory epithelial cells respond to influenza infection to limit virus replication
through elaboration of antiviral IFNs (2). The results from this study show that influenza
infection of epithelial cells upregulates IDO activity, specifically IDO1, which is partially
driven by IFNλ. This finding is important as IDO attenuates the immune response to
virus infection and because this is the first demonstration that IFNλ is an inducer of IDO1
in the context of influenza infection. Notably, upregulation of IDO following influenza
infection was shown to be linked to increased viral load. Recently, a second IDO enzyme,
IDO2, was recognized and findings are emerging on the differential regulation between
IDO1 and IDO2. IDO1 has been shown to be highly up-regulated in response to IFN
stimulation (3), while IDO2 appears more involved in tumor immunology (4). The
findings reported here that influenza preferentially upregulates IDO1 over IDO2 is
important when considering features driving the antiviral state.
Another interesting result from these studies was the basal secretion of kyn from
influenza and IFN stimulated differentiated NHBE cells (Fig 4.1D and 4.5C). NHBE
cells mimic the lung airways through their ability to differentiate and be maintained at the
air-liquid interface. These cells provide the opportunity to evaluate molecules secreted
from the apical and basal surfaces of the cells. Kyn was only detected in the basal media
suggesting that the effects of IDO activity are directed toward the recruited cell
populations rather than the virus. Furthermore, there was high concentration of kyn
155
present in the basal media of uninfected and unstimulated NHBE cells. Preliminary
results show that as the NHBE cells are being differentiated at the air-liquid interface
there is a steady increase in the concentration of kyn that reaches the levels observed in
these studies by 2 weeks at air (data not shown). This suggests that the bronchial
epithelial cells present in the lungs constitutively have a low level of IDO activity.
Importantly, in the presence of influenza infection or IFN stimulation there was an
increase in the concentration of kyn over the control cells.
Although IFNλ is involved in mediating an antiviral state, IFNλ-mediated IDO
induction was linked to higher viral titers compared to cells with IDO inhibited (Fig
4.7A). There are several possibilities for the decreased viral titers when IDO activity is
blocked. One is reduced cell viability. Although there was not a significant difference
between 1MT administration cell death at 48 hpi (Fig 4.7B), it is possible that changes in
cellular functions may reduce the capacity of the cell to produce virus. IDO has been
shown to impart antioxidant properties following influenza infection by using superoxide
anion as a substrate, thus protecting the cell from oxidative damage (10, 11). These
cellular changes would occur at early stages of cell death, and perhaps be more
distinguishable at later time-points, thus providing a pro-survival response for the
epithelial cells. Another possibility may involve the 1MT treatment. A study showed that
1MT can work independently of IDO to enhance or change the response to TLR
stimulation in dendritic cells (1). We addressed this hypothesis by using shRNA
transduced MLE-15 to silence IDO1 expression. While there was still reduced WSN viral
load in the shIDO1 MLE-15 cells compared to shNEG cells, the pattern was altered (Fig
4.7C). Treatment with 1MT showed reduced viral titers at 24 and 48 hpi, but by 72 hpi,
156
1MT treatment had no effect compared to control treated cells (Fig 4.7A). While shIDO1
transduced cells showed reduced viral load 48 and 72 hpi (Fig 4.7C), suggesting that
1MT may potentially be playing an additional role in enhancing TLR signaling following
influenza infection at early time points.
In addition to sharing downstream signaling pathways with type I and II IFNs for
IDO induction, IFNλ has also been shown to dampen the immune response through Treg
stimulation. One report showed that dendritic cells stimulated with IFNλ triggered the
proliferation of Foxp3-expressing Treg cells (16). Also, IFNλ in conjunction with IFNα
expression during respiratory syncytial virus infection has been shown to suppress CD4+
T cell proliferation, where the suppression could be blocked by addition of neutralizing
antibodies to the IFN receptors (6). These studies support a mechanism by which IFNλ is
inducing IDO expression and inducing a regulatory phenotype.
In summary, the results from this study show a mechanism of IDO up-regulation
through IFNλ signaling. This finding is of significance as IFNλ can only act on a limited
number of cells, so this response is unique to epithelial cells and pDCs. These studies
also show a role of IDO in increasing viral titers in epithelial cells which could be
associated with reduced cellular death. Thus, this study enhances the link between IDO
activity and regulation during infection and support the need for continued studies on
IDO’s role in vaccine development.
157
Acknowledgements
We thank Elizabeth O’Connor for her help and Dr. Wendy Watford for providing and
assisting with reagents. This work was supported by the National Institutes of Health
U01 grant AI083005-01 and the Georgia Research Alliance.
References
1. Agaugue, S., L. Perrin-Cocon, F. Coutant, P. Andre, and V. Lotteau. 2006. 1-
Methyl-tryptophan can interfere with TLR signaling in dendritic cells
independently of IDO activity. J Immunol 177:2061-2071.
2. Ank, N., and S. R. Paludan. 2009. Type III IFNs: new layers of complexity in
innate antiviral immunity. Biofactors 35:82-87.
3. Ball, H. J., A. Sanchez-Perez, S. Weiser, C. J. Austin, F. Astelbauer, J. Miu,
J. A. McQuillan, R. Stocker, L. S. Jermiin, and N. H. Hunt. 2007.
Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans
and mice. Gene 396:203-213.
4. Ball, H. J., H. J. Yuasa, C. J. D. Austin, S. Weiser, and N. H. Hunt. 2009.
Indoleamine 2,3-dioxygenase-2; a new enzyme in the kynurenine pathway. The
International Journal of Biochemistry & Cell Biology 41:467-471.
5. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine
dioxygenase by interferon in mice: a study with different recombinant interferons
and various cytokines. Biochem Biophys Res Commun 152:237-242.
6. Chi, B., H. L. Dickensheets, K. M. Spann, M. A. Alston, C. Luongo, L.
Dumoutier, J. Huang, J. C. Renauld, S. V. Kotenko, M. Roederer, J. A.
158
Beeler, R. P. Donnelly, P. L. Collins, and R. L. Rabin. 2006. Alpha and lambda
interferon together mediate suppression of CD4 T cells induced by respiratory
syncytial virus. J Virol 80:5032-5040.
7. Commins, S., J. W. Steinke, and L. Borish. 2008. The extended IL-10
superfamily: IL-10, IL-19, IL-20, IL-22, IL-24, IL-26, IL-28, and IL-29. J Allergy
Clin Immunol 121:1108-1111.
8. de Weerd, N. A., S. A. Samarajiwa, and P. J. Hertzog. 2007. Type I interferon
receptors: biochemistry and biological functions. J Biol Chem 282:20053-20057.
9. Fallarino, F., C. Vacca, C. Orabona, M. L. Belladonna, R. Bianchi, B.
Marshall, D. B. Keskin, A. L. Mellor, M. C. Fioretti, U. Grohmann, and P.
Puccetti. 2002. Functional expression of indoleamine 2,3-dioxygenase by murine
CD8 alpha(+) dendritic cells. Int Immunol 14:65-68.
10. Hirata, F., and O. Hayaishi. 1975. Studies on indoleamine 2,3-dioxygenase. I.
Superoxide anion as substrate. J Biol Chem 250:5960-5966.
11. Jacoby, D. B., and A. M. Choi. 1994. Influenza virus induces expression of
antioxidant genes in human epithelial cells. Free Radic Biol Med 16:821-824.
12. Jewell, N. A., T. Cline, S. E. Mertz, S. V. Smirnov, E. Flano, C. Schindler, J.
L. Grieves, R. K. Durbin, S. V. Kotenko, and J. E. Durbin. 2010. Lambda
interferon is the predominant interferon induced by influenza A virus infection in
vivo. J Virol 84:11515-11522.
13. Krunkosky, T. M., B. M. Fischer, L. D. Martin, N. Jones, N. J. Akley, and K.
B. Adler. 2000. Effects of TNF-alpha on expression of ICAM-1 in human airway
159
epithelial cells in vitro. Signaling pathways controlling surface and gene
expression. Am J Respir Cell Mol Biol 22:685-692.
14. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G.
Opelz, and P. Terness. 2009. IDO1 and IDO2 are expressed in human tumors:
levo- but not dextro-1-methyl tryptophan inhibits tryptophan catabolism. Cancer
Immunol Immunother 58:153-157.
15. Matrosovich, M., T. Matrosovich, W. Garten, and H. D. Klenk. 2006. New
low-viscosity overlay medium for viral plaque assays. Virol J 3:63.
16. Mennechet, F. J., and G. Uze. 2006. Interferon-lambda-treated dendritic cells
specifically induce proliferation of FOXP3-expressing suppressor T cells. Blood
107:4417-4423.
17. Mordstein, M., E. Neugebauer, V. Ditt, B. Jessen, T. Rieger, V. Falcone, F.
Sorgeloos, S. Ehl, D. Mayer, G. Kochs, M. Schwemmle, S. Gunther, C.
Drosten, T. Michiels, and P. Staeheli. 2010. Lambda interferon renders
epithelial cells of the respiratory and gastrointestinal tracts resistant to viral
infections. J Virol 84:5670-5677.
18. Munn, D. H., M. D. Sharma, B. Baban, H. P. Harding, Y. Zhang, D. Ron, and
A. L. Mellor. 2005. GCN2 kinase in T cells mediates proliferative arrest and
anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 22:633-
642.
19. Oshansky, C. M., J. P. Barber, J. Crabtree, and R. A. Tripp. 2010.
Respiratory syncytial virus F and G proteins induce interleukin 1alpha, CC, and
160
CXC chemokine responses by normal human bronchoepithelial cells. J Infect Dis
201:1201-1207.
20. Popov, A., Z. Abdullah, C. Wickenhauser, T. Saric, J. Driesen, F. G.
Hanisch, E. Domann, E. L. Raven, O. Dehus, C. Hermann, D. Eggle, S.
Debey, T. Chakraborty, M. Kronke, O. Utermohlen, and J. L. Schultze. 2006.
Indoleamine 2,3-dioxygenase-expressing dendritic cells form suppurative
granulomas following Listeria monocytogenes infection. J Clin Invest 116:3160-
3170.
21. Qian, F., J. Liao, J. Villella, R. Edwards, P. Kalinski, S. Lele, P. Shrikant,
and K. Odunsi. 2012. Effects of 1-methyltryptophan stereoisomers on IDO2
enzyme activity and IDO2-mediated arrest of human T cell proliferation. Cancer
Immunol Immunother.
22. Reed, L. J., and H. Meunch. 1938. A simple method for estimating fifty
160160rcent endpoints. American Journal of Hygiene 27:493-497.
23. Sanders, C. J., P. C. Doherty, and P. G. Thomas. 2010. Respiratory epithelial
cells in innate immunity to influenza virus infection. Cell Tissue Res.
24. Smith, J. H., P. Brooks, S. Johnson, S. M. Tompkins, K. M. Custer, D. L.
Haas, R. Mair, M. Papania, and R. A. Tripp. 2011. Aerosol vaccination
induces robust protective immunity to homologous and heterologous influenza
infection in mice. Vaccine 29:2568-2575.
25. Sommereyns, C., S. Paul, P. Staeheli, and T. Michiels. 2008. IFN-lambda
(IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on
epithelial cells in vivo. PLoS Pathog 4:e1000017.
161
26. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-
gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via
indoleamine 2,3-dioxygenase. J Immunol 169:7039-7044.
27. Wang, J., R. Oberley-Deegan, S. Wang, M. Nikrad, C. J. Funk, K. L.
Hartshorn, and R. J. Mason. 2009. Differentiated human alveolar type II cells
secrete antiviral IL-29 (IFN-lambda 1) in response to influenza A infection. J
Immunol 182:1296-1304.
