[Type text]

Hello and welcome to the University of Glasgow protocol guide! At the beginning of our project, we spent so much time searching through the Registry trying to locate a certain protocol. We thought it would save a lot of time for new teams if all these protocols were in one place. We hope it will be a good starting place for you and your team in the 2012 iGEM competition. Good luck, and enjoy the competition!

The 2011 University of Glasgow iGEM team

[Type text]

Contents Getting DNA from the kit

Storing kit plate Page 4

Using kit plate Page 4

Taking DNA from plate Page 4

Biobricks Page 5

Protocols

Standard Transformation Page 6

Overnight Cultures Page 6

Glycerol Stocks Page 6

Miniprep Page 7

Digest Page 8

Gel Extraction Page 9

Making chemically competent cells Page 10

Making electo-competent cells Page 10

Standard Assembly Page 11

3A Assembly Page 12

Alternative Ligation Protocol Page 13

AlwnI Digestion Page 14

Recipes

LB Broth Page 15

Agar Page 15

Agarose Gel Page 15

[Type text]

Q: How do we store the kit plate? They can be stored at room temperature. However once the DNA is resuspended in any of the wells, we recommend either storing the kit plate with its plastic cover in a -20C freezer, or aspirating the rest of the resuspended DNA from the well and keeping it separately in a -20C freezer. Q: How do we use the kit plate? The kit plate does not contain enough DNA to assemble any parts. You will need to transform the DNA into cells and then make your own glycerol stocks. Q: What do we do when we want to use the DNA? The DNA in each well needs to be resuspended. To do this you must: 1. Puncture a hole through the foil with a pipette tip

2. Add 15 ul of diH2O

3. We found that it was best to allow the DNA to soak into the water for about 10 minutes

4. Aliquot 15ul of the DNA to an eppendorf

5. Label and store in the fridge Q: Why is the kit DNA different colours? The dried DNA also contains food colouring. This is to denote the antibiotic resistance of the part. The standard colour key used by the Registry is:

Orange Ampicillin Red Kanamycin Green Chloramphenicol Yellow Tetracycline

For more information about the kit plate, as well as how to locate the part you want, visit

http://partsregistry.org/Help:Spring_2011_DNA_distribution

[Type text]

Biobricks Remember that the sequence for your part on the Registry will not include the Prefix and Suffix. Biobrick Prefix:

If the part begins in “ATG”, then the prefix sequence is:

GAATTCGCGGCCGCTTCTAG

Otherwise the sequence will be: GAATTCGCGGCCGCTTCTAGAG Biobrick Suffix: TACTAGTAGCGGCCGCTGAG

Restriction Sites In the biobrick prefix, there are two restriction sites – EcoRI and XbaI. In the biobrick suffix, there are two restriction sites – SpeI and PstI.

Enzyme Site

EcoRI

XbaI

SpeI

PstI

Only two of these enzymes will create compatible ends for ligation. These are XbaI and SpeI, and they will come together to form a scar. Biobrick Scar If the second part of the construct starts with “AT”, then the scar will be: TACTAG Otherwise, the scar site will be TACTAGAG

[Type text]

Standard Transformation of Chemically Competent Cells

1. Aliquot 15 μl of competent cells into a labelled eppendorf

2. Add 1 μl of DNA.

3. Put on ice for 15 min.

4. Heat shock at 42°C for 1 min.

5. Put on ice for 5 min.

6. Add 200 μl of LB medium.

7. Incubate at 37°C for 1 h.

8. Plate out onto a plate containing the correct antibiotic for your transformants

Overnight Cultures

1. Aliquot 5ml of LB into a labelled tube

2. Add the required volume of antibiotic

3. Inoculate the broth with a single colony from your plate

4. Grow for approximately 18 hours in a shaking incubator

5. Use the resulting culture to miniprep and make glycerol stocks

Glycerol Stocks

To make a 15% glycerol stock (1ml of liquid):

1. Add 250 μl of 60% glycerol to an eppendorf

2. Add 750 μl of the culture

3. Mix well, either by pipetting or vortexing

4.Store in a -80ºC freezer

[Type text]

