Identification and properties of an inducible phenylacyl-CoA dehydrogenase in Pseudomonas putida KT2440

Identi¢cationandproperties ofan inducible phenylacyl-CoAdehydrogenase inPseudomonasputida KT2440Brian McMahon & Stephen G. Mayhew

UCD School of Biomolecular and Biomedical Science, and Centre for Synthesis and Chemical Biology, Conway Institute for Biomolecular and

Biomedical Research, University College Dublin, Belfield, Dublin, Ireland

Correspondence: Stephen G. Mayhew, UCD

School of Biomolecular and Biomedical

Science, and Centre for Synthesis and

Chemical Biology, Conway Institute for

Biomolecular and Biomedical Research,

University College Dublin, Belfield, Dublin 4,

Ireland. Tel.: 1353 1 7166780; fax: 1353 1

2837211; e-mail: [email protected]

Received 9 March 2007; revised 24 April 2007;

accepted 25 April 2007.

First published online 7 June 2007.

DOI:10.1111/j.1574-6968.2007.00780.x

Editor: Dieter Jahn

Keywords

phenylacyl-CoA; dehydrogenase;

phenylalkanoate; Pseudomonas putida .

Abstract

A novel acyl-CoA dehydrogenase that initiates b-oxidation of the side chains of

phenylacyl-CoA compounds by Pseudomonas putida was induced by growth with

phenylhexanoate as carbon source. It was identified as the product of gene

PP_0368, which was cloned and overexpressed in Escherichia coli. This phenyla-

cyl-CoA dehydrogenase was found to be dimeric with a subunit molecular mass of

66 kDa, to contain FAD and to be active with phenylacyl-CoA substrates having

side chains from four to at least 11 carbon atoms. The same enzyme was induced

by the aliphatic alkanoate octanoate. The optimal aliphatic substrates for the

enzyme were palmitoyl-CoA and stearoyl-CoA, a property shared with mamma-

lian very-long-chain acyl-CoA dehydrogenases. The FAD in the enzyme was

reduced by aromatic and aliphatic substrates, with changes to the oxidation–

reduction potential. Chemical reduction by dithionite ion and oxidation by

ferricyanide ion showed that the enzyme can accept four electrons: two to reduce

the flavin and two to slowly reduce an unknown acceptor, which in its reduced

form interacts with the oxidized flavin in a charge-transfer complex. The

experiments identify for the first time an acyl-CoA dehydrogenase that oxidizes

the activated forms of aromatic acids similar to those used to first demonstrate the

biological b-oxidation of fatty acids.

Introduction

Phenylalkanoates can serve as the sole source of carbon and

energy for the growth of Pseudomonas putida, which acti-

vates the carboxylate with CoA and degrades the side chain

by b-oxidation (Olivera et al., 2001; Jimenez et al., 2002).

Intermediates in this process can lead to the formation of

polymers of 3-hydroxy-n-phenylalkanoates whose proper-

ties as plastics suggest that they might be used to replace

products derived from the petrochemical industry (Luengo

et al., 2003; Sandoval et al., 2005). With the exception of

medium-chain acyl-CoA dehydrogenase (MCAD) from

mammals, which uniquely oxidizes phenylpropionyl-CoA

(Rinaldo et al., 1990), enzymes that catalyze the oxidation

phenylacyl-CoA compounds have not been identified. A

proposal that gene PP_2216 in P. putida KT2440 codes for

an acyl-CoA dehydrogenase (ACD) that oxidizes of pheny-

lacyl-CoA (Jimenez et al., 2002) was not confirmed by

subsequent characterization of the enzyme (McMahon

et al., 2005). Several other ACDs have been identified in the

genome (Nelson et al., 2002), and the aim of the work

described in this paper was to determine which of them

codes for an enzyme that functions with the aromatic

compounds. To this end, P. putida was grown with phenyl-

pentanoate or phenylhexanoate as the carbon source to

induce the synthesis of (an) acyl-CoA dehydrogenase(s)

that oxidize(s) phenylalkanoyl-CoA, and with octanoate to

determine whether a different enzyme is made to degrade

this aliphatic alkanoate with a similarly medium-length

carbon chain. The ACDs induced were purified, and their

peptide mass fingerprints were determined to allow identi-

fication of their coding gene(s) for subsequent cloning,

overexpression in Escherichia coli and further enzyme

characterization with the possibility for mechanistic and

structural studies.

