Upload
brian-mcmahon
View
213
Download
1
Embed Size (px)
Citation preview
Identi¢cationandproperties ofan inducible phenylacyl-CoAdehydrogenase inPseudomonasputida KT2440Brian McMahon & Stephen G. Mayhew
UCD School of Biomolecular and Biomedical Science, and Centre for Synthesis and Chemical Biology, Conway Institute for Biomolecular and
Biomedical Research, University College Dublin, Belfield, Dublin, Ireland
Correspondence: Stephen G. Mayhew, UCD
School of Biomolecular and Biomedical
Science, and Centre for Synthesis and
Chemical Biology, Conway Institute for
Biomolecular and Biomedical Research,
University College Dublin, Belfield, Dublin 4,
Ireland. Tel.: 1353 1 7166780; fax: 1353 1
2837211; e-mail: [email protected]
Received 9 March 2007; revised 24 April 2007;
accepted 25 April 2007.
First published online 7 June 2007.
DOI:10.1111/j.1574-6968.2007.00780.x
Editor: Dieter Jahn
Keywords
phenylacyl-CoA; dehydrogenase;
phenylalkanoate; Pseudomonas putida .
Abstract
A novel acyl-CoA dehydrogenase that initiates b-oxidation of the side chains of
phenylacyl-CoA compounds by Pseudomonas putida was induced by growth with
phenylhexanoate as carbon source. It was identified as the product of gene
PP_0368, which was cloned and overexpressed in Escherichia coli. This phenyla-
cyl-CoA dehydrogenase was found to be dimeric with a subunit molecular mass of
66 kDa, to contain FAD and to be active with phenylacyl-CoA substrates having
side chains from four to at least 11 carbon atoms. The same enzyme was induced
by the aliphatic alkanoate octanoate. The optimal aliphatic substrates for the
enzyme were palmitoyl-CoA and stearoyl-CoA, a property shared with mamma-
lian very-long-chain acyl-CoA dehydrogenases. The FAD in the enzyme was
reduced by aromatic and aliphatic substrates, with changes to the oxidation–
reduction potential. Chemical reduction by dithionite ion and oxidation by
ferricyanide ion showed that the enzyme can accept four electrons: two to reduce
the flavin and two to slowly reduce an unknown acceptor, which in its reduced
form interacts with the oxidized flavin in a charge-transfer complex. The
experiments identify for the first time an acyl-CoA dehydrogenase that oxidizes
the activated forms of aromatic acids similar to those used to first demonstrate the
biological b-oxidation of fatty acids.
Introduction
Phenylalkanoates can serve as the sole source of carbon and
energy for the growth of Pseudomonas putida, which acti-
vates the carboxylate with CoA and degrades the side chain
by b-oxidation (Olivera et al., 2001; Jimenez et al., 2002).
Intermediates in this process can lead to the formation of
polymers of 3-hydroxy-n-phenylalkanoates whose proper-
ties as plastics suggest that they might be used to replace
products derived from the petrochemical industry (Luengo
et al., 2003; Sandoval et al., 2005). With the exception of
medium-chain acyl-CoA dehydrogenase (MCAD) from
mammals, which uniquely oxidizes phenylpropionyl-CoA
(Rinaldo et al., 1990), enzymes that catalyze the oxidation
phenylacyl-CoA compounds have not been identified. A
proposal that gene PP_2216 in P. putida KT2440 codes for
an acyl-CoA dehydrogenase (ACD) that oxidizes of pheny-
lacyl-CoA (Jimenez et al., 2002) was not confirmed by
subsequent characterization of the enzyme (McMahon
et al., 2005). Several other ACDs have been identified in the
genome (Nelson et al., 2002), and the aim of the work
described in this paper was to determine which of them
codes for an enzyme that functions with the aromatic
compounds. To this end, P. putida was grown with phenyl-
pentanoate or phenylhexanoate as the carbon source to
induce the synthesis of (an) acyl-CoA dehydrogenase(s)
that oxidize(s) phenylalkanoyl-CoA, and with octanoate to
determine whether a different enzyme is made to degrade
this aliphatic alkanoate with a similarly medium-length
carbon chain. The ACDs induced were purified, and their
peptide mass fingerprints were determined to allow identi-
fication of their coding gene(s) for subsequent cloning,
overexpression in Escherichia coli and further enzyme
characterization with the possibility for mechanistic and
structural studies.