162
Hours Post-Infection
Fo
ld C
han
ge
24 48
0
2
4
6IDO1
IDO2
****
*
****
Hours Post-Infection
Kyn
co
ncen
trati
on
(u
g/m
l)
48 72
0
1
2
3UI
0.001
0.01
*
**
Hours Post-Infection
Kyn
co
ncen
trati
on
(u
g/m
l)
48 72
0.0
0.1
0.2
0.3
0.4
0.5
0.1
0.01
UI
**
***
Hours Post-Infection
Kyn
co
ncen
trati
on
(u
g/m
l)
UI
48 72
0
5
10
15
20
**** ****
A. B.
C. D.
Figure 4.1. Influenza infection up-regulates IDO1 expression. (A) MLE-15 cells were
infected with WSN at an MOI of 0.001. At 24 or 48 hours post-infection (hpi), RNA was
harvested. IDO1 and IDO2 mRNA expression was determined by qRT-PCR.
Significance is indicated when compared to uninfected cells (UI) using a one-way
ANOVA for each panel. (B) MLE-15 cells and (C) Beas2B cells were infected with
varying MOIs of WSN. Cell supernatant was collected at 48 and 72 hpi and the
concentration of kyn was determined. Significance is indicated using a one-way ANOVA
for each time point. (D) Differentiated NHBE cells were infected with WSN at an MOI of
0.5 and IDO activity was determined in the basal media. Each graph is representative of
the mean and standard deviation (SD) of at least 2 independent experiments. Significance
is indicated using a one-way ANOVA with increase compared to UI controls.
163
24 48
0
2
4
6
8
10 IDO1
IDO2
*
Hours Post-Infection
Fo
ld C
han
ge
24 48
0
500
1000
1500
Hours Post-Infection
Fo
ld C
han
ge
**
A.
B.
Figure 4.2. A/HK/X31 (X31) infection up-regulates IDO1 expression. MLE-15 cells
were infected with X31 at an MOI of 0.1 in the presence of 2 ug/ml TPCK-treated trypsin
and 0.3% BSA. At 24 or 48 hpi, RNA was harvested. (A) IDO1 and IDO2 mRNA
expression was determined by qRT-PCR. Significance assigned when compared to IDO2
using a one-way ANOVA. (B) IFNλ mRNA expression was determined by qRT-PCR.
All samples were normalized to a housekeeping gene. Each graph represents the mean
and SD of at least 2 independent experiments. Significance assigned when compared to
48hpi using a student’s t-test.
164
UI
0.00
10.
01
0
5
10
15UI0.001
0.01* *
WSN MOI
Fo
ld C
han
ge
24 48 72
0
500
1000
1500
2000
0.01
0.001
*
****
*
Hours Post-Infection
IFN
Co
ncen
trati
on
(p
g/m
l)
A.
B.
Figure 4.3. IDO and IFNλ expression are related to MOI of infection. MLE-15 cells were
infected at varying MOI with WSN. (A) RNA was collected 48hpi and IDO1 expression
was determined by qRT-PCR. All samples were normalized to a housekeeping gene.
Significance was assigned when compared to uninfected control (UI) using a one-way
ANOVA. (B) Cellular supernantant was collected at indicated time points and the
concentration of IFNλ was determined using an ELISA. Each graph represents the mean
and SD of at least 2 independent experiments. Significance assigned when compared to
MOI 0.001 at same time point using a student’s t-test.
165
Hours Post-Infection
IFN
Co
ncen
trati
on
(p
g/m
l)
24 48 72
0
50
100
500
1000
1500IFN
IFN
**
********
***
*
Hours Post-Infection
IFN
Co
ncen
trati
on
(p
g/m
l)
24 48 72
010203040
500
1000
1500
2000IFN
IFN
***
****
********
Hours Post-Infection
IFN
Co
ncen
trati
on
(p
g/m
l)
48 72 48 72
0
50
100
1500
3000
4500
6000
7500IFN
IFN
Apical Basal
**
**** ****
A. B.
C.
Figure 4.4. IDO expression correlates with IFNλ expression. (A) MLE-15 cells and (B)
Beas2B cells were infected with WSN at a MOI of 0.01 and 0.1, respectively. Cell
supernatant was collected at 24, 48, and 72 hpi and IFNλ and IFNα concentrations were
determined through ELISA. (C) Differentiated NHBE cells were infected with WSN at
an MOI of 0.5 and IFNλ and IFNα concentrations were determined from apical and basal
supernatant at indicated times points via ELISA. Each graph is representative of the mean
and SD of at least 2 independent experiments. Significance was determined by a one-way
ANOVA.
166
0
0.03
9
0.07
8
0.15
6
0.31
2
0.62
51.
25 2.5
0
2
4
6
8
10IDO1IDO2
******
******
** *
rIFN concentration (nM)
No
rmalized
Fo
ld C
han
ge
0
0.03
9
0.07
8
0.15
6
0.31
2
0.62
51.
25 2.5
0
2
4
6
8
*************
*
rIFN concentration (nM)
Kyn
co
ncen
trati
on
(u
g/m
l)
Kyn
co
ncen
trati
on
(u
g/m
l)
Apical Basal0
5
10
15US
IFN2
IFN1****
*
A. B.
C.
Figure 4.5. rIFNλ directly up-regulates the expression of IDO. (A, B) MLE-15 cells were
stimulated with varying concentrations of rIFNλ3. (A) RNA was collected at 24 h post-
stimulation and IDO1 and IDO2 expression was determined by qRT-PCR. (B)
Supernatants were collected 48 h post-stimulation and the concentration of kyn was
determined. (C) Differentiated NHBE cells were stimulated with rIFNλ2 or rIFNλ1 at
25nM. Supernatants were collected 48 h post-stimulation and IDO activity was
determined by kyn expression. Each graph is representative of the mean and SD of at
least 2 independent experiments. Significance is indicated when compared to
unstimulated expression using a one-way ANOVA.
167
nAb none0.0
0.5
1.0
1.5
**
Treatment
Rela
tive ID
O1 F
old
Ch
an
ge
Treatment
% R
ela
tive g
en
e e
xp
ressio
n
siIFN3 siNEG0
20
40
60
80
100
120
140
**
Treatment
Rela
tive ID
O1 F
old
Ch
an
ge
siIFN3 siNEG0.0
0.5
1.0
1.5
*
A. B.
C.
Figure 4.6. IFNλ partially up-regulates IDO1 during influenza infection. (A) MLE-15
cells were infected with WSN at an MOI of 0.01 with or without IFNλ nAb. RNA was
collected 48 hpi and IDO1 mRNA expression was determined through qRT-PCR. (B, C)
MLE-15 cells were transfected for 16 h with siIFNλ3 or siNEG followed by infection
with WSN at an MOI of 0.01. RNA was harvested 48 hpi. (B) IFNλ3 or (C) IDO1 gene
expression was determined through qRT-PCR. Each graph is representative of the mean
and SD of at least 2 independent experiments. Significance was assigned by student’s t-
test compared to negative control.
168
24 48 72
103
104
105
106
107
1MT
Con*
Hours Post-Infection
TC
ID50
/ml
Hours Post-Infection
TC
ID5
0/m
l
24 48 72
102
103
104
105
106
shIDO1
shNEG*
24 48 72
0
20
40
60
80
1001MT
Con
*
Hours Post-Infection
% C
ell D
ea
th
A.
B.
C.
Figure 4.7. Inhibition of IDO decreases viral titers and reduces cellular viability. (A, B)
MLE-15 cells were infected with WSN at an MOI of 0.01 with or without 1-methyl-D, L-
tryptophan (1MT) present. Cellular supernatant was collected at indicated time points.
(A) Viral titers were determined from supernatant using a TCID50. (B) Cell death was
evaluated by adenylate kinase release. (C, D) MLE-15 cells were transduced using a
lentiviral vector containing a shRNA targeting IDO1 (shIDO1) or non-targeting control
(shNEG). The transduced cells were infected with WSN at an MOI of 0.001 and cellular
supernatants were collected at indicated time points. (C) Viral titers were determined by
TCID50. Each graph is representative of the mean and SD of at least 2 independent
experiments. Significance is indicated when compared to control treated cells using a t-
test at each time point.
169
CHAPTER 5
INHIBITION OF IDO DURING EARLY STAGES OF INFLUENZA VIRUS
INFECTION AUGMENTS PRO-INFLAMMATORY CYTOKINE PRODUCTION3
3Fox, J.M., Sage, L.K., Poore, S., Johnson, S., Tompkins, S.M., and Tripp, R.A. To be
submitted to Journal of Virology.
170
Abstract
Indoleamine 2, 3-dioxygenase (IDO) activity is increased in the lung parenchyma of mice
following influenza virus infection. The presence of IDO has been shown to mediate
immune suppression through depletion of tryptophan. Influenza virus is recognized by
pattern recognition receptors which are critical in the early response to virus infection.
To determine IDO’s role in the innate response, IDO activity was inhibited using the
synthetic analog, 1-methyl-D, L-tryptophan (1MT). The results show that IDO inhibition
at early times post-infection enhanced innate signaling and increased pro-inflammatory
cytokine gene and protein expression at 24 and 48 h post-infection, respectively,
compared to control treated mice. The enhanced pro-inflammatory response in the
presence of 1MT is attributed to the macrophage population present in the airways as
RAW264.7 and primary alveolar macrophages have enhanced production of IL-6 and
TNF-α in the presence of 1MT. These studies will provide knowledge into the role of
IDO during early stages of influenza infection and how this may enhance vaccine and
therapeutic approaches.
171
Introduction
Influenza virus belongs to the family Orthomyxoviridae and causes significant
morbidity and mortality worldwide each year (7). Influenza virus primarily infects and
replicates in the airway epithelium where infection and replication induces a robust innate
immune response through recognition of pattern associated molecular patterns (PAMPs)
(34). Influenza virus is primarily recognized by TLR7, TLR3, and RIG-I, which detect
ssRNA, dsRNA, and 5’ triphosphate on ssRNA, respectively (8, 30). Stimulation of
these pattern recognition receptors (PRRs) on epithelial cells, alveolar macrophages
(AMs), and dendritic cells (DCs) induce the secretion of pro-inflammatory cytokines (IL-
6, TNF-α, IL-1β), chemokines (MCP-1, RANTES, MIP-1α/β), and type I and III
interferons (5, 18, 25, 26, 32). The expression of these molecules induces an acute phase
response, enhanced recruitment of immune cells, and induces an antiviral state resulting
in clearance and immunity (6, 22, 25, 39).
Indoleamine 2, 3-dioxygenase (IDO) is the first and rate-limiting step in the
kynurenine pathway where it catabolizes tryptophan into kynurenine (38). Kynurenine
can be further degraded into metabolites that include 3-HAA and QA (42). IDO-
mediated depletion of tryptophan and production of metabolites induces an
immunosuppressive environment in part through T cell anergy and immune cell death
(12, 13). IDO activity can be blocked using the pharmacological inhibitor 1-methyl- D,
L- tryptophan (1MT) (23). We have previously shown that in the absence of IDO activity
there is an enhanced Th1-type immune response and robust influenza-specific CD8+ T
cell response to influenza virus infection (15). To better understand the innate features
that may have contributed to an enhanced adaptive response in the absence of IDO
172
activity, it is important to evaluate how IDO activity affects very early time points post-
influenza infection.
IDO can be induced in a variety of cells types including DCs (14), macrophages
(44), and respiratory epithelial cells (41). These cell types are important for viral
replication as well as initial viral control and are known to facilitate adaptive immunity
(2, 36, 40, 43). Thus, the pro-inflammatory cytokine response throughout influenza virus
infection, and in the absence of IDO activity, was evaluated following 1MT treatment.