Materials and methods

Cultivation and harvest of bacteria

Pseudomonas putida strain KT2440 (DSM 6125) was cul-

tured in either nutrient agar (peptone 0.5%, yeast extract

FEMS Microbiol Lett 273 (2007) 50–57c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

0.3%, agar 1.5%) or E2 medium (Vogel & Bonner, 1956)

with 10 mM phenylhexanoic acid, 10 mM phenylpentanoic

acid or 10 mM octanoic acid. Escherichia coli strain Over-

ExpressTMC41(DE3) was maintained and propagated in

Luria–Bertani medium (Ausubel et al., 1993). Cultures

(1 L) for the overexpression of the recombinant gene in

plasmid pRSETB were as in McMahon et al. (2005).

Molecular biological methods

Pseudomonas putida DNA (McMahon et al., 2005) was used

as the template in PCR to amplify the PP_0368 gene. The

following oligonucleotide primers from Operon Biotechnol-

ogies GmbH, Cologne, were used in the PCR reaction; they

incorporate the restriction sites Nde1 (italics) and BamH1

(underlined):

GGAATTCCATATGCCTGACTACAAAGCCCC (forward)

CGGGATCCTCAGTACGACAGGCCGAAG (reverse and

complementary).

PCR conditions were as follows: initial denaturation was

at 94 1C for 2 min. It was followed by 30 cycles of denatura-

tion at 94 1C for 15 s, annealing for 30 s at 55 1C and

extension at 72 1C for 100 s. The final extension was per-

formed for 7 min. Other conditions and treatment of the

cloned gene were as in McMahon et al. (2005).

Enzyme assay

The assay for acyl-CoA dehydrogenase has been described

(Lehman et al., 1990; McMahon et al., 2005). Assays to

determine the kinetic constants contained 10–60 nM en-

zyme-FAD. The acyl-CoA and phenylacyl-CoA compounds,

except for stearyl-CoA and palmitoyl-CoA, which were from

Sigma, were made and determined as in McMahon et al.

(2005), as were other analytical methods.

Purification of phenylacyl-CoA dehydrogenase(PACD)

The crude extract of P. putida cultivated with phenylhex-

anoate or octanoate (65 and 95 mL extract, respectively) was

treated on a column of Q-Sepharose (10� 2.5 cm diameter),

equilibrated with 50 mM potassium phosphate buffer, pH 7,

and 1 mM EDTA (buffer A). The column was developed

with a linear gradient of NaCl (0–0.5 M) in buffer A. Yellow

fractions collected between 0.3 and 0.4 M NaCl were com-

bined (60 mL), diluted three times with buffer A and applied

to a 6 mL Q-Sepharose column equilibrated with buffer A.

The column was stripped with 0.75 M NaCl in buffer A and

the elute (6 mL) was chromatographed on a gel filtration

column (74� 1.5 cm diameter Sephacryl S300) equilibrated

with buffer A. Yellow fractions from this column (16 mL)

were diluted five times with water before application to a

7.5 mL hydroxylapatite column equilibrated with 10 mM

potassium phosphate buffer, pH 7, and 1 mM EDTA. The

column was developed with a linear gradient of 10–100 mM

potassium phosphate. The flavoprotein eluted at about

25 mM potassium phosphate.

Recombinant PACD was made by overexpression in

E. coli. The crude extract (16 mL from a 2 L culture) was

mixed with FAD to 200 mM and fractionated as described for

P. putida short-chain ACD (McMahon et al., 2005). The

apoprotein was made by dialyzing 2 mL of enzyme (40mM

enzyme FAD) against several changes of 500 mL buffer A

plus 2 M KBr and then against buffer A (Massey & Curti,

1966).

Oxidation--reduction potential

The oxidation–reduction potential of PACD was measured

spectroelectrochemically using photo-reduction (Mayhew,

1999; McMahon et al., 2005). The reaction contained, in

3 mL at 25 1C, 25–35mM enzyme-FAD, buffer A, 1 mM

5-deaza-lumiflavin, 1.5 mM indigodisulfonate and 1.5 mM

indigotetrasulfonate. The midpoint potential for the qui-

none/hydroquinone couple of the enzyme was determined

from a Nernst plot. Values were also determined by spectro-

photometric analysis of the equilibrium formed between

partially reduced PACD and indigodisulfonate. The cuvette

contained, in a final volume of 3 mL at 25 1C, 30mM PACD,

buffer A, 1 mM 5-deaza-flavin and 17.5 mM indigodisulfo-

nate. The cuvette was made anaerobic and the enzyme and

dye were then photo-reduced stepwise. After each period of

irradiation (c. 5 s), the system was allowed to reach equili-

brium as judged by DA458 nm (an isosbestic point between

oxidized and reduced dye) and DA609 nm being o 0.001/

20 min. The absorbance spectrum was then recorded. EEFADm

was calculated using the Nernst equation:

EEFADm ¼ Edye

m þ 2:303RT

2F

� �log10

½dyeox½EFADH2�½dyered�½EFAD�

� �ð1Þ

where EEFADm is the midpoint potential of the enzyme-bound

FAD, Edyem is the midpoint potential of indigodisulfonate

(� 0.116 V at 25 1C and pH 7; Clark, 1960), R is the gas

constant, T is the temperature in K, F is the Faraday, and

EFADH2 and EFAD and dyered and dyeox are the concentra-

tions of the reduced and oxidized forms of enzyme-bound

flavin and the indigodisulfonate, respectively.

