MUTATION IN BRIEF

HUMAN MUTATION Mutation in Brief #329 (2000) Online

© 2000 WILEY-LISS, INC.

Received 17 January 2000; Revised manuscript accepted 14 March 2000.

Identification of Four Single NucleotidePolymorphisms in DNA Repair Genes: XPA and XPB(ERCC3) in Polish PopulationDorota Butkiewicz 1, Marek Rusin 1, Curtis C. Harris 2 and Mieczyslaw Chorazy 1

1Department of Tumor Biology, Centre of Oncology-M. Sklodowska-Curie Memorial Institute, 44-101 Gliwice,Poland; 2 Laboratory of Human Carcinogenesis, National Cancer Institute, NIH, Bethesda, MD 20892-4255,USA.

*Correspondence to Dorota Butkiewicz, Department of Tumor Biology, Centre of Oncology-M. Sklodowska-Curie Memorial Institute, Wybrzeze Armii Krajowej 15, 44-101 Gliwice, Poland; Fax: +48 32 231 35 12; E-mail:dorotab@rocketmail.com.

Contract grant sponsor: The Polish-American MSC Fund II and Polish State Committee for Scientific Research;Contract grant number: MZ/NIH-97-313 and KBN 4 P05A 06217.

Communicated by R.G.H. Cotton

A deficiency in DNA repair is associated with increased cancer risk. Inter-individualvariations in DNA repair capacity observed in humans may result from geneticpolymorphisms in DNA repair genes. In order to provide a basis for future functional andmolecular epidemiology studies on cancer susceptibility, we screened 35 individuals forpolymorphisms in coding regions of XPA and XPB genes involved in nucleotide excisionrepair (NER). Relevant cDNA sequences were amplified by PCR, sequenced withfluorescently labeled terminators and analyzed with automated sequencer. Twopolymorphisms in XPB were found: AAA→→AGA (445A>G; GenBank M31899) causingK117R substitution and GGC→→TGC (1299G>T; GenBank M31899) causing G402Cexchange. Also, two polymorphisms in XPA were detected: CGA→→CAA (709G>A; GenBankD14533) causing R228Q exchange, and A→→G (23A>G; GenBank D14533) substitution in the5’ non-coding region of the gene. The three aforementioned amino acid substitutions wereuncommon in this population (1.4%). In contrast, the substitution located 4 nucleotidesupstream of the ATG start codon of XPA was frequent (57%). To our best knowledge this isthe first report of these sequence variants. The location of these polymorphisms inevolutionary conserved regions suggest that they may be of functional significance. © 2000Wiley-Liss, Inc.

KEY WORDS: DNA repair; XPB; ERCC3; XPA; single-nucleotide polymorphism; SNP

INTRODUCTION

The nucleotide excision repair (NER) pathway is involved in removing a wide range of lesions, includingUV-induced photoproducts and bulky DNA adducts (de Laat et al., 1999). A reduced DNA repair capacity isassociated with increased cancer risk (Wei and Spitz, 1997). Inherited defect in NER genes leads to cancer-pronesyndrome xeroderma pigmentosum (XP) (Bootsma et al., 1998). Inter-individual differences in DNA repair

2 Butkiewicz et al.

capacity and a level of DNA damage observed in human population may be the result of functional polymorphismsin DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies oncancer susceptibility, we searched for new polymorphisms in entire coding regions of two NER genes – XPA(MIM# 278700), coding for zinc-finger DNA binding protein responsible for damage recognition (Cleaver andStates, 1997), and XPB (ERCC3; MIM# 133510), coding for 3’ to 5’ DNA helicase, being a component of TFIIHcomplex, involved in transcription, NER as well as in apoptosis (Schaeffer et al., 1994, Wang et al., 1996, Ellis,1997).