The results show that IDO inhibition during influenza virus infection boosts the pro-
inflammatory cytokine response, in particular the expression of IL-6 and TNF-α.
Raw264.7 macrophage cells and primary murine AMs showed increased cytokine
production in the presence of 1MT following influenza infection. These findings show a
role of AMs in modulation of the immune response to influenza through IDO inhibition.
Material and Methods:
Mice, cell culture, and virus. Six-to-eight week old female C57BL/6 mice were received
from the Charles River NCI program (Raleigh, NC). Madin Darby canine kidney
(MDCK) cells and RAW264.7 cells were maintained in DMEM (Hyclone, Logan, UT)
with 5% FBS. Mouse Lung Epithelial (MLE-15) cells were cultured in HITES media
[RMPI 1640 media (Hyclone) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis,
MO), 10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1%
ITS (insulin-transferring-selenium; Gibco)] with 4% FBS. A/HK/x31 (X31; H3N2) was
propagated in the allantoic cavity of 9 day old embryonated chicken eggs for 72h at 37°C.
Viral titer was determined through a standard avicel plaque assay on Madin Darby canine
173
kidney cells (MDCKs) in the presence of TPCK-treated trypsin, as previously described
(31).
Preparation and administration of 1-methyl-D, L-tryptophan (1MT). D, L-1MT (Sigma-
Aldrich) was administered to the mice through drinking water at a concentration of 2
mg/ml. The treated water was prepared by dissolving the 1MT powder in water using
NaOH. The pH was then adjusted to 7. To ensure the mice would drink the water, 2
sleeves of aspartame per 1L were added to the water. The water was filter sterilized and
contained in autoclaved water bottles covered in aluminum foil. Control animals
received sweetened water. 1MT-treated water was given to the mice 3 days prior to
infection and the animals remained on the treatment throughout the course of the
infection. Mice receiving the 1MT treatment were weighed during the three days prior to
infection to ensure consumption of the water. The water and water bottles were checked
every day and changed if needed. For in vitro studies, a concentrated stock solution of
1MT (7.5 mM) was prepared in molecular grade water and dissolved using NaOH. The
pH was then adjusted to 7. The solution was filtered sterilized and frozen at -80°C in
aliquots.
Evaluating TLR associated genes using a TLR PCR Array. Mice were treated 3 days
prior to infection with either 1MT or control (Con) water. On day 0, mice were infected
with 103 PFU of X31 in PBS. At 24 h post-infection, lungs were harvested and
homogenized in TRIZOL (Invitrogen, Carlsbad, CA) using a tissuelyser. Homogenate
was frozen at -80°C until processed. RNA was isolated by addition of chloroform,
174
centrifugation, and collection of the aqueous phase. RNA was precipitated with
isopropanol and washed twice with 75% ethanol. Finally, the RNA was dried and
resuspended in RNase-free water. RNA concentration was determined using the
Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was prepared using the
RT2 First Strand cDNA kit (SABiosciences; Qiagen, Valencia, CA) following the
manufacturer’s protocol with 1 ug of RNA for each sample. The RT2 Profiler PCR Array
Mouse Toll-Like Receptor Signaling Pathway (PAMM-018A) was purchased from
SABiosciences (Qiagen) and the samples were run following manufacturer’s protocol on
the Mx3005P or Mx3000P real-time machines (Stratagene, La Jolla, CA). All Ct values
were determined using a manual baseline and equivalent threshold values. Data was
analyzed using the software provided, which utilizes the 2^(-ΔΔCt) method with HPRT
has the housekeeping gene. Mice receiving 1MT-X31 were compared to Con-X31.
Influenza infection of MLE-15 and RAW264.7 cells. MLE-15 and RAW264.7 cells were
seeded onto a 24-well plate at 4.5x105 and 5x10
5 cells per well, respectively. The MLE-
15 cells were infected for one hour with the indicated MOI in MEM (Hyclone) with 0.3%
BSA Fraction V and 1 ug/ml TPCK-treated trypsin (Worthington, Lakewood, NJ). The
RAW264.7 cells were infected for one hour with indicated MOI in MEM with 1 ug/ml
TPCK-treated trypsin. Following infection, both cell types were rinsed three times with
PBS and appropriate infection media was added to the cells. RNA and supernatant was
collected at indicated time points.
175
qRT-PCR for peli1 and IDO1 gene expression. RNA was isolated at respective time-
points from samples using the RNeasy mini kit (Qiagen) following the manufacture’s
protocol and stored at -20C. Isolated RNA was DNase treated using DNase I
recombinant (Roche, Indianapolis, IN) following manufacture’s protocol. DNase treated
RNA was quantified using the Nanodrop 1000. cDNA was synthesized using Verso
cDNA kits (Thermo Scientific, Lafayette, CO) following the manufacture’s protocol
using equivalent concentrations of RNA for each experiment. The reaction was done at
42C for 30 min. qPCR was used to detect peli1 (Applied Biosystems, Foster City, CA).
The cycling times were 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 55°C
for 1 min, and 72°C for 1 min. qPCR was used to detect IDO1 (primers and probes:
Forward-GCACGACATAGCTACCAGTCT, Reverse-
CCACAAAGTCACGCATCCTCTTAA, Probe-5’-6FAM-AAAGCCAAGGAAATTT-
MGBNFQ-3’) and the cycling times were 95°C for 10 min, followed by 40 cycles of
95°C for 30 sec, 52°C for 1 min, and 68°C for 1 min. All samples were normalized to a
housekeeping gene, HPRT (Applied Biosystems). mRNA expression was determined
using the 2^(-ΔΔCt) method.
Isolation of murine alveolar macrophages (AM). Mice were treated 3 days prior to
infection with either 1MT or vehicle (control) water. On day 0, mice were infected with
103 PFU of X31 in PBS. Bronchoalveolar lavage (BAL) was collected 24 h post-
infection from uninfected or X31-infected mice by instillation of 1ml of PBS three times
in the lungs. Lung washes were maintained on ice or 4°C until processing. BAL cells
were centrifuged at 1500 x rpm for 8 min and resuspended in RPMI (Hyclone) with 10%
176
FBS and 1x antibiotics/antimycotics (Hyclone) (growth media). Adherent cells were
isolated by plastic adherence on a petri dish and incubated at 37°C with 5% CO2 for 3h.
Following incubation, the media was removed carefully and replaced with 2.5mM EDTA
in PBS for 5 min at 37°C to release the cells. Remaining adherent cells were released
using a cell lifter. Cells were centrifuged for 1500 x rpm for 8 min at 4°C and
resuspended in growth media. Cells were counted using a hemocytometer with trypan
blue exclusion. The same number of cells was plated for each group in growth media in a
48-well dish or used to phenotype the cellular population, as described below.
Supernatants were collected 48 h post-plating for pro-inflammatory cytokine response
analysis. Cells collected from 1MT treated mice were maintained in the presence of 1MT
(750uM; Sigma Aldrich) during the 3h incubation and for the 48h culture. Control cells
received molecular grade water in place of 1MT.
Quantification of pro-inflammatory cytokines. Protein concentrations were determined
from cell supernatant or BAL fluid (BALF). IL-6, IL-1β, and TNF-α concentrations were
determined using Ready-Set-Go ELISA kits (eBiosciences, San Diego, CA) following
manufacture’s protocol compared to a standard curve. Concentration of IFNβ was
determined using the VeriKine IFNβ ELISA kit (PBL Interferon Source, Piscataway, NJ)
following manufacture’s protocol compared to a standard curve.
Staining for AMs. Single cell suspensions from BAL were plated at the same number.
The cells were resuspended in staining wash buffer (SWB) (PBS + 1% BSA + 0.09%
NaN3) followed by incubation with Fc Block (BD Pharmingen, San Diego, CA) at 4C
177
for 15 min. Cells were then incubated with anti-CD45 (clone 30-F11), anti-CD11c (clone
HL3), and anti-Siglec-F (clone E50-2440) (BD Pharmingen) for 30 min at 4C. Cells
were rinsed with SWB and fix and permeabilized with the Foxp3
Fixation/Permeabilization solution (eBiosciences). The cells were rinsed with
Perm/Wash Buffer (BD Biosciences) and incubated with anti-CD68 (clone FA-11) (AbD
Serotec, Raleigh, NC) for 30 min at 4C. All samples were run on a LSRII flow
cytometer (BD Biosciences, San Jose, CA) and analyzed using FlowJo (Tree Star,
Ashland, OR). Isotype control antibodies were used to set gates for analysis.
Statistical analysis. Statistics were performed using GraphPad Prism Version 5.04 (La
Jolla, CA). Significance was assigned when the *p < 0.05, **p<0.01, ***p<0.001,
****p<0.0001 using either a student’s t-test or ANOVA with a Bonferroni post-hoc test,
as listed in the figure legends.
Results
1MT treatment augments pro-inflammatory cytokine expression during influenza
infection.
IDO inhibition during an acute influenza infection resulted in an enhanced Th1-
type and influenza virus-specific CD8 T cell response (16, 20). To better understand the
features that may have affected the adaptive immune response, the role of IDO activity
and modulation of the pro-inflammatory cytokine response was addressed, particularly
the inhibition of IDO activity during very early time points post- influenza infection.
Thus, mice were orally-treated with 1MT, a competitive inhibitor of IDO, or vehicle
178
water (control) for three days prior to intranasal infection with 103 PFU of X31. At 12
and 24 hours post-infection (hpi), RNA was isolated from lungs to evaluate the
expression of IDO1. There was no increase in the mRNA expression of IDO1 at 12 hpi
compared to uninfected controls; however, there was significant (p<0.05) increase of
IDO1 mRNA expression at 24 hpi compared to 12 hpi (Fig. 5.1A). IDO2 mRNA levels
were not altered in any of the lung samples (data not shown). There was also no
difference in IDO1 gene expression between 1MT and control treated mice (data not
shown).
IDO1 expression was increased at 24 hpi, thus the expression of pro-inflammatory
genes from the lungs of 1MT or control treated mice was determined at 24 hpi using a
Toll-like Receptor (TLR) array. In this assay, a substantial increase in gene expression
was assigned if the fold-change from 1MT treated mice compared to control treatment
was greater than 2. Mice treated with 1MT had significantly increased IL-6 (p<0.05) and
CD80 (p<0.001) gene expression compared to control treated mice (Table 1). Other
genes were up-regulated in 1MT treated mice including colony stimulating factor 3
(CSF3), interleukin-1β (IL-1β), interferon beta (IFNβ), prostaglandin-endoperoxide
synthase 2 (PTGS2; also known as COX-2), pellino1 (peli1), TNF-α induced protein 3
(TNFAIP3), Lymphotoxin A (LTA), TNF receptor-associated factor 6 (TRAF6), Toll-
like receptor 6 (TLR6), and Myeloid differentiation primary response gene 88 (MyD88)
(Table 1). Since 1MT treatment enhanced multiple pro-inflammatory cytokines as well as
TNF-α induced pathways compared to control treated mice, the concentration of the
cytokines (IL-6, TNF-α, IFNβ, and IL-1β) in the bronchoalveolar lavage (BAL) fluid
(BALF) of 1MT or control treated mice was determined at 48 hpi. 1MT treatment
179
significantly (p<0.01) increased the levels of IL-6, TNF-α, and IFNβ present in the BALF
compared to control treatment (Fig. 5.1B), a finding consistent with the PCR array data
(Table 1). There was no significant difference in the levels of IL-1β expression (Fig.
5.1B). These results show that 1MT treatment enhances the pro-inflammatory response
in the lung airways following influenza virus infection in mice.
1MT treatment and enhanced pro-inflammatory cytokine expression is mediated through
macrophages.