Miniprep Protocol

The following protocol is from QIagen. You can view a full guide at

http://www.qiagen.com/literature/handbooks/literature.aspx?id=1000248&r=1009

1. Spin down 3ml of culture at 13,000 rpm for 3 minutes. To do this, do two spins (1.5ml of liquid each time) to obtain a pellet made of 3ml of the relevant culture. 2. After each spin, empty the supernatant be careful not to dislodge the pellet) 3. Add 250 μl of P1 Buffer and resuspend the pellet 4. Add 250 μl of P2 buffer and invert the tube 4 - 6 times. 5. Add 350 μl of N3 and invert the tube 4 - 6 times. 6. Spin for 10 minutes at 13,000 rpm. 7. Pipette 800 μl of the clear liquid into the sieve column. Be careful not to take up any of the white residue! 8. Spin for 1 minute at 13,000 rpm. 9. Discard supernatant. 10. Repeat stage 7-8 until all supernatant has been passed through the column. 11. Add 500 μl of PB (to wash the membrane) 12. Spin for 1 minute at 13,000 rpm. 13. Empty the collection tube 14. Add 750 μl of PE (Note: Always check that ethanol has been added. It should be ticked on the lid) 15. Spin for 1 minute at 13,000 rpm 16. Empty the collection tube 17. Spin for 1 minute at 13,000 rpm. This is to remove all residual ethanol. 18. Discard the collection tube. 19. Transfer the sieve column to a labelled empty eppendorf tube with the lid removed. 20. Add 50 μl of distilled water to the middle of the spin column 21. Leave to sit for 1 minute 22. Spin for 1 minute at 13,000 rpm 23. Discard the sieve column 24. Place the lid onto the eppendorf. The eluted DNA is now in the tube.

[Type text]

Digestion This is the standard protocol we used for digestions using enzymes from Roche. Digest and Gel 1. Take 1μl of the DNA obtained from the miniprep and add it to an empty eppendorf 2. Add 18.5μl of diH20 3. Add 0.25μl of the relevant restriction enzyme to the mixture. 4. Add 2.5 μl of the relevant buffer for the enzyme you are using. 5. Vortex the eppendorf 6. Briefly centrifuge the eppendorf 7. Incubate in the 37°C water bath for at least 1 hour Q: What buffer do I use? There are a variety of online resources available to help you determine which buffer to use in your reaction. If you are using enzymes from Roche, you may find it useful to consult this table. It can be accessed here: https://www.roche-applied-science.com/sis/cloning/cloning_images/0101011201_b1.jpg

[Type text]

Gel Extraction To perform gel extractions, we used the QIagen kit. You can access more information about this protocol here, http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx#Tabs=t2 1. Use a sharp, clean razorblade to cut out the required DNA fragment from the agarose gel

and put it into a corning tube.

2. Weigh an empty corning tube, zero the balance and then weigh the gel slice i tube. Note

the weights.

3. Add 3 volumes of buffer QG to 1 volume gel (100 mg ~ 100 ul). For example, a gel slice

that weighs 0.22g will require 660ul of Buffer QG.

4. Incubate in a 50C water bath for 10 min (or until the gel slice has completely dissolved).

Every 2-3 minutes, vortex the tube to help dissolve the gel.

5. After the gel slice has dissolved completely, check that the colour of the mixture is yellow.

It should be similar to buffer QG. If the colour of the mixture is orange or violet, add 10ul 3

M sodium acetate, pH 5.0 and mix. The colour of the mixture will turn yellow.

6. Add 1 gel volume of isopropanol to the sample and mix.

7. Aliquot the sample into a QIAquick spin column. For sample volumes of more than 800ul,

spin repeatedly until no sample remains.

8. Spin for 1 minute and discard flow through.

9. To wash, add 0.75 ml of Buffer PE to the column and centrifuge for 1 min.

10. Discard flow through

11. Centrifuge again in the same tube, to remove residual wash buffer

12. Move the sieve column to a new eppendorf (with the lid removed).

13. To elute the DNA, add 50ul buffer EB to the centre and centrifuge the column for 1 min.

14. If you are going to analyse it on a gel, add 1 volume of loading dye to 5 volumes of

purified DNA. Mix by pipetting.

[Type text]

Competent cells are expensive! Here is a guide on how to make your own: Making cells chemically competent Please note this protocol will take around 2 hours. 1. Add 20 ml of LB medium to Eppendorf tube. 2. Add 200 μl of bacterial cells. 3. Incubate in the 37°C shaker for 90 min. 4. From the incubator put straight onto ice (to stop growth). 5. Spin at 10,000 rpm at 4°C for 1 min. 6. Remove supernatant and add 10 ml of ice cold CaCl2 and resuspend. 7. Spin at 10,000 rpm at 4°C for 1 min. 8. Remove supernatant. 9. Resuspend in 1ml of ice cold CaCl2. Making cells electrically competent Please note: This protocol will take around 7 hours. Make sure to keep glycerol and corning tubes on ice at all times (including before use) 1. Prewarm 400ml of medium in the 37°C bath. 2. Inoculate with 10ml of fresh culture from overnight 3. Grow up in the 37°C shaker incubator until OD600 is between 0.5 and 0.7. This should take around 2 hours. 4. Aliquot the liquid into 10 corning tubes of 40ml each 5. Chill cells (in the tubes) on ice/water for 20 minutes. Keep close to 0°C for subsequent steps. 6. Spin at 4000g for 15 mins at 4°C. 7. Remove the supernatant (upside-down on blue roll to remove excess liquid from around pellet) 8. Resuspend gently in 40ml of ice cold glycerol (10% filtered glycerol) 9. Repeat step 6: resuspend 20 ml of ice cold glycerol (10% filtered glycerol) 10. Repeat step 6: resuspend 5ml ice cold glycerol (10% filtered glycerol) 11. Repeat step 6: resuspend 1ml of ice cold glycerol (10% filtered glycerol) 12. After resuspension transfer the solution into two corning tubes, then repeat step 6 and resuspend in 1ml of ice cold glycerol (10%, filtered)