MATERIALS AND METHODS

Thirty-five unrelated individuals free from cancer participated voluntary in the study. They all wereCaucasians living in the Upper Silesia, Poland. RNAs from 1.5 ml of fresh blood samples were isolated withQIAamp RNA Blood Mini Kit (QIAGEN) according to the manufacturer’ protocol. Then, cDNA was synthesizedwith random hexamers using GeneAmp RNA PCR Kit (Perkin Elmer) according to the protocol and was subjectedto PCR amplification. The following PCR primers (5’→ 3’; based on the sequences published in GenBank -U16815, D14533, M31899) were used: XPA fragment 1 (sense) TCAGAAAGGCCGCTGGGT, (anti-sense)CATATCACCCCATTGTGAATG, fragment 2 (sense) AACCACTTTGATTTGCCAAC, (anti-sense)TTCATCTATGAAGATGTTGC, XPB fragment 1 (sense) TTCCGGATTGAGCCGGAAGT, (anti-sense)ATTCTCGGATCACGGGGTCCT, fragment 2 (sense) GAAGCTCAGCAAGACTGGA, (anti-sense)CTCCACAGAAACAGCTGAGT, fragment 3 (sense) CTCAGACCCTATCAGGAGAA, (anti-sense)AATCTTGTCATTCCTCCTTTC, fragment 4 (sense) GGTGCCCTATGTCTCCTGAA, (anti-sense)CTCCATGCCAGCGAGTTTC, fragment 5 (sense) TAGGGCGGGTGCTTCGAGCTAA, (anti-sense)ACAATTTGGCCAACGCTGGA. PCR reactions contained: 4 µl of cDNA and 16 µl of reaction mix consisted of1x PCR buffer II (50 mM KCl, 10 mM Tris-HCl pH 8.3), 1 mM (for XPA fragment 1) or 1.5 mM (for XPAfragment 2) or 0.8 mM (for all XPB fragments) MgCl2, 10 pmoles of each primer and 1 U of AmpliTaq Gold. AllPCR reagents were from Perkin Elmer. The temperature profile of amplification was: XPA fragment 1 - 940C 60sec, 550C 60 sec, 720C 60 sec; XPA fragment 2 - 940C 60 sec, 520C 60 sec, 720C 60 sec; XPB fragments 1, 3-5 -940C 60 sec, 540C 60 sec, 720C 60 sec; XPB fragment 2 - 940C 60 sec, 560C 60 sec, 720C 60 sec. PCR started withinitial denaturation (940C 12 min) and ended with final extension (720C 4 min) and 35-40 cycles were performedin Thermal Cycler 480 (Perkin Elmer). PCR products were purified before sequencing with exonuclease andshrimp alkaline phosphatase according to the manufacturer’ protocol (Amersham Life Science). Both strands weresequenced with BigDye Terminator Cycle Sequencing Kit (Perkin Elmer) according to the enclosed protocol. Thefollowing primers (5’→ 3’) were used for sequencing: XPA fragment 1 (sense) AGGCGGTGCAGGGCGGCT,anti-sense primer same as for PCR, fragment 2 (sense) TTGTGATAACTGCAGAGATG, (anti-sense)GAATTTTGAAAAGGACCAATC, XPB fragment 1 sense primer same as for PCR, (anti-sense)TGGAGAAGATGCTGGATTAC, fragment 2 (sense) CCCTGATGGAATTATGCAGT, (anti-sense)AGACAGCGTTTTCTGACAGT, fragment 3 sense primer same as for PCR, (anti-sense)TGAAACTTGATCAGAAACTGG, fragment 4 (sense) ACCGGGAATATGTGGCAATC, (anti-sense)CGTGATCACCTTGAAGCTAT, fragment 5 (sense) TGCAGAAGAGTACAATGCCT, (anti-sense)GAAGGTCAAAGAGGTGGAAG. The sequencing products were analyzed with the ABI Prism 377 DNAautomated sequencer (Perkin Elmer). When a polymorphism was found it was confirmed by repeating the PCRand sequencing in both directions.

RESULTS AND DISCUSSION

Thirty-five healthy individuals were screened for polymorphisms in the coding regions of XPA and XPBgenes. Four single nucleotide substitutions were detected – two in the XPA gene and two in the XPB gene - andhad not been previously observed. For three variants only a single heterozygote was found (rarer allele frequency0.014): CGA→CAA (709G>A; GenBank D14533) substitution in exon 6 of XPA causing R228Q exchange,AAA→AGA (445A>G; GenBank M31899) in exon 3 of XPB causing K117R and GGC→TGC (1299G>T;GenBank M31899) in exon 8 of XPB causing G402C (Table 1). One common polymorphism was also found in the5’ non-coding region of the XPA gene, i.e. A→G (23A>G; GenBank D14533) substitution in the nucleotide –4from ATG start codon. There were 6 (17 %) AA homozygotes, 18 (51.5 %) AG heterozygotes and 11 (31.5 %) GGhomozygotes (G allele frequency 0.57). Thus, the allele reported in GenBank (D14533 or U16815) is less common

