Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Identification of Gastric Cancer–Related Genes Using a cDNA
Microarray Containing Novel Expressed Sequence
Tags Expressed in Gastric Cancer Cells
Jeong-Min Kim,1,5 Ho-Yong Sohn,4
Sun Young Yoon,1 Jung-Hwa Oh,1 Jin Ok Yang,1
Joo Heon Kim,2 Kyu Sang Song,3 Seung-Moo Rho,2
Hyan Sook Yoo,1 Yong Sung Kim,1 Jong-Guk Kim,5
and Nam-Soon Kim1
1Genome Research Center, Korea Research Institute of Bioscience andBiotechnology; 2Department of Pathology, Eulji University School ofMedicine; and 3Department of Pathology, College of Medicine,Chungnam National University, Daejeon, Korea; 4Department of Foodand Nutrition, Andong National University, Andong, Korea; and5Department of Microbiology, College of Natural Sciences, KyungpookNational University, Daegu, Korea
ABSTRACT
Purpose: Gastric cancer is one of the most frequently
diagnosed malignancies in the world, especially in Korea and
Japan. To understand the molecular mechanism associated
with gastric carcinogenesis, we attempted to identify novel
gastric cancer–related genes using a novel 2K cDNA micro-
array.
Experimental Design: A 2K cDNA microarray was
fabricated from 1,995 novel expressed sequence tags (ESTs)
showing no hits or a low homology with ESTs in public
databases from our 143,452 ESTs collected from gastric
cancer cell lines and tissues. An analysis of the gene expression
for human gastric cancer cell lines to a normal cell line was
done using this cDNA microarray. Data for the different
expressed genes were verified using semiquantitative reverse
transcription-PCR,Western blotting, and immunohistochem-
ical staining in the gastric cell lines and tissues.
Results: Forty genes were identified as either up-
regulated or down-regulated genes in human gastric cancer
cells. Among these, genes such as SKB1 , NT5C3 , ZNF9 ,
p30, CDC20 , and FEN1 , were confirmed to be up-regulated
genes in nine gastric cell lines and in 25 pairs of tissue
samples from patients by semiquantitative reverse tran-
scription-PCR. On the other hand, genes such as MT2A
and CXX1 were identified as down-regulated genes. In
particular, the SKB1 , CDC20 , and FEN1 genes were
overexpressed in z68% of tissues and the MT2A gene
was down-expressed in 72% of the tissues. Western blotting
and immunohistochemical analyses for CDC20 and SKB1
showed overexpression and localization changes of the
corresponding protein in human gastric cancer tissues.
Conclusions: Novel genes that are related to human
gastric cancer were identified using cDNA microarray
developed in our laboratory. In particular, CDC20 and
MT2A represent a potential biomarker of human gastric
cancer. These newly identified genes should provide a
valuable resource for understanding the molecular mecha-
nism associated with tumorigenesis of gastric carcinogenesis
and for the discovery of potential diagnostic markers of
gastric cancer.
INTRODUCTION
Gastric cancer is one of the most frequently diagnosed
malignancies in the world (1). It is particularly prevalent in
Korea and Japan and is one of the leading causes of cancer death
in these regions (2). Although the incidence and mortality have
been decreasing during the last several years, gastric cancer still
has a notorious position, with the first incidence and the second
cause of mortality in Korea (3).
Advances in diagnostic and treatment technologies have
enabled us to offer excellent long-term survival results for early
gastric cancer, but the prognosis of advanced gastric cancer still
remains poor (4). Recent molecular analyses revealed that gastric
cancers are closely related to genetic alterations in several genes,
such as p53, APC , E-cadherin , b-catenin , TGF-a , c-met , trefoilfactor 1 , and Runx3 (5–7). However, the common pathways of
carcinogenesis and the subsequent progression of gastric cancer
remained to be elucidated.
A cDNA microarray was used to simultaneously study
the expression profiles of a number of genes at specific
conditions in a single hybridization (8, 9). Many reports on
gene expression profiles of various cancers and diseases using
cDNA microarray techniques have been reported (10–14).
Among them, changes in gene expression in gastric cancer
cell lines and malignant tissues have been reported. In gastric
adenocarcinomas, genes such as S100A4 , CDK4 , MMP1 , and
b-catenin genes have been reported as being up-regulated
genes, the GIF gene was reported to be a down-
regulated gene (15). Ji et al . (16) has also reported the first
comprehensive review of gene expression patterns in gastric
cancer cell lines on a genomic scale. In this study, they
analyzed global gene expression patterns of 27 human cell
lines, including 12 gastric carcinoma cell lines and compared
heterogeneity between gastric cancer cell lines. In addition, a
comparison of the gastric cancer–related genes using gastric
cancer tissues and surrounding gastric mucosa tissues has been
reported, as well as a connection between the clinical
phenotypes of patients (17).
Received 4/20/04; revised 9/25/04; accepted 10/5/04.Grant support: 21C Frontier Functional Human Genome Project fromthe Ministry of Science and Technology of Korea.The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.Requests for reprints: Nam-SoonKim, Laboratory of HumanGenomics,Genome Research Center, Korea Research Institute of Bioscience andBiotechnology, P.O. Box 115, Yusong, Daejeon, Korea. Phone: 82-42-879-8112; Fax: 82-42-879-8119; E-mail: [email protected].
D2005 American Association for Cancer Research.
Vol. 11, 473–482, January 15, 2005 Clinical Cancer Research 473
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
In a previous study, we collected an entire set of genes that
are expressed in gastric cancer cell lines or tissues using full-
length enriched cDNA libraries, subtracted cDNA libraries, and
normalized cDNA libraries from gastric cancer cell lines and
tissues from Korean patients and identified the genes associated
with gastric cancer by examining their expression profiles (18).
Using this process for identifying novel gastric cancer-related
genes in which there were no hits or a low homology with known
genes in public databases, we isolated 1,995 novel genes from the
collected gastric expressed sequence tags (ESTs) and fabricated a
cDNA microarray containing these genes. However, some of the
ESTs were identified as known genes in recent updated public
databases. Using the cDNA microarray, a gene expression anal-
ysis of these genes in gastric cancer cell lines and tissues was
done. Here, we report on the identification of novel genes that are
differentially expressed in gastric cancer cell lines and tissues.
MATERIALS AND METHODS
Cell Culture, Tissues, and RNA Preparation
Human gastric cancer cell lines, SNU-1, SNU-16, SNU-
216, SNU-484, SNU-601, SNU-638, SNU-668, and SNU-719
were cultured in RPMI 1640 (Life Technologies, Grand Island,
NY) and human normal gastric cell lines Hs 677.St (ATCC CRL-
7407) in DMEM (Life Technologies) supplemented with 10%
inactivated fetal bovine serum, 2 mg/mL sodium bicarbonate,
and 1% antibiotic-antimycotic solution (Invitrogen Life Tech-
nologies, Carlsbad, CA). The Hs 677.St cell line was derived
from normal fetal stomach tissue and had a morphology similar
to a fibroblast. All cultured cells were incubated at 37jC in a
humidified incubator maintained with a 5% CO2 atmosphere
(19, 20). When the cells were about 80% to 90% confluent, they
were harvested and used for total RNA isolation. Fifty gastric
tissues containing the tumor and normal regions of 25 gastric
cancer patients were obtained from the College of Medicine,
Chungnam National University, Korea with informed consent.