Materials and methods
Cultivation and harvest of bacteria
Pseudomonas putida strain KT2440 (DSM 6125) was cul-
tured in either nutrient agar (peptone 0.5%, yeast extract
FEMS Microbiol Lett 273 (2007) 50–57c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
0.3%, agar 1.5%) or E2 medium (Vogel & Bonner, 1956)
with 10 mM phenylhexanoic acid, 10 mM phenylpentanoic
acid or 10 mM octanoic acid. Escherichia coli strain Over-
ExpressTMC41(DE3) was maintained and propagated in
Luria–Bertani medium (Ausubel et al., 1993). Cultures
(1 L) for the overexpression of the recombinant gene in
plasmid pRSETB were as in McMahon et al. (2005).
Molecular biological methods
Pseudomonas putida DNA (McMahon et al., 2005) was used
as the template in PCR to amplify the PP_0368 gene. The
following oligonucleotide primers from Operon Biotechnol-
ogies GmbH, Cologne, were used in the PCR reaction; they
incorporate the restriction sites Nde1 (italics) and BamH1
(underlined):
GGAATTCCATATGCCTGACTACAAAGCCCC (forward)
CGGGATCCTCAGTACGACAGGCCGAAG (reverse and
complementary).
PCR conditions were as follows: initial denaturation was
at 94 1C for 2 min. It was followed by 30 cycles of denatura-
tion at 94 1C for 15 s, annealing for 30 s at 55 1C and
extension at 72 1C for 100 s. The final extension was per-
formed for 7 min. Other conditions and treatment of the
cloned gene were as in McMahon et al. (2005).
Enzyme assay
The assay for acyl-CoA dehydrogenase has been described
(Lehman et al., 1990; McMahon et al., 2005). Assays to
determine the kinetic constants contained 10–60 nM en-
zyme-FAD. The acyl-CoA and phenylacyl-CoA compounds,
except for stearyl-CoA and palmitoyl-CoA, which were from
Sigma, were made and determined as in McMahon et al.
(2005), as were other analytical methods.
Purification of phenylacyl-CoA dehydrogenase(PACD)
The crude extract of P. putida cultivated with phenylhex-
anoate or octanoate (65 and 95 mL extract, respectively) was
treated on a column of Q-Sepharose (10� 2.5 cm diameter),
equilibrated with 50 mM potassium phosphate buffer, pH 7,
and 1 mM EDTA (buffer A). The column was developed
with a linear gradient of NaCl (0–0.5 M) in buffer A. Yellow
fractions collected between 0.3 and 0.4 M NaCl were com-
bined (60 mL), diluted three times with buffer A and applied
to a 6 mL Q-Sepharose column equilibrated with buffer A.
The column was stripped with 0.75 M NaCl in buffer A and
the elute (6 mL) was chromatographed on a gel filtration
column (74� 1.5 cm diameter Sephacryl S300) equilibrated
with buffer A. Yellow fractions from this column (16 mL)
were diluted five times with water before application to a
7.5 mL hydroxylapatite column equilibrated with 10 mM
potassium phosphate buffer, pH 7, and 1 mM EDTA. The
column was developed with a linear gradient of 10–100 mM
potassium phosphate. The flavoprotein eluted at about
25 mM potassium phosphate.
Recombinant PACD was made by overexpression in
E. coli. The crude extract (16 mL from a 2 L culture) was
mixed with FAD to 200 mM and fractionated as described for
P. putida short-chain ACD (McMahon et al., 2005). The
apoprotein was made by dialyzing 2 mL of enzyme (40mM
enzyme FAD) against several changes of 500 mL buffer A
plus 2 M KBr and then against buffer A (Massey & Curti,
1966).