You now have 2ml of electro-competent cells. These can be used for electroporation.

[Type text]

Standard Ligation This is the standard method of ligating biobricks, as suggested by the Registry. The following protocol is taken from Gingo Bioworks , who have a short manual available to download. It can be accessed here http://ginkgobioworks.com/support/, where there is also a troubleshooting guide. 1. Start with two biobrick parts and a biobrick destination plasmid. The destination plasmid contains a different antibiotic resistance to the upstream and downstream parts 2. Digest each of the parts with the appropriate restriction enzymes. 3. Mix the digests together and perform a ligation step. You can use the ligation mix to transform competent cells with the new composite part. You can read more about the Standard Assembly protocol on the Registry, at the following

link:

http://partsregistry.org/Assembly:Standard_assembly

[Type text]

3A Assembly The Registry also has an alternative method of assembly. This is called 3A (“Three Antibiotic”) Assembly. To read more about 3A assembly, visit this page http://partsregistry.org/Assembly:3A_Assembly 3A Protocol 1. Miniprep your two parts.

2. Digest your two parts and construction plasmid backbone destination vector with the following enzymes

- Left part with EcoRI and SpeI

- Right part with XbaI and PstI

- Construction plasmid backbone with EcoRI and PstI.

3. If possible, you should also digest the construction plasmid backbone with DpnI to eliminate any plasmid remaining from the PCR. 3. Combine 1 ul of each restriction digest reaction with 1 ul of ligase in a 25 ul reaction.

4. Transform the ligation product.

5. If the input parts are good, almost all colonies will be correct.

6. If desired, analyze the transformation with single colony PCR followed by agarose gel electrophoresis. 7. Miniprep clones that generated a band of the appropriate size.

8. Sequence the clone.

9. Record the sequence information in the Registry.

[Type text]

Alternative Ligation Protocol It is the protocol that the 2011 Universty of Glasgow iGEM team used, producing excellent ligation results.

1) 8.6 ul of insert + vector (1:1 ratio)

2) 1.2ul of PEG 6000 (25%)

3) 1.2 ul of T4 Buffer

4) 1ul of T4 Ligase

5) Leave for 1 hour at 21ºC

6) Inactivate for 30 min at 68ºC

7) Transform immediately or store in a -20ºC freezer

[Type text]

AlwnI Digestion

This method of digestion was used by the 2011 University of Glasgow iGEM team to combat

the problem of some parts being too small to visualise on a gel.

1. Digest the plasmid containing the promoter with AlwnI and SpeI.

2. Digest the plasmid containing the ribosome binding site with AlwnI and XbaI.

3. Run the samples on a gel.

4. Perform a gel extraction. Ensure you know the size of the fragments you are keeping.

5. Ligate the promoter fragment to the RBS fragment.

6. Transform the ligation into E.coli.

7. Overnight and miniprep colonies.

[Type text]

To make a 500 ml bottle of LB broth:

1. Measure out 5g of tryptone 2. Measure out 5g of NaCl 3. Measure out 2.5g of yeast extract 4. Add approximately 500 ml of dH₂O 5. Make sure well mixed (all powder dissolved) 6. Autoclave the bottles To make 500 ml of LB Agar: As LB broth, but also add 7.5 g of agar before step 4.

Preparing an Agarose Gel

1. To make a 1% agarose gel, add together:

1.5g of agarose powder

150ml of TAE (Tris Acetate EDTA)

2. Melt in the microwave for ~ 4 minutes at 40% power. Heat the mixture until the liquid is

clear and the bubbles are large.

3. When the mixture has cooled enough to hold comfortably, add 15 μl of Sybrsafe.

4. Add 5μl of 1kbp molecular ladder to the first lane of the gel. This will act as a positive

control.

5. As a negative control, use just loading dye and distilled water.

Note: The TAE solution in the gel system can be reused, just place the lid on the well.