The tumors were staged according to tumor-node-metastasis
classification of Union Internationale Contre le Cancer. The
obtained tissues were immediately frozen in liquid nitrogen.
Total RNA was extracted from the cultured cells and tissues
using a commercially available RNA isolation kit (Qiagen,
Hilden, Germany) following the procedures recommended by
the manufacturer.
Isolation of Novel Genes from ESTs Collected in Gastric
Cancers
The total 143,452 ESTs collected from human gastric
cancer cell lines and gastric tissues were analyzed by a BLAST
search against human mRNA (Genbank release 126, down-
loaded on Oct. 2001), UniGene (UniGene build 143, down-
loaded on Oct. 2001) and NR databases (downloaded on Oct.
2001). To isolate novel ESTs in which there were no hits or a low
homology in public databases, ESTs having an identity of <90%
for <50 bp with E V 1 � 10�3 against the human mRNA and
UniGene databases, and having an identity of <85% for <20
amino acids with E V 1 � 10�5 against the NR database were
selected. E V 1 � 10�3 indicates that the probability that a query
sequence have accidentally identity with a certain sequences in
database under given condition is V1 � 10�3. These isolated
ESTs were used to fabrication the cDNA microarray.
The novelty of these ESTs were reanalyzed by a BLAST
search against human mRNA (Genbank release 138.0, down-
loaded on Dec. 2003), RefSeq (downloaded on Dec. 2003) under
conditions of an identity of >90% for >50 bp with E V 1 �10�20. The remaining ESTs were analyzed by a BLAT search
against the human genome database (University of California
Santa Cruz6 Golden Path genome database build 15) under the
above conditions. Analysis of the ESTs that were not included in
the above searches were done under conditions of an identity of
>90% for >50 bp with E = 1 � 10�20 to 1 � 10�3 against human
mRNA and RefSeq databases and with E V 1 � 10�1 against the
NR database (downloaded on Dec. 2003).
Fabrication and Hybridization of cDNA Microarray
Clones containing the novel ESTs were grown in 96-well
culture plates and plasmid DNAs were purified using a Millipore
plasmid kit (Millipore Co., Bedford, MA). The inserts of cDNAs
using purified plasmid DNAs were amplified by PCR with the
sense primer 5V-GCAGAGCTCTCTGGCTAAC-3V, which is
localized in the vector region and the antisense primer 5V-CGTGCGGCCGCT21(G/A/C)-3V. After purifying the PCR
products on Sephadex G-50 Superfine (Amersham Pharmacia
Biotech AB, Uppsala, Sweden), they were suspended in a
Microspotting solution (ArrayItTM Brand Products, TeleChem,
Sunnyvale, CA) and spotted on CSS-100 Silyated Slides
(Aldehyde; CEL Associates, Pearland, TX) using a Carte-
sian Prosys 5510 robot (Cartesian, Inc., Irvine, CA) with 32
printing tips. Our cDNA microarray contained a total of 6,912
spots in one slide including triplicates of 1,995 cDNA, control
genes of GAPDH and b-actin , and empty spots for negative
controls.
Twenty micrograms of total RNA from a normal cell line or
cancer cell lines, respectively, were used in the cDNA micro-
array analysis. RNA of the normal cell line, labeled with Cy3,
was used as a reference versus RNAwith Cy5 from each of eight
cancer cell lines as a sample. Probe labeling and hybridization
were done using a 3DNA Array 50 kit (Genisphere, Inc.,
Hatfield, PA) according to the manufacturer’s instructions. After
the hybridization procedure, the slide was scanned at a
wavelength of 532 nm for Cy3 and at 635 nm for Cy5 using
a ScanArray 5000 scanner (Packard BioChip Technologies,
Billerica, MA). To increase the accuracy of the experiment,
each experiment was done in duplicate using two different
cDNA microarrays.
Analysis of Data Obtained from cDNA Microarray
The scanned images were analyzed using the GenePix Pro
4.0 program (Axon Instruments, Inc., Union City, CA) and the
subsequent data were normalized using the scaled print-tip group
Lowess method using the statistics for microarray analysis
package of the R7 statistics software to remove intensity
variances between spots themselves that originate from spotted
locations. If the signal to background ratio was <1.4, the feature
was processed as a null value to reduce bias. Using normalized
M values [M = log2(R/G)], we did a one class analysis using the
6 http://genome.ucsc.edu/7 http://www.maths.lth.se/help/R/com.braju.sma/
Identification of Gastric Cancer–Related Novel Genes474
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
significance analysis of microarrays8 program with a median
false discovery rate of 0.10089 and D = 1.40 to select
significantly expressed genes (21). Furthermore, to exclude
spots having a low intensity, genes having an A > 6 [A =
0.5log2(RG)] were selected. In addition, redundant clones were
removed, because our cDNA microarray had triplicate spots.
Finally, differentially expressed genes in gastric cancer cell lines
were selected for further study based on the significance analysis
of microarrays scores.
Bioinformatic Analysis of Up-Regulated or Down-Regulated
Genes
A homology search for the selected genes was done by a
BLASTn analysis against the NR database with the National
Center for Biotechnology Information9 default conditions. The
search for the symbol and function of these genes were done by
SOURCE10 and GeneCards.11 In addition, an analysis for the
chromosomal location of the selected genes was done using the
University of California Santa Cruz Golden Path human genome
database build 15 at conditions of 90% minimum identity.
Semiquantitative Reverse Transcription-PCR
The 1st cDNA was synthesized by the reverse transcription
reaction with 5 Ag of isolated RNA, 2 pmol/L of oligo (dT)20,
1 AL of 10 Amol/L deoxynucleotide triphosphate, 4 AL of 5�buffer, 2 AL of 100 mmol/L DTT, 1 AL of RNaseOUT (40 units/
AL, Invitrogen Life Technologies), and 1 AL of SuperScript II
(200 units/AL, Invitrogen Life Technologies) at 42jC for 1 hour.
The 1st cDNA was quantified using a human b-actin competi-
tive PCR kit (TaKaRa Co., Tokyo, Japan) according to the
manufacturer’s instructions. The PCR conditions were 1 cycle of
2 minutes at 94jC, 25 cycles of 30 seconds at 94jC, and 1
minute at 68jC, and 1 cycle of 1 minute at 72jC with b-actinprimer sets (Table 1). After electrophoresis in a 2% agarose gel,
the DNA concentration of b-actin (275 bp) and actin competitor
(340 bp) were analyzed using the TotalLab software program
(Phoretix Co., Newcastle Upon Tyne, United Kingdom) and the
amount of the 1st cDNA of each sample was adjusted based on
the b-actin concentration. To quantify the expression level of
the selected genes, the same volume of diluted 1st cDNAs
synthesized from gastric cells was used as a template in a PCR
reaction. Each gene was amplified by PCR which consisted of 27
cycles of 40 seconds at 94jC, 50 seconds at 55jC, and 1 minute
at 72jC with specific primer sets (Table 1). The PCR products of
each of the specific genes and b-actin (275 bp) were analyzed by
2% agarose gel electrophoresis and the expression ratio was
calculated using the TotalLab software program (Phoretix).