Results and discussion

Identification of the ACD induced byphenylhexanoate or octanoate: catalyticproperties

The growth of P. putida KT2440 with phenylhexanoate or

octanoate as the carbon source induced the synthesis of

FEMS Microbiol Lett 273 (2007) 50–57 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

51Pseudomonas putida phenylacyl-CoA dehydrogenase

yellow ACD activities. In contrast, growth on phenylpen-

tanoate did not give detectable ACD activity, possibly

indicating that degradation of this compound occurs via

poly-3-hydroxyphenylpentanoate as is known to occur in

certain other strains of P. putida (Garcıa et al., 1999; Olivera

et al., 2001; Tobin & O’Connor, 2005). The two enzymes

were purified to about 95% purity (3 mg from a 23 g cell

paste of phenylhexanoate-grown cells; 8 mg from 38 g oc-

tanoate-grown cells). The percentage recoveries are not

known because the extracts had thioesterase activity that

hydrolyzed the acyl-CoA in the assay before ACD activity

could be measured. The peptide mass fingerprints for the

two preparations were found to be identical, indicating that

the same enzyme was induced by the two substrates. This

analysis allowed the enzyme to be identified as the protein

coded by the gene at locus number PP_0368 (protein

reference number NP_742535) (Nelson et al., 2002). The

gene was amplified using PCR, and the base sequence of the

cloned gene was shown to be the same as that in the whole

genome. After overexpression of the gene in E. coli, the

recombinant protein was purified and shown to be identical

to the native enzyme. The yield of pure enzyme was 220 mg

from a 16 g cell paste.

The enzyme is active with the CoA derivatives of pheny-

lalkanoates with from four to at least 11 atoms in the side

chain (Table 1), the first ACD known to have this property.

The greatest activity was observed with phenyloctanoyl-

CoA. However, the next larger aromatic substrate available

(phenylundecanoyl-CoA) has an odd number of carbon

atoms in the side chain, and because in general the enzyme

is less active with substrates with an odd number of carbon

atoms than with adjacent even-chain substrates, it is not

known whether phenyloctanoyl-CoA is the optimal aro-

matic substrate. Activity was also observed with aliphatic

acyl-CoA compounds, with the greatest activities occurring

with palmitoyl-CoA (C16) and stearyl-CoA (C18). The

pattern with the aliphatic substrates indicates that PACD

resembles very-long-chain acyl-CoA dehydrogenases

(VLCAD) isolated from two mammalian sources (Izai

et al., 1992; Andresen et al., 1996). The observation that a

medium-chain phenylalkanoate or alkanoate induces the

synthesis of a single enzyme in P. putida for which the

optimal aliphatic substrates are the very-long-chain com-

pounds is surprising, but is possibly explained by the further

observation that, unlike mammalian VLCADs, the bacterial

enzyme is active with even short-chain substrates. However,

it shows no activity with either propionyl-CoA or phenyl-

propionyl-CoA. Pseudomonas putida PACD is the first

bacterial ACD to be characterized that operates on very-

long-chain substrates, and is the first ACD from any organ-

ism known to oxidize phenylalkanoyl-CoA compounds

other than phenylpropionyl-CoA, which is a substrate only

for MCAD (Rinaldo et al., 1990).

All other ACDs use electron-transferring flavoprotein

(ETF) as the natural electron acceptor. Two ETF genes have

been identified in the genome of P. putida (Nelson et al.,

2002), but neither is close to the gene for PACD and neither

protein product has been purified. Interestingly, however,

human ETF is active with the bacterial enzyme, catalyzing

electron transfer from the phenylheptanoyl-CoA-reduced

PACD to 2,6-dichlorophenolindophenol with an apparent

Km for ETF of 1.9� 0.2mM and an apparent kcat (76 mol

substrate min�1 mol�1 FAD in PACD) that is about half that

measured with ferrocenium as the electron acceptor.

Comparison of amino-acid sequence

Of the 601 residues in the derived amino-acid sequence of

P. putida PACD, about 30% of the first 451 residues at the

N-terminal end are identical with or similar to those in

human ACDs and human acyl-CoA oxidase. The remainder,

toward the C-terminus, has its counterpart in the mamma-

lian VLCAD (Andresen et al., 1996) and the oxidase

(Aoyama et al., 1994), but with no similarities in sequence.