Since 1MT treatment during an influenza infection increased the cytokine
response, the cell types likely linked to enhanced cytokine expression were evaluated.
The immune cell types present in the lungs of naïve mice primarily consists of alveolar
macrophages (AMs) with a low percentage of pulmonary DCs and lymphocytes (28).
Influenza virus primarily replicates in alveolar epithelial cells stimulating an antiviral
response, but has been shown to minimally replicate in AMs, where infection in epithelial
or macrophage cell type induces a robust pro-inflammatory response (19, 33, 36).
Consequently, murine lung epithelial cells (MLE-15) and a mouse macrophage cell line
(Raw264.7) were evaluated for their cytokine responses following influenza virus
infection. Recent studies by others have shown the E3 ubiquitin ligase Pellino-1 (peli1)
to be an important adaptor molecule in TLR3 signaling (4) as well as mediating
interaction between IRAK4 and TRAF6 following IL-1β stimulation (24). Since the TLR
screen showed an increase in peli1 gene expression in 1MT treated mice compared to
control treatment and peli1 is associated with the other genes identified in the array
(Figure 5.2), peli1 expression was used as a marker for indicating a potential enhanced
180
cytokine response. MLE-15 cells or Raw264.7 cells were infected with X31 at varying
multiplicities of infection (MOI), and peli1 expression was assessed at 12 and 24 hpi.
There was no increase in peli1 expression in the MLE-15 cells following influenza virus
infection (Fig. 5.3A), suggesting that the epithelial cells are not likely the key cell types
mediating the enhanced pro-inflammatory response. However, there was a significant
increase in the expression of peli1 at 12 and 24 hpi in the Raw264.7 cells, peaking at 12
hpi (Fig. 5.3B) and the increase in gene expression was virus dependent as increased
MOIs increased the expression of peli1 (Fig. 5.3B).
As peli1 was up-regulated in Raw264.7 cells, the effect of 1MT treatment on the
cytokine response was determined. Raw264.7 cells were pretreated for 24h with 1MT,
followed by infection (MOI = 1) with X31. RNA was collected at 12 hpi to assess peli1
gene expression. There was no difference in the expression of peli1 with 1MT treatment
compared to control treated cells (Fig. 5.4A). Interesting, there was a significant increase
in the expression of peli1 in Raw264.7 cells that were treated with 1MT and not infected
(Fig. 5.4A) suggesting that peli1 gene expression may be linked to IDO1 expression. To
determine if increased levels of peli1 correlated with an enhanced pro-inflammatory
cytokine response, Raw 264.7 were pretreated with 1MT for 24h, and subsequently
infected (MOI = 1) with X31 to be compared with a mock-infected control. Cell
supernatants were collected 12 and 24 hpi and cytokine concentrations were evaluated
using ELISA. Consistent with the level of peli1 expression, there was a significant
(p<0.01) increase in the levels of IL-6 and TNF-α following 1MT treatment compared to
control treatment in mock infected cells (Fig. 5.4B). There was no detectable level of IL-
1β or IFNβ in mock infected supernatants (data not shown). At 12 hpi, 1MT treatment
181
was significantly associated with increased concentrations of IL-6 (p<0.01), TNF-α
(p<0.001), IFNβ (p< 0.01), and IL-1β (p<0.0001) compared to control treated cells (Fig.
5.4C). The significant increase in IL-6 (p<0.01), TNF-α (p<0.01), IFNβ (p<0.05), and
IL-1β (p<0.01) in 1MT treated compared to control treated Raw264.7 cells was also
observed at 24 hpi, although the overall levels of cytokine expression were lower (Fig.
5.4D). At 12 and 24 hpi there was no detectable level of IL-1β in control treated cells
(Fig. 5.4C and D), while the addition of 1MT induced high levels of IL-1β from influenza
virus infected cells at 12 and 24 hpi (Fig. 5.4C and D). The level of IDO1 mRNA
expression was evaluated by qRT-PCR. There was minimal IDO1 mRNA detected in
uninfected cells that gradually increased through the course of infection (Fig. 5.4E).
There were no significant differences in IDO1 expression between 1MT and control
treated cells at either time point. These results indicate that 1MT modulation of the pro-
inflammatory cytokine response is likely linked to the macrophage population.
Alveolar macrophages are responsible for enhanced TNF-α and IL-6 expression
Since the Raw264.7 cells showed increased cytokine expression with 1MT
treatment, it was important to confirm these results using primary mouse AMs. Mice
were treated with 1MT or control for 3 days prior to X31 infection. Twenty-four hours
post-infection, AM macrophages were harvested from the BAL by plastic adherence.
These adherent cells were phenotyped to determine the cell populations present where
AMs were phenotyped as CD45+CD68
hiCD11c
+ Siglec-F
+ as previously described (37,
45). Representative dot plots show that greater than 90% of the cells collected following
plastic adherence were CD45+ and of that population, almost 99% were of the alveolar
182
macrophage phenotype (Fig. 5.5A). Almost 100% of the adherent cells collected from
each group (1MT or control treatment and X31 infected or mock infected) were AMs
(Fig. 5.5B). There was no difference in the number of AMs between 1MT and control
treatment following plastic adherence with or without X31 infection (Fig. 5.5C).
Interestingly, AMs harvested from mice treated with 1MT and infected with X31 had
significantly increased levels of IL-6 and TNF-α in the supernatant compared to control
treated-X31 infected mice (Fig. 5.5D and E). There were no detectable levels of IFNβ or
IL-1β present with either treatment group (data not shown). These results help to confirm
that the AMs are in part linked to the enhanced pro-inflammatory cytokine response
following 1MT treatment.
Discussion
IDO has been associated with attenuating the immune response to infectious
diseases, including influenza virus infection, and modulation of IDO activity through
1MT administration has been shown to reverse the inhibitory effects of IDO and IDO
metabolites (10, 16, 29). This study shows an enhanced pro-inflammatory cytokine
response occurs in the presence of 1MT which appears to be partially mediated through
AMs. An interesting result was the minimal expression of IDO1 in uninfected cells and
small increase in expression following influenza infection (Fig. 5.1A and 5.4E). This
suggests that the increase in cytokine expression could be caused by an IDO1-
independent mechanism, i.e. a 1MT non-specific enhancement. Also of interest is the
finding that the IDO1-independent cytokine increase was only seen for IL-6 and TNF-α
expression. This may be the reason the levels of IL-1β and IFNβ were undetectable in
183
the ex vivo culture of the AMs, while dramatic increases in IL-6 and TNF-α were
observed with 1MT treatment (Fig. 5.5D and E). The time point evaluated following ex
vivo culture may have resulted in degradation of IL-1β and IFNβ in the absence of
stimuli, while IL-6 and TNF-α were maintained without stimuli.
The 1MT mediated modulation of the macrophage response over the epithelial
cell response correlated with the cytokines observed during the PCR array screen (Table
1). AMs are known to secrete high levels of TNF-α (36) and IL-1β (21) following
influenza virus infection, although somewhat lower levels of IL-1β were detected in this
study. An unexpected result was the lack of change in peli1 gene expression in the 1MT-
treated and influenza virus infected Raw264.7 cells compared to increased peli1 gene
expression in uninfected cell treated with 1MT treatment (Fig. 5.4A). The peli1 gene
encodes for Pellino 1, an E3 ubiquitin ligase, which is emerging as a critical effector
molecule during viral infections, including TLR3 stimulation (11) and during rhinovirus
infections (3). Pellino 1 is important for IL-1β signaling (24) and cytokine production,
including TNF-α and IFNβ, following TLR3 or TLR4 stimulation (Fig. 5.2) (4). The lack
of change in peli1 gene expression may be related to the kinetics of its induction.
Uninfected cells showed increase in peli1 expression suggesting that influenza virus
infection may down-regulate peli1, and because there was increased expression of peli1
gene expression with 1MT treatment, this effect is likely linked to IDO1 gene activity.
Inhibition of IDO through 1MT administration increased the secretion of IL-6 in
the BALF (Fig. 5.1B) and isolated AMs (Fig. 5.5B) from influenza infected mice, and in
influenza infected macrophage cell line (Fig. 5.4B-D). Besides being prominently
expressed in inflammatory environments and increasing recruit of neutrophils and
184
monocytes (35), IL-6 is a key mediator in the differentiation of CD4+ toward a Th17-
type pro-inflammatory response over a Treg response (27). IDO activity has been shown
to skew the immune response to a Treg phenotype and inhibition of IDO activity drives a
Th17 response through enhanced secretion of IL-6 (1). Although enhanced IL-6
secretion may be seen as potentially detrimental to the host, studies have shown that
increased IL-6 expression only has an effect on inducible Treg cells development with
little effect on natural Tregs (17). Furthermore, IL-6 is known to be important for the
resolution of influenza infection (9). These results show that AMs provide a role in the
modulation of the regulatory phenotype particularly in the lungs.
The results from this study identify a novel mechanism to enhance the pro-
inflammatory cytokine response using a pharmacological inhibitor of IDO, i.e. 1MT. The
addition of 1MT could be useful to boost vaccines with poor immune activation as the
presence of 1MT would improve cytokine induction. This study demonstrates the
connection between IDO activity and modulation of the immune response early following
influenza virus infections and shows potential usage of 1MT as a method to augment the
immune response for influenza vaccines.
Acknowledgements
We thank Elizabeth O’Connor for her help. This work was supported by the National
Institutes of Health U01 grant AI083005-01 and the Georgia Research Alliance.
185
References
1. Baban, B., P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H.
Munn, and A. L. Mellor. 2009. IDO activates regulatory T cells and blocks their
conversion into Th17-like T cells. J Immunol 183:2475-2483.
2. Bender, B. S., and P. A. Small, Jr. 1992. Influenza: pathogenesis and host
defense. Seminars in respiratory infections 7:38-45.
3. Bennett, J. A., L. R. Prince, L. C. Parker, C. A. Stokes, H. G. de Bruin, M.
van den Berge, I. H. Heijink, M. K. Whyte, and I. Sabroe. 2012. Pellino-1
selectively regulates epithelial cell responses to rhinovirus. J Virol 86:6595-6604.
4. Chang, M., W. Jin, and S. C. Sun. 2009. Peli1 facilitates TRIF-dependent Toll-
like receptor signaling and proinflammatory cytokine production. Nat Immunol
10:1089-1095.
5. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I.
Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like
receptor agonists induce a differential expression of type I and lambda interferons
in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol
34:796-805.
6. Conn, C. A., J. L. McClellan, H. F. Maassab, C. W. Smitka, J. A. Majde, and
M. J. Kluger. 1995. Cytokines and the acute phase response to influenza virus in
mice. The American journal of physiology 268:R78-84.
7. Cox, R. J., K. A. Brokstad, and P. Ogra. 2004. Influenza virus: immunity and
vaccination strategies. Comparison of the immune response to inactivated and
live, attenuated influenza vaccines. Scand J Immunol 59:1-15.
186
8. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.
Innate antiviral responses by means of TLR7-mediated recognition of single-
stranded RNA. Science 303:1529-1531.
9. Dienz, O., J. G. Rud, S. M. Eaton, P. A. Lanthier, E. Burg, A. Drew, J. Bunn,
B. T. Suratt, L. Haynes, and M. Rincon. 2012. Essential role of IL-6 in
protection against H1N1 influenza virus by promoting neutrophil survival in the
lung. Mucosal immunology 5:258-266.
10. Donovan, M. J., V. Tripathi, M. A. Favila, N. S. Geraci, M. C. Lange, W.
Ballhorn, and M. A. McDowell. 2012. Indoleamine 2,3-dioxygenase (IDO)
induced by Leishmania infection of human dendritic cells. Parasite Immunol
34:464-472.