Western Blotting
When human gastric normal and cancer cell lines which
were cultured in media, were about 80% to 90% confluent,
they were rinsed with PBS, scrapped into 300 AL of cell lysis
buffer containing 50 mmol/L Tris (pH 7.5), 150 mmol/L
NaCl, 0.5% NP40, 1 mmol/L EDTA, 1 mmol/L phenyl-
methylsulfonyl fluoride, 1 Amol/L Pepstatin A, 1 Amol/L
Leupeptin, 1 Amol/L Aprotinin, and placed on ice for 1 hour.
The cells were then centrifuged at 15,000 � g for 15 minutes
and the supernatant was harvested. Aliquots (50 Ag) of
soluble proteins were separated on SDS-polyacrylamide-gels
and transferred to polyvinylidene difluoride membranes
(Millipore). The membranes were incubated with the mouse
monoclonal antibody against CDC20 (Santa Cruz Biotechnol-
ogy, Inc., Santa Cruz, CA), a rabbit polyclonal antibody to
SKB1 (Cell Signaling Technology, Inc., Beverly, MA) and a
mouse monoclonal antibody to h-actin (Sigma, St. Louis,
MO) at a dilution of 1:1,000, 1:1,000, and 1:50,000,
respectively. After the blots were incubated with peroxidase-
conjugated goat anti-rabbit IgG (Jackson ImmunoResearch,
WestGrove, PA) and horseradish peroxidase–conjugated goat
anti-mouse antibody (Promega, Madison, WI), immunoreactive
signals were detected using enhanced chemiluminescence kit
(Amersham Pharmacia, Piscataway, NJ).
Immunohistochemistry
Paraffin sections of gastric cancer tissue from patients
were deparaffinized with xylene and then rehydrated.
Antigenic retrieval was processed by submerging in citrate
buffer (pH 6.0) and microwaving. The sections were then
treated with 3% hydrogen peroxide in methanol to quench
endogenous peroxidase activity, followed by incubation with
1% bovine serum albumin to block nonspecific binding. The
primary anti-CDC20 (1:100 dilution) and anti-SKB1 (1:100
dilution) antibodies that are used in Western blotting were
incubated for 60 minutes at room temperature. After washing,
the tissue section was then reacted with the biotinylated anti-
mouse and anti-rabbit secondary antibodies, followed by
incubation with streptavidin-horseradish-peroxidase complex.
The tissue section was immersed in 3-amino-9-ethyl carba-
zole as a substrate, and counterstained with 10% Mayer’s
hematoxylin, dehydrated, and mounted by crystal mount. In
the negative controls, the nonimmune mouse or rabbit IgG
of the same isotype or the antibody dilution solution was
replaced the primary antibody.
RESULTS
Analysis of cDNA Included in cDNA Microarray
To isolate novel genes associated with stomach cancer, a
cDNA microarray containing novel ESTs which have low
homology or no hits in public databases was fabricated. A total
of 1,995 ESTs contained in microarray were selected as novel
ESTs from our 143,452 ESTs collected from human gastric
cancer cell lines and gastric tissues by analysis of public
databases (collected on Oct. 2001, see MATERIALS AND
METHODS). A reanalysis of these selected genes against
updated above databases, for novelty, (data collected on Dec.
2003) showed that 686 genes (34.4%) could be categorized into
known human genes against the human mRNA and RefSeq
databases with conditions of identity of >90% for >50 bp with E
V 1 � 10�20, and 559 genes (28%) without known human genes
were mapped only on the human genome against University of
California Santa Cruz Golden Path genome database build 15
under above conditions (Table 2). In addition, 690 genes were
8 http://www-stat.stanford.edu/ftibs/SAM/index.html9 http://www.ncbi.nlm.nih.gov/BLAST/10 http://source.stanford.edu/cgi-bin/sourceSearch11 http://bioinformatics.weizmann.ac.il/cards/
Clinical Cancer Research 475
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
categorized into ESTs of low homology and 60 genes (3.0%)
showing ‘‘no hits’’. Among known human genes, 289 genes
(14.5%) were functionally classified by the Gene Ontology
database.12 From these analyses, 1,309 ESTs excluding Known
human genes were thought to be novel ESTs, although only 60
(3%) represented novel ESTs which were sacrificed by the first
criteria, in which novel ESTs were defined as ESTs having an
identity of <90% for <50 bp with E V 1 � 10�3 against the
human mRNA and UniGene databases.
Identification of Up-Regulated or Down-Regulated Genes in
Gastric Cancer Cells
We compared the gene expression profiles of eight gastric
cancer cell lines with that of a normal gastric cell line using
cDNA microarray. After cDNA microarray hybridization,
normalization, and data analysis, we finally selected a total of
40 genes, 20 genes for up-regulation and 20 genes for down-
regulation, based on significance analysis of microarrays scores,
that showed significant expression changes in gastric cancer
cells.
As shown in Table 3, the up-regulated genes in gastric
cancer cells included known genes such as CKS1B , SCX ,
D1S155E , FKBP4 , SKB1 , NT5C3 , p30, GPI , PRO2000 ,
CDC20 , FEN1, ZNF9 , and RPS16 and functionally unknown
genes such as FLJ31196, FLJ39478 , and FLJ90345 . In
addition, four novel genes NSG-21-D10 , NSG-18-A07 , NSG-
05-E12 , and NSG-08-D09 were included. A search of the
SOURCE and GeneCards database for the function of these
selected genes indicated that their biological functions were
diverse and included genes related to a cell cycle regulator
(CKS1B , SKB1 , and CDC20), transcription (SCX), develop-
ment (D1S155E), protein folding (FKBP4), DNA repair
(FEN1), and biosynthesis (ZNF9 , RPS16). Furthermore, a
search of chromosomal locations for the up-regulated genes
was done by mapping the in University of California Santa
Cruz Golden Path human genome database. The analysis
showed that of the 20 genes, 13 were localized in
chromosome 1 (CKS1B , D1S155E , and CDC20), chromosome
8 (SCX , FLJ39478 , and PRO2000), chromosome 11 (FEN1
and NSG-18-A07), chromosome 17 (FLJ31196 and p30), and
chromosome 19 (GPI , FLJ90345, and RPS16). The genes
localized in chromosome 17 and chromosome 19 were
clustered in 17p11.2 and 19q13, respectively.
Genes representing a down-regulated expression in gastric
cancer cells included known genes such as LGALS1 , OAZ1 ,
PEA15 , SEC61A1 , LGP1 , MT2A , MAGED2 , NPDC1 , CXX1 ,
FKBP8 , and PGR1 and functionally unknown genes such as
DXS9879E , FLJ34386 , FLJ20920 , and FLJ30061 and five
novel genes (Table 4). The functional analysis of these selected
genes showed that the genes related with apoptosis (LGALS1),
polyamine biosynthesis (OAZ1), protein targeting (SEC61A1),
and protein folding (FKBP8) were included. In addition, many
of the down-regulated genes were localized in chromosome 17,
chromosome 19, and chromosome X. Among them, two genes
LGP1 and FLJ20920 were clustered in 17q21.