It has been proposed that mammalian VLCAD associates

with the mitochondrial membrane through the C-terminus

Table 1. Catalytic properties of Pseudomonas putida PACD�

Substrate

kcat (mmol

substratemmol

enzyme

FAD�1 min�1) Km (mM)

kcat/Km

(M�1 min�1)

Phenylbutyryl-CoAw 145�8 8� 1 18.1

Phenylpentanoyl-CoA 78�3 9� 1 8.6

Phenylhexanoyl-CoA 257�11 19� 3 13.5

Phenylheptanoyl-CoA 154�7 22� 3 7

Phenyloctanoyl-CoA 600�29 9� 1 66.6

Phenylundecanoyl-CoA 185�18 27� 4 6.9

Butyryl-CoA 143�7 20� 3 7.2

Pentanoyl-CoA 98�3 21� 2 4.6

Hexanoyl-CoA 105�3 17� 2 6.1

Heptanoyl-CoA 227�8 24� 3 9.5

Octanoyl-CoA 478�6 27� 1 17.7

Nonanoyl-CoA 230�6 26� 2 8.8

Decanoyl-CoA 403�13 7� 1 57.6

Dodecanoyl-CoA 340�10 16� 2 21.3

Palmitoyl-CoA 1955�145 20� 2 97.8

Stearoyl-CoA 1033�55 12� 1 86.1

�The kinetic assays were performed using the standard ferrocenium

hexafluorophosphate assay at 25 1C and enzyme isolated from cells

cultured on phenylhexanoic acid. The initial rate data obtained over a

range of concentrations of each substrate were fitted to the Michaelis–

Menten equation to calculate Km and kcat. Very similar kinetic constants

were determined for PACD isolated from P. putida cultured on octanoate

and for the purified recombinant enzyme.wThe enzyme was inactive with propionyl-CoA and phenylpropionyl-

CoA.


52 B. McMahon & S.G. Mayhew

(Souri et al., 1998), a region that is lacking from the smaller

tetrameric ACDs (Kim & Miura, 2004). There is no

evidence that P. putida PACD is membrane bound. Many

of the active site residues found in human MCAD also

occur in P. putida PACD and in human VLCAD. For

example, the catalytic glutamate-376 in human MCAD

occurs as glutamate-441 in the P. putida PACD and as

glutamate-422 in human VLCAD, indicating that the active

sites are similar. MCAD is a tetrameric enzyme that may be

regarded as a dimer of two dimers (Andresen et al., 1996;

Kim & Miura, 2004). Residues in MCAD that form hydro-

gen bonds with the pyrophosphate of the FAD in the

neighboring subunit of the dimer are conserved in the

dimeric P. putida PACD (arginine-321, glutamine-414) and

in human VLCAD (arginine-326, glutamine-395), suggest-

ing that the regions involved in FAD binding and dimer-

ization are similar. In contrast, glutamate-300 and

arginine-383, which form an important salt bridge between

the two dimers of the tetrameric MCAD (Kim & Miura,

2004), are not present in the dimeric P. putida PACD or in

human VLCAD.

Physico-chemical properties

The absorption spectrum of PACD has maxima at 272, 367

and 448 nm, with relative intensities of 8.3 : 0.67 : 1, respec-

tively (Fig. 1). The extinction coefficient of the protein-

bound FAD is 15.1 mM�1 cm�1 at 448 nm compared with

11.3 mM�1 cm�1 at 450 nm of free FAD. The flavin is

fluorescent with excitation peaks at 365 and 447 nm, while

emission occurs at 522 nm with 20% of the fluorescence

intensity of FAD.

Sodium dodecylsulfate-polyacrylamide gel electrophor-

esis showed that the subunit molecular mass is around

60 kDa compared with the theoretical molecular mass of

65 540 Da from the predicted amino-acid sequence. The

native molecular mass of the enzyme, estimated by gel

filtration, was 132 kDa, indicating that the protein is a

homodimer. The molar ratio of FAD to protein was

found to be 0.9 : 1, showing that there is one FAD/sub-

unit�1. The molecular mass of the subunit, and the dimeric

nature of the holoenzyme, are therefore similar to those

of mammalian VLCAD but different from those of most

other ACDs.

The FAD in PACD was removed reversibly by dialysis

against KBr. The resulting apoenzyme bound FAD, allowing

the dissociation constant of the complex to be determined as

in Lostao et al. (2000) by adding aliquots of apoenzyme to

1 mM FAD and measuring the flavin fluorescence after each

addition. The Kd calculated was 17� 5 nM.