11. Enesa, K., A. Ordureau, H. Smith, D. Barford, P. C. Cheung, J. Patterson-
Kane, J. S. Arthur, and P. Cohen. 2012. Pellino1 is required for interferon
production by viral double-stranded RNA. J Biol Chem 287:34825-34835.
12. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.
C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.
Cell Death Differ 9:1069-1077.
13. Fallarino, F., U. Grohmann, C. Vacca, C. Orabona, A. Spreca, M. C. Fioretti,
and P. Puccetti. 2003. T cell apoptosis by kynurenines. Adv Exp Med Biol
527:183-190.
14. Fallarino, F., C. Vacca, C. Orabona, M. L. Belladonna, R. Bianchi, B.
Marshall, D. B. Keskin, A. L. Mellor, M. C. Fioretti, U. Grohmann, and P.
187
Puccetti. 2002. Functional expression of indoleamine 2,3-dioxygenase by murine
CD8 alpha(+) dendritic cells. Int Immunol 14:65-68.
15. Fox, J. M., L. K. Sage, L. Huang, J. Barber, K. D. Klonowski, A. L. Mellor,
M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2, 3-
dioxygenase (IDO) enhances the T cell response to influenza virus infection. J
Gen Virol.
16. Fox, J. M., L. K. Sage, L. Huang, J. Barber, K. D. Klonowski, A. L. Mellor,
S. M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2,3-
dioxygenase enhances the T-cell response to influenza virus infection. J Gen Virol
94:1451-1461.
17. Fujimoto, M., M. Nakano, F. Terabe, H. Kawahata, T. Ohkawara, Y. Han, B.
Ripley, S. Serada, T. Nishikawa, A. Kimura, S. Nomura, T. Kishimoto, and
T. Naka. 2011. The influence of excessive IL-6 production in vivo on the
development and function of Foxp3+ regulatory T cells. J Immunol 186:32-40.
18. Hennet, T., H. J. Ziltener, K. Frei, and E. Peterhans. 1992. A kinetic study of
immune mediators in the lungs of mice infected with influenza A virus. J
Immunol 149:932-939.
19. Hofmann, P., H. Sprenger, A. Kaufmann, A. Bender, C. Hasse, M. Nain, and
D. Gemsa. 1997. Susceptibility of mononuclear phagocytes to influenza A virus
infection and possible role in the antiviral response. J Leukoc Biol 61:408-414.
20. Huang, L., L. Li, K. D. Klonowski, S. M. Tompkins, R. A. Tripp, and A. L.
Mellor. 2013. Induction and role of indoleamine 2,3 dioxygenase in mouse
models of influenza a virus infection. PLoS One 8:e66546.
188
21. Ichinohe, T., H. K. Lee, Y. Ogura, R. Flavell, and A. Iwasaki. 2009.
Inflammasome recognition of influenza virus is essential for adaptive immune
responses. J Exp Med 206:79-87.
22. Jewell, N. A., T. Cline, S. E. Mertz, S. V. Smirnov, E. Flano, C. Schindler, J.
L. Grieves, R. K. Durbin, S. V. Kotenko, and J. E. Durbin. 2010. Lambda
interferon is the predominant interferon induced by influenza A virus infection in
vivo. J Virol 84:11515-11522.
23. Jia, L., K. Schweikart, J. Tomaszewski, J. G. Page, P. E. Noker, S. A.
Buhrow, J. M. Reid, M. M. Ames, and D. H. Munn. 2008. Toxicology and
pharmacokinetics of 1-methyl-d-tryptophan: absence of toxicity due to saturating
absorption. Food Chem Toxicol 46:203-211.
24. Jiang, Z., H. J. Johnson, H. Nie, J. Qin, T. A. Bird, and X. Li. 2003. Pellino 1
is required for interleukin-1 (IL-1)-mediated signaling through its interaction with
the IL-1 receptor-associated kinase 4 (IRAK4)-IRAK-tumor necrosis factor
receptor-associated factor 6 (TRAF6) complex. J Biol Chem 278:10952-10956.
25. Julkunen, I., K. Melen, M. Nyqvist, J. Pirhonen, T. Sareneva, and S.
Matikainen. 2000. Inflammatory responses in influenza A virus infection.
Vaccine 19 Suppl 1:S32-37.
26. Julkunen, I., T. Sareneva, J. Pirhonen, T. Ronni, K. Melen, and S.
Matikainen. 2001. Molecular pathogenesis of influenza A virus infection and
virus-induced regulation of cytokine gene expression. Cytokine Growth Factor
Rev 12:171-180.
189
27. Kimura, A., and T. Kishimoto. 2010. IL-6: regulator of Treg/Th17 balance. Eur
J Immunol 40:1830-1835.
28. Kirby, A. C., J. G. Raynes, and P. M. Kaye. 2006. CD11b regulates recruitment
of alveolar macrophages but not pulmonary dendritic cells after pneumococcal
challenge. J Infect Dis 193:205-213.
29. Larrea, E., J. I. Riezu-Boj, L. Gil-Guerrero, N. Casares, R. Aldabe, P.
Sarobe, M. P. Civeira, J. L. Heeney, C. Rollier, B. Verstrepen, T. Wakita, F.
Borras-Cuesta, J. J. Lasarte, and J. Prieto. 2007. Upregulation of indoleamine
2,3-dioxygenase in hepatitis C virus infection. J Virol 81:3662-3666.
30. Le Goffic, R., J. Pothlichet, D. Vitour, T. Fujita, E. Meurs, M. Chignard, and
M. Si-Tahar. 2007. Cutting Edge: Influenza A virus activates TLR3-dependent
inflammatory and RIG-I-dependent antiviral responses in human lung epithelial
cells. J Immunol 178:3368-3372.
31. Matrosovich, M., T. Matrosovich, W. Garten, and H. D. Klenk. 2006. New
low-viscosity overlay medium for viral plaque assays. Virol J 3:63.
32. Onoguchi, K., M. Yoneyama, A. Takemura, S. Akira, T. Taniguchi, H.
Namiki, and T. Fujita. 2007. Viral infections activate types I and III interferon
genes through a common mechanism. J Biol Chem 282:7576-7581.
33. Rodgers, B. C., and C. A. Mims. 1982. Influenza virus replication in human
alveolar macrophages. Journal of medical virology 9:177-184.
34. Sanders, C. J., P. C. Doherty, and P. G. Thomas. 2010. Respiratory epithelial
cells in innate immunity to influenza virus infection. Cell Tissue Res.
190
35. Scheller, J., A. Chalaris, D. Schmidt-Arras, and S. Rose-John. 2011. The pro-
and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys
Acta 1813:878-888.
36. Seo, S. H., R. Webby, and R. G. Webster. 2004. No apoptotic deaths and
different levels of inductions of inflammatory cytokines in alveolar macrophages
infected with influenza viruses. Virology 329:270-279.
37. Stevens, W. W., T. S. Kim, L. M. Pujanauski, X. Hao, and T. J. Braciale.
2007. Detection and quantitation of eosinophils in the murine respiratory tract by
flow cytometry. J Immunol Methods 327:63-74.
38. Taylor, M. W., and G. S. Feng. 1991. Relationship between interferon-gamma,
indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J 5:2516-2522.
39. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I
interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol
23:307-336.
40. Tumpey, T. M., A. Garcia-Sastre, J. K. Taubenberger, P. Palese, D. E.
Swayne, M. J. Pantin-Jackwood, S. Schultz-Cherry, A. Solorzano, N. Van
Rooijen, J. M. Katz, and C. F. Basler. 2005. Pathogenicity of influenza viruses
with genes from the 1918 pandemic virus: functional roles of alveolar
macrophages and neutrophils in limiting virus replication and mortality in mice. J
Virol 79:14933-14944.
41. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-
gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via
indoleamine 2,3-dioxygenase. J Immunol 169:7039-7044.
191
42. Wichers, M. C., G. H. Koek, G. Robaeys, R. Verkerk, S. Scharpe, and M.
Maes. 2005. IDO and interferon-alpha-induced depressive symptoms: a shift in
hypothesis from tryptophan depletion to neurotoxicity. Molecular psychiatry
10:538-544.
43. Wijburg, O. L., S. DiNatale, J. Vadolas, N. van Rooijen, and R. A. Strugnell.
1997. Alveolar macrophages regulate the induction of primary cytotoxic T-
lymphocyte responses during influenza virus infection. J Virol 71:9450-9457.
44. Yeung, A. W., W. Wu, M. Freewan, R. Stocker, N. J. King, and S. R.
Thomas. 2012. Flavivirus infection induces indoleamine 2,3-dioxygenase in
human monocyte-derived macrophages via tumor necrosis factor and NF-kappaB.
J Leukoc Biol 91:657-666.
45. Zaynagetdinov, R., T. P. Sherrill, P. L. Kendall, B. H. Segal, K. P. Weller, R.
M. Tighe, and T. S. Blackwell. 2013. Identification of myeloid cell subsets in
murine lungs using flow cytometry. Am J Respir Cell Mol Biol 49:180-189.
192
Table 5.1. Genes differentially regulated post-X31 infection in 1MT-treatment compared
to Con-treatment in mouse lungs.
193
Figure 5.1. 1MT treatment enhances pro-inflammatory cytokines in lungs following
influenza infection with modest increase in IDO1 expression. Mice were pretreated with
1MT (2 mg/ml) or vehicle (con) water for 3 days prior to intranasal infection with 103
PFU of X31. (A) RNA was harvested from lungs at indicated time points and analyzed
for IDO1 mRNA expression by qRT-PCR. Samples were normalized to HPRT and
compared to control treated uninfected controls at respective time points. (B)
Concentration of indicated cytokines in the BALF at 48 hpi. Significance was assigned
using a student’s t-test. Graphs show the mean and standard deviation of representative
data from at least 2 independent experiments.
194
Figure 5.2. Interaction of genes identified in TLR array. VisANT was used to
determined protein interactions for genes up-regulated with 1MT treatment (red diamond)
with peli1 (blue diamond). Connections shown are representative of known protein
interactions of Homo sapiens since more data exists as compared to Mus musculus.
195
Hours Post-Infection
Rela
tive p
eli1 F
old
Ch
an
ge
12 24
0
2
4
6
8
10
MOI 0.5
MOI 0.1
Hours Post-Infection
Rela
tive p
eli1 F
old
Ch
an
ge
12 24
0
2
4
6
8
10MOI 0.5
MOI 1
**
****
****
*
***
A. B.
Figure 5.3. Increased peli1 expression is mediated through macrophages. (A) MLE-15
or (B) Raw264.7 cells were infected with X31 at indicated MOI. RNA was harvested at
12 and 24 hpi. Expression of peli1 was determined by qRT-PCR. Significance was
assigned using a one-way ANOVA. Samples were normalized to HPRT and compared to
control treated uninfected controls at respective time points. Graphs show the mean and
standard deviation of representative data from at least 2 independent experiments.
196
A. B.
C. D.
E.
Co
ncen
trati
on
(p
g/m
l)
IL-6
TNF-
IFN
IL-1
05
10100
200
300
400
500
2000400060008000
1MT
Con
**
***
**
****
Co
ncen
trati
on
(p
g/m
l)
IL-6
TNF-
IFN
IL-1
0
50
100
150
200
250
1500
3000
45001MT
Con
**
**
***
Co
ncen
trati
on
(p
g/m
l)
IL-6 TNF-0
5
10
1550
100
150
200
1000
2000
30001MT
Con
**
**
Hours Post-Infection
Rela
tive ID
O1 F
old
Ch
an
ge
UI 12 240
5
10
15
20
251MT
Con
Rela
tive p
eli1 F
old
Ch
an
ge
UI X31
0
2
4
6
8
101MT
Con
***
Figure 5.4. 1MT enhances pro-inflammatory cytokine expression. Raw264.7 cells were
pretreated with 1MT or control for 24h followed by infection with X31 (MOI = 1). (A)
RNA was collected 12 hpi and expression of peli1 was assessed by qRT-PCR. (B-E)
Cytokine levels were determined using an ELISA for (B) uninfected cells, (C) 12 hpi, or
(D) 24 hpi. Significance was assigned using a student’s t-test. (E) RNA was harvested at
indicated time points and expression of IDO1 was evaluated using qRT-PCR. Samples
were normalized to HPRT and compared to control treated uninfected controls at
197
respective time points. Graphs show the mean and standard deviation of representative
data from at least 2 independent experiments.