Verification of mRNA Levels for Selected Genes Using
Semiquantitative Reverse Transcription-PCR
To more quantitatively verify the data obtained from our
DNA microarray, we randomly selected seven up-regulated
genes (CKS1B , SKB1 , NT5C3 , ZNF9 , p30, CDC20 , and FEN1)
and five down-regulated genes (LGALS1 , OAZ1 , DXS9879E ,
MT2A , and CXX1) in gastric cancer and did semiquantitative
reverse transcription-PCR (RT-PCR) in nine normal and gastric
cancer cell lines, and in 25 pairs of gastric normal and tumor
tissues in the I to IV stages.
As shown in Fig. 1A , the expression of all the up-regulated
genes were higher in most of the cancer cell lines than in
normal cell lines, Hs 677.St. All of these genes were also highly
Table 1 Primer sequences and the product size of selected genes used in RT-PCR
Gene Sense (5V!3V) Antisense (5V!3V) Size (bp)
CKS1B ACGACGACGAGGAGTTTGAG CCGCAAGTCACCACACATAC 584SKB1 CAAGTTGGAGGTGCAGTTCA GCCCACTCATACCACACCTT 1,074NT5C3 TGATGCCAGAATTCCAGAAA CAACATTGGCCACTCCATCT 723ZNF9 TTCAAGTGTGGACGATCTGG TTGCTGCAGTTGATGGCTAC 437P30 CTTCTCGCTTCAAGCTCCTG TGTTCTTGATGGTCTTGTGCTC 249CDC20 GTACCTGTGGAGTGCAAGC GTAATGGGGAGACCAGAGG 618FEN1 CATGGACTGCCTCACCTTC CGGTCACCTTGAAGAAATC 508LGALS1 GACGCTAAGAGCTTCGTGCT GTAGTTGATGGCCTCCAGGT 282MT2A ATGGATCCCAACTGCTCCT CTTTGCAGATGCAGCCTTG 154CXX1 GGAGGAGGACGAGGACTTCT TGGGCAGAATGATGTAGTCG 418Actin CAAGAGATGGCCACGGCTGCT TCCTTCTGCATCCTGTCGGCA 275
Table 2 Contents of the cDNA microarray
Categories Novel genes (%)
Known human genes* 289 (14.5)Known functiony 397 (19.9)Unknown functiony 397 (19.9)
Human genomez 559 (28.0)ESTs (low homology)x 690 (34.6)No hitsk 60 (3.0)Total 1,995 (100)
*An identity of >90% for >50 bp with a E V 1 � 10�20 againsthuman mRNA and RefSeq databases.
yAccording to the Gene Ontology consortium http://www.geneon-tology.org).
zNot categorized in known human genes, but mapped on humanGolden Path build 15 at condition of >90% identity.
xNot categorized in known human genes and human genome, buthave an identity of above 90% with E = 1 � 10�20 to 1 � 10�3 againsthuman mRNA and RefSeq database and an E V 1 � 10�1 against NRdatabase.
kNot found in any databases under the above conditions.12 http://www.geneontology.org/
Identification of Gastric Cancer–Related Novel Genes476
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
expressed in most of the tumor tissues compared with their
normal tissues (Fig. 1B). These genes were highly expressed in
tumor tissues with a frequency of 40% to 88% in 25 tissue pairs
that were classified as containing I to IV stages of gastric
cancer. Among these genes, the CDC20 gene was the most
highly expressed in 22 tumor tissues of the 25 tissue pairs with
a high frequency of 88% which covered all stages of gastric
cancer. The SKB1 and FEN1 genes were also detected at high
Table 3 Up-regulated genes in gastric cancer cells in comparison to gastric normal cell
No.* Clone name Homology search Gene symbol Functiony Chromosome location Accession no.z
1 NSG-19-G11 Hypothetical protein FLJ31196 FLJ31196 — 17p11.2 BQ0824342 NSG-03-F01 CDC28 protein kinase regulatory
subunit 1BCKS1B cell cycle control 1q22 CB104710
3 NSG-06-C08 Homo sapiens class II bHLHproteinscleraxis (SCX) gene
SCX transcription 8x —
4 NSG-11-H11 cDNA FLJ39478 FLJ39478 — 8q13.2 BM8382625 NSG-11-H08 NRAS-related gene D1S155E development 1p13.2 BM7499716 NSG-17-H01 FK506-binding protein 4
(59 kDa)FKBP4 protein folding 12p13.33 —
7 NSG-06-C12 SKB1 homologue(Schizosaccharomyces pombe)
SKB1 cell proliferation 14q11.2 —
8 NSG-07-G05 5V nucleotidase, cytosolic III NT5C3 nucleotide metabolism 7p14.3 BQ0820239 NSG-16-G09 nuclear proteinp30 p30 — 17p11.2 BM76448110 NSG-14-A11 glucose phosphate isomerase GPI Glycolysis 19q13.11 BM83747711 NSG-08-D03 cDNA clone FLJ90345 FLJ90345 — 19q13.32 BQ08218212 NSG-21-D10 unknown — — 7q36.1 BM79225613 NSG-13-A06 PRO2000 protein PRO2000 nucleotide binding 8q24.13 BM74683514 NSG-11-G05 cell division cycle 20 homologue
(Saccharomyces cerevisiae)CDC20 regulation of cell cycle 1p34.2 BM742641
15 NSG-16-F01 flap structure–specific endonuclease 1 FEN1 DNA repair 11q12.2 —16 NSG-14B06 zinc finger protein 9 ZNF9 cholesterol biosynthesis 3q21.3 BM83731117 NSG-18-A07 unknown — — 11p15.5 BM82655418 NSG-05-E12 Unknown — — — BM74280719 NSG-12-F03 ribosomal protein 16 RPS16 protein biosynthesis 19q13.2 BM76456520 NSG-08-D09 unknown — — — BM759098
*Number represents the order of genes selected from a significance analysis of microarrays.yGene function according to SOURCE and GeneCards.zGenbank accession no.xKnown as only the chromosome number.
Table 4 Down-regulated genes in gastric cancer cells in comparison to gastric normal cell
No.* Clone name Homology search Gene symbol Functiony Chromosome location Accession no.z
1 NSG-18-B07 lectin, galactoside-binding, soluble, 1 LGALS1 apoptosis/cell differentiation 22q13.1 BM7405712 NSG-05-G04 ornithine decarboxylase antizyme 1 OAZ1 polyamine biosynthesis 19p13.3 BM7457273 NSG-21-C09 unknown — — 2q22.3 CB1048814 NSG-03-B06 phosphoprotein enriched in
astrocytes 15PEA15 small molecular transport 1q23.2 —
5 NSG-14-F03 DNA segment on chromosome X(unique) 9879 expressed sequence
DXS9879E — Xq28 M827357
6 NSG-15-D02 FLJ34386 fis, clone HCHON1000166 FLJ34386 — 12q13.2 BM7639097 NSG-02-E05 protein transport protein SEC61 alpha
subunit isoform 1SEC61A1 protein targeting 3q21.3 —
8 NSG-21-B09 H. sapiens D11lgp1e-like, fragment LGP1 — 17q21.2 BM7900489 NSG-21-E10 hypothetical protein FLJ20920 FLJ20920 — 17q21.33 BM79535810 NSG-15-D03 metallothionein-II gene MT2A metal ion binding 16q12.2 BQ08215911 NSG-17-B05 melanoma antigen, family D, 2 MAGED2 — Xp11.21 BM79047012 NSG-12-D11 neural proliferation, differentiation
and control, 1NPDC1 Integral to membrane 9q34.3 —
13 NSG-05-G03 unknown — — — —14 NSG-21-F08 unknown — — — —15 NSG-15-C07 CAAX box 1 CXX1 — Xq26.3 BM76306316 NSG-21-D05 FK506 binding protein 8 FKBP8 protein folding 19q13.11 BM79040417 NSG-19-A04 T-cell activation protein PGR1 — 4p16.1 BM77167418 NSG-08-C02 unknown — — — BM75744119 NSG-07-F01 unknown — — — BQ08195820 NSG-07-F02 cDNA FLJ30061 FLJ30061 — 7q32.3 BQ081959
*Number represents the order of genes selected from a significance analysis of microarrays.yGene function according to SOURCE and GeneCards.zGenbank accession no.