The enzyme was shown to be reduced under anaerobic

conditions by light irradiation in the presence of EDTA, by

dithionite ion and by several substrates. Photo-reduction for

200 s caused the generation of a featureless spectrum,

characteristic of the flavin hydroquinone (Fig. 1). The

spectra at intermediate times of irradiation showed the

formation of a weak band of absorbance between about 530

and 700 nm. After each period of irradiation, the initial

reduction of the flavin was followed by partial reoxidation as

evidenced by an increase in A448 nm and a decrease in A580 nm

during about 30 min in darkness. The shape of the spectrum

of the intermediate formed initially identifies it as the blue

neutral flavin semiquinone; the subsequent changes may

have been due partly to disproportionation of the semiqui-

none to form fully oxidized FAD (quinone) and fully

reduced FAD (hydroquinone), but they were also due to

the transfer of electrons to a second redox center in the

enzyme (see later).

When air was mixed with the photo-reduced (Fig. 2) or

dithionite-reduced enzyme, about 80% of the A448 nm re-

turned in about 10 min, but the remainder required about

10 h (Fig. 2, inset a). Pseudo-first-order rate constants of 6

and 0.16 h�1 at 25 1C were calculated for the two reactions.

Intermediate spectra at the end of the more rapid phase

showed a weak band of long-wavelength absorbance (Fig. 2,

inset b) that differed from the long-wavelength band

attributed to the semiquinone (Fig. 1). It formed to the

maximal extent at the end of the rapid phase of oxidation

and then decreased to zero during the second reaction.

Similar long-wavelength bands formed during stepwise

oxidation by anaerobic 2,6-dichlorophenolindophenol or

ferricyanide ion, indicating that the transient formation of

long-wavelength absorbance was not due to air oxidation

per se.

Fig. 1. Photo-reduction of PACD. The oxidized enzyme (28.5 mM) (curve

1) in anaerobic buffer A and 1 mM 5-deazariboflavin was irradiated for

20 s and the spectrum was recorded immediately at 25 1C (curve 3). The

cuvette was left in the dark and the spectrum was recorded continuously

until no further changes were observed (curve 2). The enzyme was then

fully reduced by a further 180 s light irradiation (curve 4).



The enzyme was reduced rapidly following each in-

cremental addition of dithionite ion under anaerobic

conditions (Fig. 3). Long-wavelength absorption formed

initially, as occurred during photo-reduction, but it then

partly decayed during 30–60 min. In the experiment of Fig. 3,

this reoxidation of the enzyme FAD was allowed to go to

completion before making a further addition of dithionite.

The titration was continued until free dithionite ion

appeared in solution, as indicated by an increase in absor-

bance around 315 nm, and until the total dithionite added

was 3 mol mol�1 enzyme-FAD. At this point in the titration,

1.49 mol of sodium dithionite had been used per mol of

enzyme-FAD (Fig. 3, inset a), and summation of the small

increases at 448 nm due to reoxidation of the flavin after

each addition of reductant showed that they accounted for a

change in A448 nm of 0.22, corresponding to 0.44 mol FAD

reoxidized mol�1 of enzyme FAD. A part of the excess

dithionite was then consumed during about 7 h, as judged

by the decrease in A315 nm (to the point indicated by the solid

triangle in inset A, Fig. 3). After this period, the A315 nm was

constant for 8 h. Based on the extinction coefficient

7050 M�1 cm�1 at 315 nm experimentally determined for

dithionite ion (Mayhew, 1978), 21 mM of the excess dithio-

nite was consumed after the flavin had been fully reduced.

Thus the total dithionite oxidized in titrating 34.5 mM PACD

was 72.5mM or 2.1 mol dithionite/mol�1 enzyme flavin,

suggesting that the enzyme contains a second redox-active

center that accepts two electrons.

When reduced enzyme was titrated with anaerobic ferri-

cyanide ion, an initial lag occurred during which the flavin

remained reduced while the absorbance due to dithionite

ion disappeared (Fig. 3, inset b). The overall stoichiometry

of the reaction in the phase in which the flavin was oxidized

was 134.5 mM ferricyanide consumed in the oxidation of

34.5 mM enzyme FADH2, or 3.9 mol of the 1-electron

acceptor mol�1 of enzyme flavin, and consistent with the

observation that 2 mol dithionite had been required to

reduce the enzyme. The identity of the second redox center

(center-X) is not known and therefore it is not known

whether a single two-electron center is involved or two

one-electron centers. The low rate of equilibration between

the flavin and center-X makes it unlikely that center-X acts

in the catalytic cycle of the enzyme. However, it is evidently

close to the flavin. It might be a noncovalently bound ligand

that associates with the enzyme, such as an oxidized CoA-

containing compound that is a poor substrate, and that is

present in P. putida where it associates with native enzyme,

and in E. coli where it binds to recombinant enzyme.