198
Mock X310
50
100
1501MT
Con
% A
lveo
lar
macro
ph
ag
es
of
CD
45+
cells
Mock X310
2100 4
4100 4
6100 4
8100 4
1MT
Con
Cell
Nu
mb
er
of
CD
45+
cells
A.
B. C.
D. E.
TN
F-
co
ncen
trati
on
(p
g/m
l)
Mock X31
0
50
100
150
200
2501MT
Con
*
IL-6
co
ncen
trati
on
(p
g/m
l)
Mock X31
0
20
40
601MT
Con
*
Figure 5.5. 1MT treatment enhances alveolar macrophage secretion of TNF-α and IL-6.
Mice were pretreated with 1MT (2 mg/ml) or vehicle (con) water for 3 days prior to
intranasal infection with 103 PFU of X31 or mock infected. Alveolar macrophages were
isolated from BAL collected 24h post-infection. (A) Representative dot plots of the
isolated cell population from BAL. (B) Percentage and (C) frequency of the alveolar
199
macrophage population isolated from the BAL. (D-E) Isolated alveolar macrophages
were cultured for an additional 48h and levels of (D) IL-6 or (E) TNF-α were evaluated
in the supernatant through ELISA. Graphs show the mean and standard error mean from
results of 2 independent experiments.
200
CHAPTER 6
DEVELOPMENT OF A NOVEL METHOD TO INDUCIBLY SILENCE IDO1
ACTIVITY4
4Fox, J.M., E.R. O’Connor, S.M. Tompkins, R.A. Tripp. To be submitted to Virology.
201
Abstract
Indoleamine 2, 3-dioxygenase (IDO) is rapidly emerging as a key player in
dampening the immune response to pathogens. Two models are accepted to study the
effects of IDO abolition in vitro and in vivo: IDO1 -/- mice and administration of
pharmacological inhibitors, e.g. 1-methyl-tryptophan (1MT). Both methods have
advantages and disadvantages in the efficacy related to the temporal inhibition of IDO
activity; however, a method that has the gene silencing efficacy of IDO -/- mice with
conditional expression would be advantageous to studying the impact of IDO on the
immune response. In this study, a lentiviral vector expressing an inducible short hairpin
RNA (shRNA) targeting IDO1 (shIDO1) was developed and transduced into MLE-15
cells. Following IDO induction through recombinant IFNγ stimulation, IDO1 mRNA
expression and activity was reduced to un-stimulated levels. These results provide the
framework for applying the lentiviral vector to a mouse model and producing a shIDO1
inducible in vivo system.
202
Introduction
Indoleamine 2, 3-dioxygenase (IDO) is an immunosuppressive enzyme in the
kynurenine pathway that catabolizes tryptophan (trp) into kynurenine (kyn) (8). Testing
the effects of IDO requires the blockade of IDO activity either genetically or
pharmacologically (1, 7, 10). Correspondingly, two IDO proteins, IDO1 and IDO2, can
metabolize trp making it difficult to determine the particular enzyme having the great
catabolic effect on trp (17, 21, 22). One method to inhibit IDO activity is through
administration of 1-methyl-tryptophan (1MT), a competitive inhibitor of IDO (5, 23, 24).
1MT is typically provided to animals via drinking water or by pellet implantation, and is
efficacious for IDO inhibition in cell culture (2, 10, 19). Another option to
pharmacological inhibition in vivo is the use of IDO1 -/- mice (28). 1MT, although
effective, has drawbacks because water consumption may decrease during infectious
disease studies, thus affecting the uptake of the compound as well. Alternatively, IDO -/-
mice may have irregularities in the development of their immune system, and these mice
lack the ability to inducibly silence IDO.
In this study, a lentiviral vector containing a tetracycline-controlled expression
system encoding a short hairpin RNA (shRNA) targeting the IDO1 gene was produced
and evaluated. IDO1 was targeted based on earlier findings that showed IDO1 to be
predominantly expressed over IDO2 during influenza virus infections (specific aim 2).
The lentiviral system involves transfecting HEK293T cells with a plasmid encoding the
shRNA of interest in addition to a mix of 5 plasmids to produce the lentivirus (25). The
lentivirus can then be used to transduce cell lines or administered in vivo. The lentiviral
vector has broad tropism and can infect and replicate in dividing and non-dividing cells
203
and integrates the shRNA construct into the host genome (27). As the packaging
plasmids that are transfected are reliant on each other for expression, and the structural
genes are not included in the viral genome, there is reduced risk of recombination
between plasmids and thus a replication incompetent virus (13). The lentiviral particles
were used to transduce mouse lung epithelial cells (MLE-15) to evaluate efficacy of
IDO1 gene silencing. In vitro experiments using doxycycline-induced lentivirus
transduced MLE-15 cells showed almost complete reduction in IDO activity. This
reduction in activity was able to be reversed and showed rapid expression following
doxycycline administration. This work provides the basis to test the shRNA targeting
IDO1 (shIDO1) construct for IDO silencing in mice to eventually producing an inducible
shIDO1 knock-in mouse or in vivo cell specific IDO1 silencing.
Material and Methods
Cell culture. MLE-15 cells were maintained in HITES media [RMPI 1640 media
(Cellgro, Manassas, VA) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis, MO),
10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1% ITS
(insulin-transferring-selenium; Gibco)] with 4% FBS. HEK293T were maintained in
DMEM with 5% FBS.
Transfer for shIDO1 construct to inducible vector and lentivirus propagation. shIDO1
construct (hairpin sequence:
TGCTGTTGACAGTGAGCGATCCGTGAGTTTGTCATTTCAATAGTGAAGCCACA
GATGTATTGAAATGACAAACTCACGGACTGCCTACTGCCTCGGA; mature
204
sense: CCGTGAGTTTGTCATTTCA; mature antisense:
TGAAATGACAAACTCACGG) was obtained in the pGIPZ backbone (constitutive
expression of construct) (Open Biosystems; Thermo Scientific, Pittsburgh, PA) in E.coli
and grown on LB-Lennox agar plates supplemented with ampicillin (100ug/ml) (Fisher
BioReagents, Pittsburgh, PA) and zeocin (25ug/ml) (Invivogen, San Diego, CA).
Isolated colonies were grown in 2x-Lennox Broth (VWR, Radnor, PA) supplemented
with ampicillin. The plasmids were purified and size verified on a 1% agarose gel
following digestion with SalI [New England BioLabs (NEB), Ipswich, MA]. The
shIDO1 construct and empty pTRIPZ (doxycycline-inducible plasmid) vector were
digested using MluI and XhoI and gel purified. The 345 bp shRNA insert was ligated to
the digested pTRIPZ using T4 DNA ligase (NEB) following the manufacturer’s protocol.
The ligated construct was transformed into PrimePlus E. coli (Open Biosystems)
following manufacturer’s protocol and plated on Lennox agar plates supplemented with
amplicillin and zeocin. Colonies were isolated and grown in 2x Lennox broth with
ampicillin, purified, and shRNA insert was sequence verified. shNEG construct (non-
targeting control; Open Biosystems) was obtained in the pTRIPZ backbone. The shNEG
and shIDO1 lentiviruses were produced according to manufacturer’s protocol using
arrest-in on HEK293T cells. Supernatant was collected 72 h post-transfection,
concentrated using the Fast-Trap Lentivirus Purification and Concentration Kit
(Millipore, Billerica, MA). Viral titers were determined on HEK293T cells in the
presence of doxycycline hydrochloride (doxycycline; 1ug/ml; Fisher BioReagents) as
described by the manufacturer.
205
Transduction of MLE-15 cells with shRNA constructs. MLE-15 cells were plated in a 24-
well dish at 2x105 cells/well and infected with the shIDO1 or shNEG lentivirus for 6 h
followed by addition of normal growth media. The following day, doxycycline (1ug/ml)
was added to cells to induce shRNA insert. Two days later, media was changed to
growth media containing doxycycline (1ug/ml) and puromycin (7.5ug/ml; Invitrogen,
Pittsburgh, PA) for selection of transduced cells. The appropriate concentration of
puromycin was determined by a dose kill curve on MLE-15 cells (data not shown).
Media was changed every 2-3 days and passaged into larger flasks when confluent.
Transduced cells were sorted using FACSAria (BD Biosciences, San Jose, CA) collecting
the top 10% of RFP fluorescencing cells. Clonal cell populations were used for in vitro
studies. Transduced cells were maintained in growth media containing doxycycline and
puromycin. Fluorescent images were taken using the EVOS Fluorescent Cell Imaging
System (Life Technologies, Carlsbad, CA).
Validation of IDO1 knock-down in transduced cells. Transduced and parental MLE-15
cells were plated in a 24-well dish at 4.5x105 cells/well. Cells were stimulated with
recombinant mouse IFNγ (rIFNγ; Pierce, Rockford, IL) at 10ng/ml in growth media
without phenol red. Transduced cells are stimulated in the same media with the addition
of doxycycline and puromycin. Twenty-four hours post stimulation, L-trp (50uM)
(Sigma Aldrich) was added to each well. The following day supernatant was collected
and stored at -20°C. RNA was harvested using the RNeasy mini kit (Qiagen, Valencia,
CA) and stored at -20°C. The supernatant was used to determine IDO activity using the
kynurenine (kyn) colorimetric assay. Briefly, proteins were removed by addition of 30%
206
tricholoracetic acid (TCA; VWR) and incubated at 50°C for 30 min to hydrolyze n-
formylkynurenine to kyn. Samples were then centrifuged at 2400 rpm for 10 min at 4°C.
Supernatants were incubated with Erlich’s reagent for 10 min. Absorbance was read at
490nm using an Epoch microplate reader (BioTek, Winooski, VT). Concentration of kyn
was determined using a kyn colorimetric assay with a standard curve of kyn (Sigma-
Aldrich). IDO1 mRNA expression was determined by qRT-PCR, as described below.
To determine the amount of time needed for shIDO1 induction following doxycycline
treatment, transduced cells were cultured in the absence of doxycycline until IDO activity
assay was not significant between the groups (data not shown). Doxycycline (1ug/ml)
was added to the cells at varying times prior to rIFNγ stimulation.
qPCR for detection of IDO1 mRNA. RNA was isolated at respective time-points from
samples using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol and
stored at -20C. Isolated RNA was DNase treated using DNase I recombinant (Roche,
Indianapolis, IN) following manufacturer’s protocol. DNase treated RNA was quantified
using the Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was synthesized
using the Verso cDNA kits (Thermo Scientific, Lafayette, CO) following the
manufacturer’s protocol using equivalent concentrations of RNA for each experiment.
The reaction was done at 42C for 30 min. qPCR was used to detect IDO1 (Forward-
GCACGACATAGCTACCAGTCT, Reverse- CCACAAAGTCACGCATCCTCTTAA,
Probe-5’-6FAM-AAAGCCAAGGAAATTT-MGBNFQ-3’). The cycling time was 95°C
for 10 min, followed by 40 cycles of 95°C for 30 sec, 52°C for 1 min, and 68°C for 1
207
min. All samples were normalized to a housekeeping gene, HPRT (Applied Biosystems,
Foster City, CA). mRNA expression was determined using the 2^(-ΔΔCt) method.