Clinical Cancer Research 477
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Fig. 1 Semiquantitative RT-PCR of selected genes from the cDNA microarray. Total RNAs isolated from gastric cell lines and tissues were used astemplates for semiquantitative RT-PCR, according to the manufacturer’s instructions (for details, see MATERIALS AND METHODS). The RT-PCRproducts were electrophoresised on a 2% agarose gel. A, expression levels of target genes in gastric cell lines. Hs677.St, gastric normal cell line; SNUseries, gastric cancer cell lines established from Korean patients. The b-actin gene was used as a reference. B, expression levels of target genes in gastrictumor and normal tissues. The transcriptional levels of the target genes were calculated relative to the amount of b-actin gene. a-f, up-regulated genes inthe cancer cells; g-h, down-regulated genes in the cancer cells; 5, normal tissues from gastric cancer patients; n, tumor tissues from gastric tumorpatients; IA, IB, II, IIIA/B, and IV: stages of gastric cancer tissues according to tumor-necrosis-metastasis classification of Union Internationale Contrele Cancer.
Identification of Gastric Cancer–Related Novel Genes478
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
levels in the IB and II stages of tumor tissues for SKB1 and in
II and III A/B stages for FEN1 with a frequency of 68% (17
in 25 cases) and 72% (18 in 25 cases), respectively. All of the
up-regulated genes detected in tissues were highly detected in
most of the II stage gastric cancers. However, CKS1B was not
detected in any of the gastric tissues, though it was detected in
very low amounts in cancer cell lines. On the other hand, three
down-regulated genes, except for OAZ1 and DXS9879E , were
detected at low levels in many of the cancer cell lines compared
with the normal cell line, Hs 677.St, as shown in Fig. 1A . When
the expression levels of three genes, LGALS1 , MT2A , and
CXX1 , were examined in gastric tissues, MT2A was found to be
detected at low levels in the tumor tissues, but had high
expression levels in normal tissues with a frequency of 72% (18
of 25 cases). Its higher expression was detected over a wide
stage from IB to IV in normal gastric tissues. The other gene,
CXX1 , was highly expressed in normal tissues with frequencies
of about 32% in various stages. However, LGALS1 was not
detected in any of the gastric tissues, because of very low
amounts in tissues. These results indicate that the mRNA levels
of target genes in gastric tissues were largely consistent with
those of the cell lines. Additionally, these results from
semiquantitative RT-PCR are in relatively good agreement with
the DNA microarray data.
Verification of Protein Levels for Selected Genes Using
Western Blotting and Immunohistochemistry
We verified the protein levels for genes that had been
confirmed by RT-PCR using Western blotting for nine gastric
normal and cancer cell lines, and immunohistochemistry for six
gastric tissues. Because antibodies for only CDC20 and SKB1
were available, these two proteins were selected as targets.
As shown in the Western blotting of Fig. 2A , high levels of
protein for CDC20 were detected in the gastric cancer cell lines
in comparison with the normal cell line, especially for SNU-601,
SNU-638, and SNU-719. The immunohistochemistry also
showed that CDC20 was highly detected in gastric tumor tissue,
although it was present in normal tissue from the patient samples
(Fig. 2B , a-c). However, differently from normal tissue, it was
localized in perinuclear region of the cell in tumor tissues and the
localization change was more strongly detected in poorly
differentiated gastric tumors. Otherwise, when the protein level
for SKB1 was checked by Western blotting, it was also detected
Fig. 2 Western blotting and immunohisto-chemistry for selected genes identified by thecDNA microarray. A, Western blot analysis ofCDC20 and SKB1 in gastric cell lines. Equalamounts of cell lysates (50 Ag) were resolvedby SDS-PAGE, transferred to PVDF mem-brane, and probed with specific antibodies(anti-CDC20 and anti-SKB1) and anti-h-actinantibody as control for protein level. B,immunohistochemical staining for CDC20and SKB1 in the gastrointestinal tumortissues. These photographs depict representa-tive areas from the normal gastrointestinaltissues (a and d), moderately differentiated (band e) and poorly differentiated gastrointes-tinal tumor tissues (c and f ). a-c, CDC20; d-f, SKB1. Bars, 100 Am (a-f ).
Clinical Cancer Research 479
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
at high levels in gastric cancer cell lines. In particular, the
amounts expressed were dramatically high in SNU-1, SNU-16,
SNU-216, and SNU-638 (Fig. 2A). It is also noteworthy that a
large band, higher than the 70 kDa band, corresponding to
SKB1, was detected for SNU-216, which is thought to be the
result of the post-modification of SKB1 or an alternative
transcript. This band was also faintly detected in Hs 677.St.
Figure 2B (d-f) shows immunohistochemical results for SKB1 in
gastric normal and tumor tissues from the patient samples. As
predicted, it was highly expressed in gastric tumors compared
with normal tissue. As shown in CDC20, a change in
localization for SKB1, mainly in the nuclear region, also
detected in tumor tissues. These results indicate that an increase
in the mRNA level for CDC20 and SKB1 in gastric tumor
tissues coupled with that of the protein level and the change in
the amount produced and their localization are associated with
carcinogenesis in gastric tumors.
DISCUSSIONcDNA microarray technologies aid in analyses of the
expression levels of several thousands of genes for multiplesamples at the same time. Numerous attempts to identify genesrelated to carcinogenesis of various cancers including gastriccancer using a DNA microarray have been reported (10–17, 22).We selected ESTs having a low homology or no hits with ESTsin public databases from our Korean UniGene Information ESTsclone bank and used this as a DNA source for the fabrication of amicroarray in order to identify novel genes that are associatedwith gastric cancer. All of the selected 1,995 ESTs were novelESTs at the first stage. However, because a considerable amountof EST data has been recently submitted to public databases byrapid advances in high-throughput sequencing, of these ESTs,only 60 genes (3%), in a homology analysis against updatedpublic databases represented novel ESTs which are sacrificedwith the first criteria. However, as shown in Table 2, 1,309 ESTsexcluding known human genes were classified as novel genes.When 2K microarray experiments using 1,995 cDNAwere done,the signal intensities obtained were generally lower than those ofa 14K cDNA microarray fabricated from our 143,452 ESTs (datanot shown). In addition, the results of RT-PCR for the targetgenes indicated that the mRNA levels of many of the genes werevery low or not detectable. These results indicate that the genesincluded in the 2K microarray were rarely expressed in cells andthat the difference in expression of these genes also can be easilyexcluded, compared with those of abundantly expressed genes.Therefore, our 2K microarray might be potentially useful inidentifying rare genes related to stomach cancer.