However, analysis of the enzyme by MS has suggested that

flavin is the only dissociable ligand in the protein. A more

likely possibility is that center-X is associated with (an)

amino acid(s) in the protein, such as a cystine disulfide

similar to the redox-active disulfides found in a variety of

Fig. 3. Reductive titration of PACD with sodium dithionite. Aliquots of

sodium dithionite (3.13 mM) were added to the anaerobic oxidized

enzyme (34.5 mM) (curve 1) at 25 1C and the spectrum was recorded

continuously after each addition until no further changes occurred.

Spectrum 2 was 60 min after addition of dithionite to 16.6 mM; spectrum

3 was immediately after addition of 27.7 mM dithionite, while spectrum 4

was recorded 60 min later when the enzyme had reached equilibrium.

Spectra 5 and 6 were taken after the additions of 44.3 and 55.4 mM

sodium dithionite and when all spectroscopic changes were finished.

Inset (a) shows a plot of A448 nm (�) and A315 nm (&) vs. sodium dithionite

added. The total dithionite added was 110 mM. The A315 nm due to

dithionite ion decreased during 7 h after the final addition to the point

indicated by the solid triangle; it then remained constant for 8 h.

Anaerobic potassium ferricyanide was then added in aliquots to the

solution. Inset (b) is a plot of A448 nm vs. potassium ferricyanide added.

Fig. 2. Reoxidation by air of photo-reduced PACD. The oxidized enzyme

(curve 1) was reduced anaerobically (curve 2) as in Fig. 4, and then

saturated with air. Spectra were recorded after 1 min (curve 3), 10 min

(curve 4) and 600 min (curve 5, �) at 25 1C. Inset (a) shows a plot of

A448 nm vs. time. Inset (b) shows the spectra between 500 and 800 nm on

an expanded scale.



flavoenzymes (Williams et al., 2000). It appears that the

reduced form of center-X is responsible for the charge-transfer

band observed during photochemical or chemical reduction

of the enzyme and during reoxidation of reduced enzyme in

the absence of substrates (Fig. 4). Similarly detailed bio-

chemical analyses have not been carried out with the two

mammalian VLCADs that have been studied, and therefore

it is not known whether center-X is a characteristic that is

common to the group of ACDs to which P. putida PACD

seems to be related.

The reductive titration curves for three substrates

(phenylundecanoyl-CoA, decanoyl-CoA and palmitoyl-

CoA) were nonlinear and the extent of reduction after

addition of 1 mol substrate/mol�1 enzyme FAD varied with

the substrate (41%, 60% and 65% reduction by phenylun-

decanoyl-CoA (Fig. 5), decanoyl-CoA and palmitoyl-CoA).

The intermediate spectra during reduction by all three

substrates showed weak absorbance at long wavelength

similar to those of the charge–transfer complexes that have

been observed between the electron-rich reduced flavin

of other ACDs and the electron-poor enoyl-CoA formed

as the oxidation product (Engel & Massey, 1971; Thorpe

et al., 1979). Air oxidation of substrate-reduced enzyme

was slow and the reaction stopped after about 36 h even

though the spectrum had not returned to that of untreated

enzyme. Enzyme that had been reduced by phenylundeca-

noyl-CoA, decanoyl-CoA and palmitoyl-CoA was 74%

(Fig. 4, curve 4), 49% and 60% reoxidized, respectively,

after 36 h.

The observation that reduction by substrate was incom-

plete indicated that redox equilibria were established

between the oxidized and reduced forms of the flavin and

each substrate/product pair. Approximate values for the

redox potential of the enzyme FAD were calculated as in

McMahon et al. (2005) using the value � 0.003 V for the

palmitoyl-CoA/hexadecenoyl-CoA redox couple at pH 7

(Sato et al., 1999) and assuming the same value for the other

two substrates. The values of Em,7 for reduction of the

enzyme by palmitoyl-CoA, decanoyl-CoA and phenylunde-

canoyl-CoA were 10.012� 0.002, � 0.003� 0.001 and

� 0.011� 0.002 V, respectively. It should be noted that in

these calculations no account was taken of the proposed

second redox acceptor in the enzyme or of any substrate/

product bound to the enzyme; if electrons are passed from

the substrate-reduced flavin to the second site, the ratio

enoyl-CoA/acyl-CoA would be greater than assumed. Values

for the oxidation–reduction potential of the FAD in the

enzyme in the absence of substrate were determined at pH 7

by potentiometry and by spectrophotometric measurement

of the redox equilibrium formed with indigodisulfonate.

The potentiometric data gave the value � 0.103� 0.005 V,

while the value determined from the spectrophotometric

equilibration was � 0.119� 0.005 V. The average value,

� 0.110� 0.015 V, is less negative than the potential of free

FAD (� 0.219 V; Clark & Lowe, 1956) but clearly more

negative than the flavin in substrate-reduced enzyme. Simi-

lar shifts in redox potential on substrate/product binding

have been reported for other ACDs (Lenn et al., 1990; Pellett

et al., 2001).