Results
MLE-15 cells transduced with shIDO1 effectively silence IDO1 expression and activity.
MLE-15 cells were transduced with either shIDO1 or shNEG constructs using a
lentiviral vector and sorted based on the intensity of RFP expression (data not shown).
MLE-15 cells containing the shIDO1 or shNEG construct showed RFP expression
compared to the parental cells, which is indicative of induction of the construct (Fig.
6.1A). IFNγ is a strong stimulator of IDO activity and is an appropriate measure of the
shRNA efficacy (3, 11). To validate the effectiveness of the shRNA targeting IDO1
expression, transduced and parental MLE-15 cells were stimulated with recombinant
IFNγ (rIFNγ) and the expression and activity of IDO was analyzed. IDO activity is
determined by quantifying the concentration of kyn, i.e. IDO metabolite present in the
cell culture supernatant. Following stimulation, the shIDO1 transduced cells had
significantly reduced IDO1 mRNA expression compared to shNEG cells and parental
cells (Fig. 6.1B). More importantly, there was a significant reduction in the amount of
kyn present in the supernatant of stimulated shIDO1 transduced cells compared to
stimulated control cells (Fig. 6.1C). There was no significant difference between
stimulated shIDO1 transduced cells and unstimulated MLE-15 showing that the IDO1
shRNA is able to reduce IDO activity to background levels (Fig. 6.1C). These results
demonstrate that the shIDO1 construct can efficiently silence IDO1 gene expression and
activity following stimulation with a potent activator.
208
Doxycycline induction of shIDO1.
Since the shRNA constructs are inducible through doxycycline, it was important
to evaluate the time-course following doxycycline induction that was required for
efficient IDO1 silencing. The transduced cells were removed from doxycycline and
puromycin for multiple passages until there was no significant difference of IDO activity
between the two groups following rIFNγ stimulation (data not shown). Doxycycline was
added to transduced cells at 4, 3, 2, 1, or 0 days prior to rIFNγ stimulation (Fig. 6.2).
RFP expression was observed 1 day following doxycycline induction, but achieved
maximal fluorescence by 3 days post induction (Fig. 6.2A). On Day 0 (D0), transduced
cells were stimulated with rIFNγ and IDO activity was evaluated 48 h post-stimulation.
As expected for RNAi-mediated processes, there was not complete knock-down of IDO
activity, although induction of shIDO1 at least 2 days prior to stimulation (D-2)
significantly reduced the amount of kyn present in the cell culture supernatant as
compared to no doxycycline treated controls (none) (Fig 6.2B). These results show that
the shIDO1 and shNEG constructs are inducible but require extended culturing in
doxycycline to achieve a high level of gene silencing.
Discussion
IDO is emerging as an important player in immunity during infection (1, 9, 14,
18). Although several methods are available to inhibit IDO activity, these approaches
lack the ability to induce silencing and lack and often lack substantial efficacy (6, 24).
The use of a doxycycline-inducible shRNA method to silence IDO1 expression provides
efficient gene silencing allowing for evaluation of the effects of temporal IDO
209
expression. Furthermore, these results provide proof-of-concept that lentiviral vectors
may be used to proceed with in vivo IDO1 silencing essentially generating IDO1 -/- mice.
Although the shIDO1 construct reduced IDO mRNA expression and activity to
unstimulated levels, transduction with the shNEG construct also reduced the expression
and activity of IDO1 (Fig. 6.1B & C). This reduction is likely due to excessive amounts
of non-specific siRNA present from prolonged induction because removal of doxycycline
and short-term induction showed no reduction in IDO activity following stimulation as
compared to shIDO1 induced cells (Fig. 6.2B). Following lentiviral infection, the
shRNA construct is integrated into the genome and is synthesized and processed
following the same pathway as microRNAs (miRNA) (20). The shRNA is initially
cleaved by Drosha producing a precursor-shRNA (pre-RNA) that contains a 3’ nucleotide
overhang (15). The pre-RNA is exported from the nucleus via exportin-5 and processed
by Dicer to cleave the hairpin structure producing a siRNA duplex (16, 29). The guide
strand is incorporate into the RNA-induced silencing complex (RISC) to achieve mRNA
silencing (12). The shRNA constructs used for these studies mirror the hairpin structure
of miR-30 to enhance shRNA processing and contain a destabilized 5’ end of the
passenger strand in the final siRNA duplex to better direct the guide strand into RISC,
which should reduce the amount of off-target effects (4, 26). However, the construct
might be overwhelming the RNAi machinery and have indirect off-target effects through
reduced cellular regulation via normal miRNA expression (20).
Finally, there was a gradual reduction in IDO activity when initially inducing the
shRNA construct (Fig. 6.2B). These results suggest that either the induction of shRNA is
not rapid or that the method of IDO1 stimulation (i.e. rIFNγ) was too robust to
210
dramatically reduce IDO activity after only a limited doxycycline induction time. While
this lag is apparent in vitro, this does not necessarily translate to induction times in vivo.
These experiments would need to be tested and optimized for in vivo analysis.
Overall these studies provide the initial results for shRNA lentiviral production
and construct validation. This is the first step to proceed with in vivo delivery
optimization and verification of IDO1 silencing. The in vivo model will be useful not
only in infectious disease research but also in cancer and autoimmune studies in
determining the effects and timing of IDO activity in a mouse model system.
Acknowledgements
We thank Elizabeth O’Connor and Nisarg Patel for their help. This work was supported
by the National Institutes of Health U01 grant AI083005-01.
References
1. Bennett, J. A., L. R. Prince, L. C. Parker, C. A. Stokes, H. G. de Bruin, M.
van den Berge, I. H. Heijink, M. K. Whyte, and I. Sabroe. 2012. Pellino-1
selectively regulates epithelial cell responses to rhinovirus. J Virol 86:6595-6604.
2. Beutelspacher, S. C., P. H. Tan, M. O. McClure, D. F. Larkin, R. I. Lechler,
and A. J. George. 2006. Expression of indoleamine 2,3-dioxygenase (IDO) by
endothelial cells: implications for the control of alloresponses. Am J Transplant
6:1320-1330.
211
3. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine
dioxygenase by interferon in mice: a study with different recombinant interferons
and various cytokines. Biochem Biophys Res Commun 152:237-242.
4. Boden, D., O. Pusch, R. Silbermann, F. Lee, L. Tucker, and B. Ramratnam.
2004. Enhanced gene silencing of HIV-1 specific siRNA using microRNA
designed hairpins. Nucleic Acids Res 32:1154-1158.
5. Cady, S. G., and M. Sono. 1991. 1-Methyl-DL-tryptophan, beta-(3-
benzofuranyl)-DL-alanine (the oxygen analog of tryptophan), and beta-[3-
benzo(b)thienyl]-DL-alanine (the sulfur analog of tryptophan) are competitive
inhibitors for indoleamine 2,3-dioxygenase. Arch Biochem Biophys 291:326-333.
6. Dunham, R. M., S. N. Gordon, M. Vaccari, M. Piatak, Y. Huang, S. G.
Deeks, J. Lifson, G. Franchini, and J. M. McCune. 2013. Preclinical evaluation
of HIV eradication strategies in the simian immunodeficiency virus-infected
rhesus macaque: a pilot study testing inhibition of indoleamine 2,3-dioxygenase.
AIDS Res Hum Retroviruses 29:207-214.
7. Eleftheriadis, T., G. Pissas, A. Karioti, G. Antoniadi, V. Liakopoulos, K.
Dafopoulou, S. Pournaras, G. Koukoulis, and I. Stefanidis. 2012. The
Indoleamine 2,3-dioxygenase Inhibitor 1-methyl-tryptophan Suppresses
Mitochondrial Function, Induces Aerobic Glycolysis and Decreases Interleukin-
10 Production in Human Lymphocytes. Immunol Invest.
8. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.
C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.
Cell Death Differ 9:1069-1077.
212
9. Favre, D., J. Mold, P. W. Hunt, B. Kanwar, P. Loke, L. Seu, J. D. Barbour,
M. M. Lowe, A. Jayawardene, F. Aweeka, Y. Huang, D. C. Douek, J. M.
Brenchley, J. N. Martin, F. M. Hecht, S. G. Deeks, and J. M. McCune. 2010.
Tryptophan catabolism by indoleamine 2,3-dioxygenase 1 alters the balance of
TH17 to regulatory T cells in HIV disease. Sci Transl Med 2:32ra36.
10. Fox, J. M., L. K. Sage, L. Huang, J. Barber, K. D. Klonowski, A. L. Mellor,
S. M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2,3-
dioxygenase enhances the T-cell response to influenza virus infection. J Gen Virol
94:1451-1461.
11. Fujigaki, S., M. Takemura, H. Hamakawa, M. Seishima, and K. Saito. 2003.
The mechanism of interferon-gamma induced anti Toxoplasma gondii by
indoleamine 2,3-dioxygenase and/or inducible nitric oxide synthase vary among
tissues. Adv Exp Med Biol 527:97-103.
12. Gregory, R. I., T. P. Chendrimada, N. Cooch, and R. Shiekhattar. 2005.
Human RISC couples microRNA biogenesis and posttranscriptional gene
silencing. Cell 123:631-640.
13. Kappes, J. C., X. Wu, and J. K. Wakefield. 2003. Production of trans-lentiviral
vector with predictable safety. Methods in molecular medicine 76:449-465.
14. Larrea, E., J. I. Riezu-Boj, L. Gil-Guerrero, N. Casares, R. Aldabe, P.
Sarobe, M. P. Civeira, J. L. Heeney, C. Rollier, B. Verstrepen, T. Wakita, F.
Borras-Cuesta, J. J. Lasarte, and J. Prieto. 2007. Upregulation of indoleamine
2,3-dioxygenase in hepatitis C virus infection. J Virol 81:3662-3666.
213
15. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O.
Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates
microRNA processing. Nature 425:415-419.
16. Lee, Y. S., K. Nakahara, J. W. Pham, K. Kim, Z. He, E. J. Sontheimer, and
R. W. Carthew. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the
siRNA/miRNA silencing pathways. Cell 117:69-81.
17. Maiwald, S., R. Wehner, M. Schmitz, M. Bornhauser, S. Loeb, and R.
Wassmuth. 2011. IDO1 and IDO2 gene expression analysis by quantitative
polymerase chain reaction. Tissue Antigens 77:136-142.
18. Makala, L. H., B. Baban, H. Lemos, A. R. El-Awady, P. R. Chandler, D. Y.
Hou, D. H. Munn, and A. L. Mellor. 2011. Leishmania major attenuates host
immunity by stimulating local indoleamine 2,3-dioxygenase expression. J Infect
Dis 203:715-725.
19. Maneglier, B., C. Rogez-Kreuz, O. Spreux-Varoquaux, B. Malleret, P.
Therond, B. Samah, I. Drouet, D. Dormont, C. Advenier, and P. Clayette.
2007. Comparative effects of two type I interferons, human IFN-alpha and ovine
IFN-tau on indoleamine-2,3-dioxygenase in primary cultures of human
macrophages. Fundamental & clinical pharmacology 21:29-34.
20. Manjunath, N., H. Wu, S. Subramanya, and P. Shankar. 2009. Lentiviral
delivery of short hairpin RNAs. Adv Drug Deliv Rev 61:732-745.
21. Meininger, D., L. Zalameda, Y. Liu, L. P. Stepan, L. Borges, J. D. McCarter,
and C. L. Sutherland. 2011. Purification and kinetic characterization of human
214
indoleamine 2,3-dioxygenases 1 and 2 (IDO1 and IDO2) and discovery of
selective IDO1 inhibitors. Biochim Biophys Acta 1814:1947-1954.