When the expression profiles of the gastric cancer cells and
the normal cells were compared using our 2K microarray, 40
genes showing significant differences were found. Difference in
the expression of these genes was also confirmed by semiquan-
titative RT-PCR data, collected from gastric cell lines and tissues
from patients. Among the selected genes, several genes related to
the cell cycle, CKS1B , CDC20 , and SKB1 , were identified as
up-regulated genes. Interestingly, the CDC20 and SKB1 genes
were highly represented with a very high frequency of 88% and
68% in gastric tumor tissues in comparison with normal tissues,
although the CKS1B transcript was not detected in gastric tissues
because of the low expression. Furthermore, a higher expression
of two genes in gastric cancers was also detected by their protein
level using Western blotting and immunohistochemistry. These
results indicate that the up-regulation of two genes coupled
transcription to translation. These results also showed changes in
the localization of these proteins in tumor tissues, from the
cytosol to the perinuclear region for CDC20 and to the nucleus
for SKB1, respectively. These findings indicate that the amount
of change of these genes that encoded transcript and protein as
well as the change in localization is correlated with the
oncogenesis of human gastric cancer.
CDC20 is known to directly bind to the anaphase-
promoting complex with hCDH1 and activates anaphase-
promoting complex by which anaphase is initiated and mitosis
is terminated (23). The overexpression of CDC20 has previously
been reported in human pancreatic cancer (24) and its alteration
has also been detected in early-stage lung adenocarcinoma (25).
The up-regulation of CDC20 in gastric cancer was confirmed by
gene expression data linked to SOURCE in which CDC20 and
CKS1B has been reported to be up-regulated in gastroesophageal
adenocarcinomas (26). Meanwhile, the up-regulation of CDC20
has been reported to be related to apoptosis in Taxol-induced
HeLa cells and NIH3T3 (27), myeloid cells (28, 29). Therefore,
it is likely that function of the CDC20 in cells may depend on the
stage, type and environments of the cells. CKS1B has been
known to be a CDC28 protein kinase regulatory subunit 1B. The
overexpression of CKS1B has been previously reported in gastric
cancer (15, 22) and in pancreatic cancer (12). CKS1B has also
been proposed to facilitate the transcription of the CDC20 gene
through the remodeling of transcriptional complexes or chroma-
tin that is associated with the CDC20 gene (30). These finding
suggest that CDC20 and CKS1B may act sequentially in the
tumorigenesis of gastric cancer, although it has not been reported
that CDC20 is related to gastric cancer. It has previously been
reported that SKB1 in fission yeast plays a role in the control of
cell polarity (31), in the negative regulation of mitosis (32), and
in the coordination of cell cycle progression (33). It has also
been proposed to act as a mediator of the hyperosmotic stress
response (34), but its relation to oncogenesis has not yet been
reported.
Genes involving nucleotide metabolism, DNA repair, and
cholesterol biosynthesis such as NT5C3 , p30 , FEN1 , and
ZNF9 are also up-regulated in gastric cancer cells, as evidenced
from the microarray data as well as semiquantitative RT-PCR.
In particular, FEN1 was highly expressed with a high
frequency of 72% in gastric tumor tissues, compared with
normal tissues. These observation are consistent with the
finding that increased FEN1 expression leads to rapid tumor
progression of mouse gastrointestinal tract cancer in a haplo-
insufficient manner (35). The up-regulation of the gene has also
been reported in human lung cancer cell lines (36). It has been
reported that a deficiency in NT5C3 causes an autosomal
recessive hemolytic anemia (37) and ZNF9 involve in
myotonic dystrophy 2 (38). p30 has been identified as a
component of a purified nucleoporin fraction from rat liver nuclei
(39). Although these genes have not been reported to be related to
human gastric cancer, they do, in fact, seem to be new candidates
for gastric cancer, on based on the results herein, because the up-
regulation of these genes was detected in gastric tumor tissues
with a high frequency of 40% to 72%.
Identification of Gastric Cancer–Related Novel Genes480
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
On the other hand, of the down-regulated genes in gastric
cancer, MT2A was down-expressed with a high frequency of
72% in tumor tissues from the IB to IV stages. It is known to be
involved in the regulation of carcinogenesis and apoptosis such
as an activator of cell proliferation and an inhibitor of apoptosis,
as well as various other physiologic processes (40, 41). Although
this gene has been reported to be up-regulated in human breast
cancers (42) and esophageal cancer (41), its expression is known
to be down-regulated in gastroesophageal adenocarcinomas in
gene expression data linked to SOURCE (26). Thus, it is likely
that MT2A expression in tumor cells may depend on the
developmental stage or the specific type of tumor. Genes such as
LGALS1 and CXX1 were also down-regulated. LGALS1 is
known to regulate cell apoptosis and to act as an autocrine-
negative growth factor that regulates cell proliferation. Our data
indicated that it represents a high priority candidate among the
down-regulated genes in stomach cancer cell lines in comparison
with normal cell lines, although it was not detected in stomach
tissue because of its low abundance. However, contrary to our
data, the up-regulation of LGALS1 has been reported in several
tumors such as head and neck squamous carcinoma (43), human
colon cancer (44, 45), and human pancreatic cancer (46). These
observations imply that the mechanism of LGALS1 in human
gastric cancer might be different from that reported for other
cancers. Reports concerning CXX1 being down-regulated in
tumor tissues with a frequency of about 32%, except having a
CAAX box 1 have not yet appeared.
Some tumor suppressor genes and oncogenes under the
control of genomic change were clustered in specific chromo-
somal regions. The data herein indicate that some of the up-
regulated genes were clustered in chromosome 17p11.2 and
chromosome 19q13, and some of the down-regulated genes
in chromosome 17q21. These observations are supported by
previous findings showing that the amplification and rearrange-
ment of chromosome 17p11.2 occurred at a high frequency in
Birt-Hogg-Dube syndrome (47), osteosarcoma (48, 49), and
glioma (50), and the breakpoint of chromosomal abnormalities
at band chromosome 19q13 is frequently found in primary
gastric cancer (51). The presence of tumor suppressor genes on
chromosome 17q21 is also supported by the proposal that chro-
mosome 17q21, including the BRCA1 locus, may contain a
candidate for tumor suppressor genes in gastric cancer (52).
These reports and our data imply that the up-regulated genes
clustered on chromosome 17p11.2 and chromosome 19q13
might be candidates for an oncogene, and the down-regulated
genes on chromosome 17q21 candidates for a tumor suppressor.
Several groups have recently reported on the results of
expression profile analyses in gastric cancers using high-density
microarrays (15–17, 22, 53–59). The candidate genes reported
by these groups were mostly abundantly or intermediately
expressed genes in gastric cancers, whereas many of our
candidate genes are rarely expressed genes or novel genes
which were seldom selected by other groups. By combining
these results, as mechanisms related to gastric cancer pathogen-
esis and progression, we propose that up-regulated CKS1B in
gastric cancer cells might promote the expression of CDC20, the
highly induced the CDC20 would also increase the activation of
anaphase-promoting complex and the initiation of anaphase and
the progression of the cell cycle then be accelerated. In addition,
of hypoxia related proteins induced by HIF-1a, glycolytic
enzymes such as GAPD, ENO1, PKM2, PGK1, and LDHA have
been reported to up-regulated in gastric cancer (18, 60). GPI, an
enzyme involved in glycolysis, is known to be a hypoxia-
inducible factor in other forms of cancer (61). The findings here
indicate that this gene is up-regulated in gastric cancer cell lines.