The purification and characterization of P. putida PACD

identifies for the first time an enzyme that initiates b-

oxidation of phenylalkanoyl-CoA. It remains to be deter-

mined whether mammalian VLCAD has a similar activity

and is perhaps the enzyme that oxidizes the CoA derivatives

of the phenylalkanoates that were used in the initial experi-

ments that led to the discovery of the b-oxidation of fatty

acids (Knoop, 1904/5; Dakin, 1909).

Fig. 4. Possible involvement of center-X and the charge-transfer absor-

bance in reduction and oxidation of PACD. When the oxidized enzyme

(a) is treated with dithionite ion or by photoreduction, the flavin is

reduced (c) and electron transfer then slowly occurs to center-X,

resulting in a charge-transfer interaction (d) between reduced X and

FAD. Addition of a total of four electrons gives (e). The semiquinone (b) is

formed initially by photoreduction or dithionite reduction but it then

decays.

Fig. 5. Anaerobic titration of oxidized PACD (13.5 mM) (curve 1) with

phenylundecanoyl-CoA (1.05 mM). The spectra show the reduction of

the enzyme at 25 1C by additions of phenylundecanoyl-CoA to 16.5 mM

(curve 2) and 44.5 mM (curve 3), respectively. The cuvette contents were

fully aerated after the final addition (to 50 mM). The dashed line (curve 4)

is the spectrum after 36 h exposure to air when the absorbance changes

were complete. The inset shows a plot of flavin reduction at A448 nm (�)

and charge-transfer formation at A530 nm (&) vs. the concentration of

phenylundecanoyl-CoA added.



Acknowledgements

The authors thank Dr Dilip Rai at the UCD Centre for

Synthesis and Chemical Biology, University College Dublin,

for electrospray MS and Marie Fagan and Dr Zuhair

Nasrallah for a gift of human ETF. This study was supported

by UCD Centre for Synthesis and Chemical Biology and by

the Irish Research Council for Science, Engineering and

Technology (SC/2003/018).

References

Andresen BS, Bross P, Vianey-Saban C et al. (1996) Cloning and

characterization of human very-long-chain acyl-CoA

dehydrogenase cDNA, chromosomal assignment of the gene

and identification in four patients of nine different mutations

within the VLCAD gene. Hum Mol Genet 5: 461–472.

Aoyama T, Tsushima K, Souri M, Kamijo T, Suzuki Y, Shimozawa

N, Orii T & Hashimoto T (1994) Molecular cloning and

functional expression of a human peroxisomal acyl-coenzyme

A oxidase. Biochim Biophys Res Commun 198: 1113–1118.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,

Smith JA & Struhl K (1993) Current Protocols in Molecular

Biology, John Wiley & Sons Inc., New York.

Clark WM (1960) Oxidation–Reduction Potentials of Organic

Systems, Williams & Wilkins, Baltimore, MD.

Clark WM & Lowe HJ (1956) Studies on oxidation–reduction.

XXIV. Oxidation–reduction potentials of flavin adenine

dinucleotide. J Biol Chem 221: 983–992.

Dakin H (1909) The mode of oxidation in the animal organism

of phenyl derivatives of fatty acids. Part IV. J Biol Chem 6:

203–220.

Engel PC & Massey V (1971) The purification and properties of

butyryl-coenzyme a dehydrogenase from Peptostreptococcus

elsdenii. Biochem J 125: 879–887.

Garcıa B, Olivera ER, Minambres B, Fernandez-Valverde M,

Canedo LM, Prieto MA, Garcıa JL, Martinez M & Luengo JM

(1999) Novel biodegradable aromatic plastics from a bacterial

source. Genetic and biochemical studies on a route of the

phenylacetyl-CoA catabolon. J Biol Chem 274: 29228–29241.

Izai K, Uchida Y, Orii T, Yamamoto S & Hashimoto T (1992)

Novel fatty acid beta-oxidation enzymes in rat liver

mitochondria. I. Purification and properties of very-long-chain

acyl-coenzyme A dehydrogenase. J Biol Chem 267: 1027–1033.

Jimenez JI, Minambres B, Garcıa JL & Dıaz E (2002) Genomic

analysis of the aromatic catabolic pathways from Pseudomonas

putida KT2440. Environ Microbiol 4: 824–841.

Kim JJ & Miura R (2004) Acyl-CoA dehydrogenases and acyl-

CoA oxidases. Structural basis for mechanistic similarities and

differences. Eur J Biochem 271: 483–493.

Knoop F (1904/05) Der Abbau der aromatischer fettsauren im

tierkorper. Beitr Chem Physiol Pathol 6: 150–162.