22. Metz, R., J. B. Duhadaway, U. Kamasani, L. Laury-Kleintop, A. J. Muller,
and G. C. Prendergast. 2007. Novel tryptophan catabolic enzyme IDO2 is the
preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase
inhibitory compound D-1-methyl-tryptophan. Cancer Res 67:7082-7087.
23. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B.
Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal
rejection by tryptophan catabolism. Science 281:1191-1193.
24. Murakami, Y., M. Hoshi, A. Hara, M. Takemura, Y. Arioka, Y. Yamamoto,
H. Matsunami, T. Funato, M. Seishima, and K. Saito. 2012. Inhibition of
increased indoleamine 2,3-dioxygenase activity attenuates Toxoplasma gondii
replication in the lung during acute infection. Cytokine 59:245-251.
25. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M.
Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of
nondividing cells by a lentiviral vector. Science 272:263-267.
26. Silva, J. M., M. Z. Li, K. Chang, W. Ge, M. C. Golding, R. J. Rickles, D.
Siolas, G. Hu, P. J. Paddison, M. R. Schlabach, N. Sheth, J. Bradshaw, J.
Burchard, A. Kulkarni, G. Cavet, R. Sachidanandam, W. R. McCombie, M.
A. Cleary, S. J. Elledge, and G. J. Hannon. 2005. Second-generation shRNA
libraries covering the mouse and human genomes. Nat Genet 37:1281-1288.
215
27. Wu, X., J. K. Wakefield, H. Liu, H. Xiao, R. Kralovics, J. T. Prchal, and J. C.
Kappes. 2000. Development of a novel trans-lentiviral vector that affords
predictable safety. Mol Ther 2:47-55.
28. Xu, H., T. B. Oriss, M. Fei, A. C. Henry, B. N. Melgert, L. Chen, A. L.
Mellor, D. H. Munn, C. G. Irvin, P. Ray, and A. Ray. 2008. Indoleamine 2,3-
dioxygenase in lung dendritic cells promotes Th2 responses and allergic
inflammation. Proc Natl Acad Sci U S A 105:6690-6695.
29. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the
nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development
17:3011-3016.
216
Figure 6.1. Transduced MLE-15 cells sufficiently knock down the mRNA expression
and activity of IDO1. (A) RFP expression of parental and transduced cells (10x). (B)
Cells were stimulated with recombinant IFNγ (rIFNγ) for 24h. IDO1 expression was
determined by qRT-PCR. All samples were normalized to HPRT and compared to MLE-
15 unstimuated (US). (C) Cells were stimulated with rIFNγ for 48h. IDO activity was
determined using the kyn colorimetric assay. A one-way ANOVA was used to assign
significance (***p < 0.001); no significance (ns).
217
Figure 6.2. shRNA is gradually produced following doxycycline induction. (A) RFP
expression at indicated time points following addition of doxycycline at D-4 pre-
stimulation for each transduced cell line (10x). (B) Cells were induced with doxycycline
at indicated time prior to stimulation. At D0, cells were stimulated with recombinant
IFNγ (rIFNγ) for 48h. IDO activity was determined using the kyn colorimetric assay. A
one-way ANOVA was used to assign significance (*p < 0.05).
218
CHAPTER 7
CONCLUSIONS
Influenza virus remains a worldwide concern and a threat for pandemics.
Vaccines are available but rely primarily on production of neutralizing antibodies against
the HA protein with no consideration of the memory T cell response. Since influenza
virus is constantly undergoing antigenic drift, the current vaccine provides limited
heterologous virus protection which necessitates yearly vaccination for newly circulating
strains. T cells recognize conserved internal proteins of influenza virus rather than the
highly variable surface glycoproteins; therefore, enhancement of the T cell response
during vaccination could increase protection from heterologous virus challenge.
Indoleamine 2, 3-dioxygenase (IDO) has been associated with suppression of the immune
response, particularly the T cell response, through depletion of tryptophan (trp) and
production of kynurenine (kyn) metabolites. Modulation of IDO activity may be an
approach to enhance the T cell response to influenza virus vaccination. The experiments
in these studies examine the various roles of IDO during primary influenza virus
infection to determine the mechanisms of IDO immune modulation and the potential for
enhancing the immune response to vaccination. The central hypothesis of these studies is
that IDO activity during influenza infection results in suppressed innate and adaptive
immune responses in part through the reduction of pro-inflammatory cytokine
219
expression, a feature that negatively affects the magnitude of the T cell response. The
specific aims addressed were:
Specific aim 1. To determine the activity and role of IDO in the frequency and activation
of CD8+ and CD4+ T cells responding to acute influenza virus infection. The working
hypothesis is that inhibition of IDO during an influenza virus infection will enhance the
Th1 response and frequency of influenza virus-specific CD8+ T cells. The results in
Chapter 3 show that IDO is responsible for dampening the influenza specific CD8+ T cell
and CD4+ T cell response during influenza virus infection. In these studies, IDO activity
was blocked in vivo through oral administration of 1-methyl-D, L-tryptophan (1MT) and
mice were infected intranasally with influenza virus. IDO activity was assessed by
HPLC analysis for detection of trp and kyn. Cell populations and their activation status
were analyzed by flow cytometry. IDO activity peaked at day 10 post-infection during
an influenza virus infection. Inhibition of IDO during infection enhanced the proportion
of IL-6 and IFNγ expressing CD4+ T cells and the number of activated influenza specific
CD8+ T cells compared to control treated mice in the lung airways. Further, in the
absence of IDO activity, there was an increase in the frequency of CD8+ effector
memory cells. This study shows IDO mediated T cell modulation during an influenza
virus infection and a mechanism to enhance the T cell response.
Specific aim 2. To evaluate the induction and role of IDO expression by alveolar
epithelial cells during influenza virus infection. The working hypothesis is that IFNλ is
up-regulated during influenza virus infection inducing the expression and activity of IDO
220
in alveolar epithelial cells. The data from Chapter 4 show that IDO is induced by
influenza virus in airway epithelial cells and this induction is partially mediated by IFNλ
stimulation. In this study, mouse lung epithelial (MLE-15) cells, human bronchial
epithelial cells (Beas2B), and fully differentiated normal human bronchial epithelial
(NHBE) cells were used to examine IDO activity and its role during infection. IDO
activity was evaluated through detection of kyn in the cell culture supernatant using a kyn
colorimetric assay, and IDO1/2 gene expression was assessed through qRT-PCR.
Influenza virus infection preferentially up-regulates IDO1 over IDO2, and increases IDO
activity in a virus-dependent manner. Furthermore, kynurenine was found to be secreted
basolaterally from influenza infected NHBE cells. Following infection, IFNλ was
increased with low expression of IFNα which correlated with IDO1 expression. IDO
activity was directly induced following IFNλ stimulation in a dose-dependent manner.
Silencing IFNλ expression with siRNA or neutralizing antibodies reduced the expression
of IDO1 compared to untreated cells. Finally inhibition or silencing of IDO activity
following influenza infection resulted in reduced viral titers. This study shows a novel
role for IFNλ in the induction of IDO1 and basal secretion of kyn following influenza
virus infection.
Specific aim 3. To evaluate the effects of IDO on expression of pro-inflammatory
cytokines during influenza virus infection and determine the host cell types affected. The
working hypothesis is that IDO inhibition through 1MT treatment increases the
expression of pro-inflammatory cytokines in alveolar macrophages. The results from
Chapter 5 show that 1MT treatment enhances the pro-inflammatory cytokine response
221
prior and during influenza virus infection by macrophages. The initial screen using a
TLR PCR array to evaluate modulation of genes associated with TLR signaling pathways
showed that 1MT treatment enhanced IL-6, IL-1β, and IFNβ gene expression as well as
TNF-α, IL-1β, and TLR3 associated signaling pathways. The increase in gene expression
correlated with enhanced protein levels of IL-6, IFNβ, and TNF-α in the BAL fluid of
1MT treated mice. Further evaluation using immortalized cell lines and primary murine
alveolar macrophages revealed that 1MT modulated pro-inflammatory cytokine
expression by macrophages. This increase in the presence of 1MT occurred with or
without infection, suggesting a level of IDO independent modulation of the pro-
inflammatory response. These studies show a role of 1MT-mediated enhancement of
inflammatory cytokines particularly through macrophage stimulation.
Specific aim 4. To produce and evaluate the efficacy of a lentiviral vector expressing a
doxycycline-inducible shRNA against IDO1. The working hypothesis is that transduction
using a lentiviral vector containing a shRNA against IDO1 (shIDO1) will effectively
silence IDO1 expression and activity in vitro. The results from Chapter 6 show that a
lentiviral vector expressing a shRNA targeting IDO1 can effectively silence IDO1
expression and activity following stimulation of the cells with a potent IDO1 inducer,
IFNγ. These studies were performed using a mouse lung epithelial (MLE-15) cell line to
translate the approach to in vivo studies. mRNA expression and activity were assessed
by qRT-PCR and kyn colorimetric assay, respectively. The shIDO1 construct efficiently
silenced mRNA expression and activity following IFNγ stimulation suggesting this
construct would withstand IDO induction in vivo. Furthermore, shRNA expression was
222
induced via doxycycline treatment and was significantly expressed, based on suppression
of IDO1 activity, by 2 days following doxycycline treatment. These studies confirm
silencing and induction of the shIDO1 construct and provide a foundation for
administration of a lentiviral vector containing a shRNA in a mouse model for inducible
IDO1 silencing.
Taken together, this research shows a role for IDO in modulation of the innate
and adaptive immune response to influenza virus infection. The effect of IDO expression
most likely occurs in various locations depending on the cell type. During initial
infection, IDO activity is increased in the respiratory epithelial cells through IFN-λ
stimulation resulting in modulation of cellular viability (Fig. 7.1A). IDO activity in the
epithelial cells potentially effects the activation and cytokine expression from antigen
presenting cells. In line with epithelial cell IDO expression, IDO expression in lung
resident alveolar macrophages decreases inflammatory cytokine production, particularly
IL-6 and TNF-α, and possibly various chemokines enhancing cellular recruitment and
CD4+ T cell differentiation and expansion (Fig. 7.1B). Modulation of the T cell response
would primarily occur in the mediastinal lymph node (MLN) where IDO activity is
derived from hematopoietic cells. Increased IFN-γ production in the MLN would
increase IDO activity thus modifying the cellular expression of epitopes as well as the
cytokine milieu for influenza specific T cell activation and differentiation (Fig. 7.1C).
This model suggests that the effect of IDO may be more global in the overall immune
response following influenza infection rather than isolated to the lung tissue. These
studies provide insight into the role of IDO during influenza infection and a potential to
utilize IDO inhibition to enhance vaccine efficacy.
223
Figure 7.1. Proposed model for IDO modulation of the acute immune response to
influenza. (A) Influenza infects and replicates in respiratory epithelial cells (EC)
increasing the secretion of type III interferons (IFN-λ). IFN- λ stimulates neighboring
cells resulting in enhanced IDO1 expression. (A-C) IDO inhibition using 1MT results in
(A) decreased viral load and increased cell death in respiratory epithelial cells. (B) 1MT
treatment increases the secretion of IL-6, TNF-α, IL-1β, and IFN-β from alveolar
macrophages (AMΦ) following stimulation with influenza virus. The increased
expression of these pro-inflammatory cytokines potentially increases inflammation and
recruitment of leukocytes. (C) Increased levels of IL-6 enhance the production of Th17
cells with decreases in the Treg response. Increased secretion of TNF-α and IFN-β
224
augments the Th1 response and influenza specific CD8+ T cell (Flu-CD8) expansion
resulting in augmented IFNγ production.