From these results, one possibility is that the HIF-1a signaling
pathway might be related to the pathogenesis and progression of
gastric cancer. These newly identified genes should provide
valuable resources for developing an understanding of the
molecular mechanism associated with tumorigenesis of gastric
cancer and for discovering potential diagnostic markers for
gastric cancer.
ACKNOWLEDGMENTSWe thank Dr. Young-il Yeom for spotting the DNAs on the slides.
REFERENCES
1. Mitelman F. Catalogue of chromosome aberrations in cancer.Cytogenet Cell Genet 1983;36:1–515.
2. Neugut AI, Hayek M, Howe G. Epidemiology of gastric cancer.Semin Oncol 1996;23:281–91.
3. Lee HJ, Yang HK, Ahn YO. Gastric cancer in Korea. Gastric Cancer2002;5:177–82.
4. Roukos DH. Current status and future perspectives in gastric cancermanagement. Cancer Treat Rev 2000;26:243–55.
5. Werner M, Becker KF, Keller G, Hofler H. Gastric adenocarcinoma:pathomorphology and molecular pathology. J Cancer Res Clin Oncol2001;127:207–16.
6. Park WS, Oh RR, Park JY, et al. Somatic mutations of the trefoilfactor family 1 gene in gastric cancer. Gastroenterology 2000;119:691–8.
7. Li QL, Ito K, Sakakura C, et al. Causal relationship between the lossof RUNX3 expression and gastric cancer. Cell 2002;109:113–24.
8. DeRisi J, Penland L, Brown PO, et al. Use of a cDNA microarrayto analyse gene expression patterns in human cancer. Nat Genet1996;14:457–60.
9. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expressionprofiling using cDNA microarrays. Nat Genet 1999;21:10– 4.
10. Ross DT, Scherf U, Eisen MB, et al. Systematic variation in geneexpression patterns in human cancer cell lines. Nat Genet 2000;24:227–35.
11. Wikman H, Kettunen E, Seppanen JK, et al. Identification ofdifferentially expressed genes in pulmonary adenocarcinoma by usingcDNA array. Oncogene 2002;21:5804–13.
12. Han H, Bearss DJ, Browne LW, Calaluce R, Nagle RB, Von Hoff DD.Identification of differentially expressed genes in pancreatic cancer cellsusing cDNAmicroarray. Cancer Res 2002;62:2890–6.
13. Jiang Y, Harlocker SL, Molesh DA, et al. Discovery of differentiallyexpressed genes in human breast cancer using subtracted cDNA librariesand cDNA microarrays. Oncogene 2002;21:2270–82.
14. Yang SH, Kim JS, Oh TJ, et al. Genome-scale analysis ofresveratrol-induced gene expression profile in human ovarian cancercells using a cDNA microarray. Int J Oncol 2003;22:741–50.
15. El-Rifai W, Frierson HF Jr, Harper JC, Powell SM, Knuutila S.Expression profiling of gastric adenocarcinoma using cDNA array. Int JCancer 2001;92:832–8.
16. Ji J, Chen X, Leung SY, et al. Comprehensive analysis of the geneexpression profiles in human gastric cancer cell lines. Oncogene2002;21:6549–56.
17. Lee S, Baek M, Yang H, et al. Identification of genes differentiallyexpressed between gastric cancers and normal gastric mucosa withcDNA microarrays. Cancer Lett 2002;184:197–206.
18. Kim NS, Hahn Y, Oh JH, et al. Gene cataloging and expression
Clinical Cancer Research 481
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
profiling in human gastric cancer cells by expressed sequence tags.Genomics 2004;83:1024–45.
19. Park JG, Frucht H, LaRocca RV, et al. Characteristics of cell linesestablished from human gastric carcinoma. Cancer Res 1990;50:2773–80.
20. Park JG, YangHK,KimWH, et al. Establishment and characterizationof human gastric carcinoma cell lines. Int J Cancer 1997;70:443–9.
21. Tusher VG, Tibshirani R, Chu G. Significance analysis of micro-arrays applied to the ionizing radiation response. Proc Natl Acad SciU S A 2001;98:5116–21.
22. Hippo Y, Taniguchi H, Tsutsumi S, et al. Global gene expressionanalysis of gastric cancer by oligonucleotide microarrays. Cancer Res2002;62:233–40.
23. Fang G, Yu H, Kirschner MW. Direct binding of CDC20 proteinfamily members activates the anaphase-promoting complex in mitosisand G1. Mol Cell 1998;2:163–71.
24. Li D, Zhu J, Firozi PF, et al. Overexpression of oncogenic STK15/BTAK/Aurora A kinase in human pancreatic cancer. Clin Cancer Res2003;9:991–7.
25. Singhal S, Amin KM, Kruklitis R, et al. Alterations in cell cyclegenes in early stage lung adenocarcinoma identified by expressionprofiling. Cancer Biol Ther 2003;2:291–8.
26. Su AI, Welsh JB, Sapinoso LM, et al. Molecular classification ofhuman carcinomas by use of gene expression signatures. Cancer Res2001;61:7388–93.
27. Makino K, Yu D, Hung MC. Transcriptional upregulation andactivation of p55Cdc via p34(cdc2) in Taxol-induced apoptosis.Oncogene 2001;20:2537–43.
28. Kao CT, Lin M, O’Shea-Greenfield A, Weinstein J, Sakamoto KM.Over-expression of p55Cdc inhibits granulocyte differentiation andaccelerates apoptosis in myeloid cells. Oncogene 1996;13:1221–9.
29. Lin M, Mendoza M, Kane L, Weinstein J, Sakamoto KM. Analysisof cell death in myeloid cells inducibly expressing the cell cycle proteinp55Cdc. Exp Hematol 1998;26:1000–6.
30. Morris MC, Kaiser P, Rudyak S, Baskerville C, Watson MH,Reed SI. Cks1-dependent proteasome recruitment and activation ofCDC20 transcription in budding yeast. Nature 2003;424:1009–13.
31. Wiley DJ, Marcus S, D’urso G, Verde F. Control of cell polarity infission yeast by association of Orb6p kinase with the highly conservedprotein methyltransferase Skb1p. J Biol Chem 2003;278:25256–63.
32. Gilbreth M, Yang P, Bartholomeusz G, et al. Negative regulationof mitosis in fission yeast by the shk1 interacting protein skb1 andits human homolog, Skb1Hs. Proc Natl Acad Sci U S A 1998;95:14781–6.
33. Krapivinsky G, Pu W, Wickman K, Krapivinsky L, Clapham DE.pICln binds to a mammalian homolog of a yeast protein involved inregulation of cell morphology. J Biol Chem 1998;273:10811–4.