Lehman TC, Hale DE, Bhala A & Thorpe C (1990) An acyl-

coenzyme A dehydrogenase assay utilizing the ferricenium ion.

Anal Biochem 186: 280–284.

Lenn ND, Stankovich MT & Liu HW (1990) Regulation of the

redox potential of general acyl-CoA dehydrogenase by

substrate binding. Biochemistry 29: 3709–3715.

Lostao A, El Harrous M, Daoudi F, Romero A, Parody-

Morreale A & Sancho J (2000) Dissecting the energetics

of the apoflavodoxin–FMN complex. J Biol Chem 275:

9518–9526.

Luengo JM, Garcıa B, Sandoval A, Naharro G & Olivera ER

(2003) Bioplastics from microorganisms. Curr Opin Microbiol

6: 251–260.

Massey V & Curti B (1966) A new method of preparation of D-

amino acid oxidase apoprotein and a conformational change

after its combination with flavin adenine dinucleotide. J Biol

Chem 241: 3417–3423.

Mayhew SG (1978) The redox potential of dithionite and SO2�

from equilibrium reactions with flavodoxins, methyl

viologen and hydrogen plus hydrogenase. Eur J Biochem 85:

535–547.

Mayhew SG (1999) Potentiometric measurement of

oxidation–reduction potentials. Methods Mol Biol 131: 49–59.

McMahon B, Gallagher ME & Mayhew SG (2005) The protein

coded by the PP2216 gene of Pseudomonas putida KT2440 is

an acyl-CoA dehydrogenase that oxidises only short-chain

aliphatic substrates. FEMS Microbiol Lett 250: 121–127.

Nelson KE, Weinel C, Paulsen IT et al. (2002) Complete genome

sequence and comparative analysis of the metabolically

versatile Pseudomonas putida KT2440. Environ Microbiol 4:

799–808.

Olivera ER, Carnicero D, Garcıa B, Minambres B, Moreno MA,

Canedo L, DiRusso CC, Naharro G & Luengo JM (2001) Two

different pathways are involved in the beta-oxidation of n-

alkanoic and n-phenylalkanoic acids in Pseudomonas putida U:

genetic studies and biotechnological applications. Mol

Microbiol 39: 863–874.

Pellett JD, Becker DF, Saenger AK, Fuchs JA & Stankovich MT

(2001) Role of aromatic stacking interactions in the

modulation of the two-electron reduction potentials of flavin

and substrate/product in Megasphaera elsdenii short-chain

acyl-coenzyme A dehydrogenase. Biochemistry 40: 7720–7728.

Rinaldo P, O’Shea JJ, Welch RD & Tanaka K (1990) The

enzymatic basis for the dehydrogenation of 3-phenylpropionic

acid: in vitro reaction of 3-phenylpropionyl-CoA with various

acyl-CoA dehydrogenases. Pediatr Res 27: 501–507.

Sandoval A, Arias-Barrau E, Bermejo F, Canedo L, Naharro G,

Olivera ER & Luengo JM (2005) Production of 3-hydroxy-

n-phenylalkanoic acids by a genetically engineered strain

of Pseudomonas putida. Appl Microbiol Biotechnol 67:

97–105.

Sato K, Nishina Y, Setoyama C, Miura R & Shiga K (1999)

Unusually high standard redox potential of acrylyl-CoA/

propionyl-CoA couple among enoyl-CoA/acyl-CoA

couples: a reason for the distinct metabolic pathway of

propionyl-CoA from longer acyl-CoAs. J Biochem (Tokyo)

126: 668–675.



Souri M, Aoyama T, Hoganson G & Hashimoto T (1998) Very

long chain acyl-CoA dehydrogenase subunit assembles to the

dimer form on the mitochondrial inner membrane. FEBS Lett

426: 187–190.

Thorpe C, Matthews RG & Williams CH Jr (1979) Acyl-coenzyme

A dehydrogenase from pig kidney. Purification and properties.

Biochemistry 18: 331–337.

Tobin KM & O’Connor KE (2005) Polyhydroxyalkanoate

accumulating diversity of Pseudomonas species

utilizing aromatic hydrocarbons. FEMS Microbiol 253:

111–118.

Vogel HJ & Bonner DM (1956) Acetylornithinase of Escherichia

coli: partial purification and some properties. J Biol Chem 218:

97–106.

Williams CH Jr, Arscott LD, Muller S, Lennon BW, Ludwig ML,

Wang P-F, Veine DM, Becker K & Schirmer RH (2000)

Thioredoxin reductase two modes of catalysis have evolved.

Eur J Biochem 267: 6110–6117.



Documents

Identification and properties of an inducible phenylacyl-CoA dehydrogenase in Pseudomonas putida KT2440