New Polymorphisms in XPA and XPB Genes 3

in our group. Although K117R and G402C substitutions in XPB are not located in the known helicase motif (Ellis,1997), both are in residues highly conserved through evolution (both conserved from human to Drosophilamelanogaster, and K117R, additionally, in yeast Saccharomyces cerevisiae) that suggests a possible functionalsignificance of these polymorphisms (Table 2). Moreover, the polymorphism in codon 402 of the XPB results insubstitution of an aliphatic side chain amino acid with an amino acid containing a highly reactive sulfhydryl groupthat may possibly affect protein’ function. The R228 of XPA also is an evolutionary conserved amino acid inhuman, mouse, chicken and in frog Xenopus laevis (Table 2). It is located in the region critical for XPA functions,i.e. for interactions with TFIIH multiprotein complex during DNA repair processes (Cleaver and States, 1997).

In summary, the characteristics and location of these new polymorphisms support the hypothesis that they maybe related to the variations in DNA repair capacity in humans and that some of the DNA repair genes may have thepotential to become cancer susceptibility genes. However, the functional in vitro as well as case-control molecularepidemiology studies are required.

Table 1. Summary of single-nucleotide polymorphisms reported in the study.

Gene Segment Positiona VariationbAmino acidexchange

Polymorphicallele frequency

XPAXPAXPBXPB

5’ regionexon 6exon 3exon 8

23709445

1299

GGGCC A/G GAGATGCGGC G/A GCAGTGTACA A/G ACTAACCATC G/T GCTGC

-R228QK117RG402C

0.570.0140.0140.014

a based on the sequences from the GenBank (D14533 and M31899);b polymorphic residues underlined (the common nucleotide followed by the variant).

Table 2. Conservation of amino acid residues (one letter amino acid abbreviations) at and around thepolymorphic sites found in the human XPA (R228Q) and XPB (K117R and G402C).

Species and proteina 228Human XPAMouse XPAXenopus laevis XPAChicken XPAD. melanogaster XPA

V***M

K****

E***Q

L****

R****

R***M

A*T*E

VI***

R****

S****

S****

Species and proteina 117Human XPBMouse XPBD. melanogaster XPBS. cerevisiae RAD25

H***

V*II

H***

E***

Y***

K***

L**I

T***

A***

Y***

S***

Species and proteina 402Human XPBMouse XPBD. melanogaster XPBS. cerevisiae RAD25

K***

D**E

K**M

P**-

I*M-

G**E

C**S

S*T*

V*IL

A*LV

I*VV

a based on PredictProtein, TREMBL and SWISS-PROT data bases.

REFERENCES

Bootsma D., Kraemer KH, Cleaver J, Hoeijmakers JHJ. 1998. Nucleotide excision repair syndromes: xeroderma pigmentosum,Cockayne syndrome and trichothiodystrophy. In: Vogelstein B., Kinzler KW, editors. The Genetic Basis of Human Cancer.New York: McGraw-Hill, p 245-274.

Cleaver JE, States JC. 1997. The DNA damage-recognition problem in human and other eukaryotic cells: the XPA damagebinding protein. Biochem J 328: 1-12.

Ellis NA. 1997. DNA helicases in inherited human disorders. Curr Op Genet Develop 7: 354-63.

4 Butkiewicz et al.

de Laat WL, Jaspers NGJ, Hoeijmakers JHJ. 1999. Molecular mechanism of nucleotide excision repair. Genes Develop 13:768-785.

Schaeffer L, Roy R, Humbert S, Moncollin V, Vermeulen W, Hoeijmakers JH, Chambon P, Egly JM. 1994. DNA repairhelicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260: 58-63.

Wang XW, Vermeulen W, Coursen JD, Gibson M, Lupold SE, Forrester K, Xu G, Elmore L, Yeh H, Hoeijmakers JHJ, HarrisCC. 1996. The XPB and XPD DNA helicases are components of the p53-mediated apoptosis pathway. Genes Develop 10:1219-32.

Wei Q, Spitz MR. 1997. The role of DNA repair capacity in susceptibility to lung cancer: a review. Cancer Metastat Rev 16:295-307.