34. Bao S, Qyagng Y, Yang P, et al. The highly conserved proteinmethyltransferase, Skb1, is a mediator of hyperosmotic stress responsein the fission yeast Schizosaccharomyces pombe . J Biol Chem 2001;276:14549–52.
35. Kucherlapati M, Yang K, Kuraguchi M, et al. Haploinsufficiency ofFlap endonuclease (Fen1) leads to rapid tumor progression. Proc NatlAcad Sci U S A 2002;99:9924–9.
36. Sato M, Girard L, Sekine I, et al. Increased expression and nomutation of the Flap endonuclease (FEN1) gene in human lung cancer.Oncogene 2003;22:7243–6.
37. Marinaki AM, Escuredo E, Duley JA, et al. Genetic basis ofhemolytic anemia caused by pyrimidine 5V nucleotidase deficiency.Blood 2001;97:3327–32.
38. Liquori CL, Ricker K, Moseley ML, et al. Myotonic dystrophy type2 caused by a CCTG expansion in intron 1 of ZNF9. Science 2001;293:864–7.
39. Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT, Matunis MJ.Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol2002;158:915–27.
40. Huang G, Zhou S, Du H. Study on role of metallothionein inanticancer effect of copper green on treatment of experimental
hepatocarcinoma in mice. Zhongguo Zhong Xi Yi Jie He Za Zhi2000;20:368–70.
41. Cui Y, Wang J, Zhang X, et al. ECRG2, a novel candidate of tumorsuppressor gene in the esophageal carcinoma, interacts directly withmetallothionein 2A and links to apoptosis. Biochem Biophys ResCommun 2003;302:904–15.
42. Jin R, Chow VT, Tan PH, Dheen ST, Duan W, Bay BH.Metallothionein 2A expression is associated with cell proliferation inbreast cancer. Carcinogenesis 2002;23:81–6.
43. Gillenwater A, Xu XC, Estrov Y, Sacks PG, Lotan D, Lotan R.Modulation of galectin-1 content in human head and neck squamouscarcinoma cells by sodium butyrate. Int J Cancer 1998; 75:217–24.
44. Ohannesian DW, Lotan D, Lotan R. Concomitant increases ingalectin-1 and its glycoconjugate ligands (carcinoembryonic antigen,lamp-1, and lamp-2) in cultured human colon carcinoma cells by sodiumbutyrate. Cancer Res 1994;54:5992–6000.
45. Hittelet A, Legendre H, Nagy N, et al. Upregulation of galectins-1and -3 in human colon cancer and their role in regulating cell migration.Int J Cancer 2003;103:370–9.
46. Berberat PO, Friess H, Wang L, et al. Comparative analysis ofgalectins in primary tumors and tumor metastasis in human pancreaticcancer. J Histochem Cytochem 2001;49:539–49.
47. Schmidt LS, Warren MB, Nickerson ML, et al. Birt-Hogg-Dubesyndrome, a genodermatosis associated with spontaneous pneumothoraxand kidney neoplasia, maps to chromosome 17p11.2. Am J Hum Genet2001;69:876–82.
48. van Dartel M, Cornelissen PW, Redeker S, et al. Amplification of17p11.2 approximately p12, including PMP22, TOP3A, and MAPK7, inhigh-grade osteosarcoma. Cancer Genet Cytogenet 2002;139:91–6.
49. Lau CC, Harris CP, Lu XY, et al. Frequent amplification andrearrangement of chromosomal bands 6p12-p21 and 17p11.2 inosteosarcoma. Genes Chromosomes Cancer 2004;39:11–21.
50. van Dartel M, Leenstra S, Troost D, Hulsebos TJ. Infrequent buthigh-level amplification of 17p11.2 approximately p12 in human glioma.Cancer Genet Cytogenet 2003;140:162–6.
51. Ochi H, Douglass HO Jr, Sandberg AA. Cytogenetic studies inprimary gastric cancer. Cancer Genet Cytogenet 1986;22:295–307.
52. Semba S, Yokozaki H, Yasui W, Tahara E. Frequent microsatelliteinstability and loss of heterozygosity in the region including BRCA1(171) in young patients with gastric cancer. Int J Oncol 1998;12:1245–51.
53. Kim B, Bang S, Lee S, et al. Expression profiling and subtype-specific expression of stomach cancer. Cancer Res 2003;63:8248–55.
54. Tay ST, Leong SH, Yu K, et al. A combined comparative genomichybridization and expression microarray analysis of gastric cancerreveals novel molecular subtypes. Cancer Res 2003;63:3309–16.
55. Boussioutas A, Li H, Liu J, et al. Distinctive patterns of geneexpression in premalignant gastric mucosa and gastric cancer. CancerRes 2003;63:2569–77.
56. Hasegawa S, FurukawaY, Li M, et al. Genome-wide analysis ofgene expression in intestinal-type gastric cancers using a complementaryDNA microarray representing 23,040 genes. Cancer Res 2002;62:7012–7.
57. Inoue H, Matsuyama A, Mimori K, Ueo H, Mori M. Prognosticscore of gastric cancer determined by cDNA microarray. Clin Cancer Res2002;8:3475–9.
58. Sakakura C, Hagiwara A, Nakanishi M, et al. Differential geneexpression profiles of gastric cancer cells established from primarytumour and malignant ascites. Br J Cancer 2002;87:1153–61.
59. Chen X, Leung SY, Yuen ST, et al. Variation in gene expressionpatterns in human gastric cancers. Mol Biol Cell 2003;14:3208–15.
60. Meireles SI, Carvalho AF, Hirata R, et al. Differentially expressedgenes in gastric tumors identified by cDNA array. Cancer Lett 2003;190:199–211.
61. Naughton DP. Hypoxia-induced upregulation of the glycolyticenzyme glucose-6-phosphate isomerase perpetuates rheumatoid arthritis.Med Hypotheses 2003;60:332–4.
Identification of Gastric Cancer–Related Novel Genes482
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Correction: Article on Identification of Gastric-Related Genes Using a cDNAMicroarray
In the article on Identification of Gastric-Related Genes in the January 15, 2005 issue ofClinical Cancer Research , the name of an author, Hyang-Sook Yoo, was misspelled.
Kim JM, Sohn HY, Yoon SY, et al. Identification of gastric cancer-related genes using acDNA microarray containing novel expressed sequence tags expressed in gastric cancer cells.Clin Cancer Res 2005:11:473–82.
www.aacrjournals.org Clin Cancer Res 2005;11(8) April 15, 20053149
Corrections
2005;11:473-482. Clin Cancer Res Jeong-Min Kim, Ho-Yong Sohn, Sun Young Yoon, et al. Tags Expressed in Gastric Cancer CellscDNA Microarray Containing Novel Expressed Sequence
Related Genes Using a−Identification of Gastric Cancer
Updated version
http://clincancerres.aacrjournals.org/content/11/2/473
Access the most recent version of this article at:
Cited articles
http://clincancerres.aacrjournals.org/content/11/2/473.full#ref-list-1
This article cites 61 articles, 21 of which you can access for free at:
Citing articles
http://clincancerres.aacrjournals.org/content/11/2/473.full#related-urls
This article has been cited by 13 HighWire-hosted articles. Access the articles at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's
.http://clincancerres.aacrjournals.org/content/11/2/473To request permission to re-use all or part of this article, use this link
Research. on August 8, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from