Oxidation--reduction potential
The oxidation–reduction potential of PACD was measured
spectroelectrochemically using photo-reduction (Mayhew,
1999; McMahon et al., 2005). The reaction contained, in
3 mL at 25 1C, 25–35mM enzyme-FAD, buffer A, 1 mM
5-deaza-lumiflavin, 1.5 mM indigodisulfonate and 1.5 mM
indigotetrasulfonate. The midpoint potential for the qui-
none/hydroquinone couple of the enzyme was determined
from a Nernst plot. Values were also determined by spectro-
photometric analysis of the equilibrium formed between
partially reduced PACD and indigodisulfonate. The cuvette
contained, in a final volume of 3 mL at 25 1C, 30mM PACD,
buffer A, 1 mM 5-deaza-flavin and 17.5 mM indigodisulfo-
nate. The cuvette was made anaerobic and the enzyme and
dye were then photo-reduced stepwise. After each period of
irradiation (c. 5 s), the system was allowed to reach equili-
brium as judged by DA458 nm (an isosbestic point between
oxidized and reduced dye) and DA609 nm being o 0.001/
20 min. The absorbance spectrum was then recorded. EEFADm
was calculated using the Nernst equation:
EEFADm ¼ Edye
m þ 2:303RT
2F
� �log10
½dyeox½EFADH2�½dyered�½EFAD�
� �ð1Þ
where EEFADm is the midpoint potential of the enzyme-bound
FAD, Edyem is the midpoint potential of indigodisulfonate
(� 0.116 V at 25 1C and pH 7; Clark, 1960), R is the gas
constant, T is the temperature in K, F is the Faraday, and
EFADH2 and EFAD and dyered and dyeox are the concentra-
tions of the reduced and oxidized forms of enzyme-bound
flavin and the indigodisulfonate, respectively.
Results and discussion
Identification of the ACD induced byphenylhexanoate or octanoate: catalyticproperties
The growth of P. putida KT2440 with phenylhexanoate or
octanoate as the carbon source induced the synthesis of
FEMS Microbiol Lett 273 (2007) 50–57 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
51Pseudomonas putida phenylacyl-CoA dehydrogenase
yellow ACD activities. In contrast, growth on phenylpen-
tanoate did not give detectable ACD activity, possibly
indicating that degradation of this compound occurs via
poly-3-hydroxyphenylpentanoate as is known to occur in
certain other strains of P. putida (Garcıa et al., 1999; Olivera
et al., 2001; Tobin & O’Connor, 2005). The two enzymes
were purified to about 95% purity (3 mg from a 23 g cell
paste of phenylhexanoate-grown cells; 8 mg from 38 g oc-
tanoate-grown cells). The percentage recoveries are not
known because the extracts had thioesterase activity that
hydrolyzed the acyl-CoA in the assay before ACD activity
could be measured. The peptide mass fingerprints for the
two preparations were found to be identical, indicating that
the same enzyme was induced by the two substrates. This
analysis allowed the enzyme to be identified as the protein
coded by the gene at locus number PP_0368 (protein
reference number NP_742535) (Nelson et al., 2002). The
gene was amplified using PCR, and the base sequence of the
cloned gene was shown to be the same as that in the whole
genome. After overexpression of the gene in E. coli, the
recombinant protein was purified and shown to be identical
to the native enzyme. The yield of pure enzyme was 220 mg
from a 16 g cell paste.
The enzyme is active with the CoA derivatives of pheny-
lalkanoates with from four to at least 11 atoms in the side
chain (Table 1), the first ACD known to have this property.
The greatest activity was observed with phenyloctanoyl-
CoA. However, the next larger aromatic substrate available
(phenylundecanoyl-CoA) has an odd number of carbon
atoms in the side chain, and because in general the enzyme
is less active with substrates with an odd number of carbon
atoms than with adjacent even-chain substrates, it is not
known whether phenyloctanoyl-CoA is the optimal aro-
matic substrate. Activity was also observed with aliphatic
acyl-CoA compounds, with the greatest activities occurring
with palmitoyl-CoA (C16) and stearyl-CoA (C18). The
pattern with the aliphatic substrates indicates that PACD
resembles very-long-chain acyl-CoA dehydrogenases
(VLCAD) isolated from two mammalian sources (Izai
et al., 1992; Andresen et al., 1996). The observation that a
medium-chain phenylalkanoate or alkanoate induces the
synthesis of a single enzyme in P. putida for which the
optimal aliphatic substrates are the very-long-chain com-
pounds is surprising, but is possibly explained by the further
observation that, unlike mammalian VLCADs, the bacterial
enzyme is active with even short-chain substrates. However,
it shows no activity with either propionyl-CoA or phenyl-
propionyl-CoA. Pseudomonas putida PACD is the first
bacterial ACD to be characterized that operates on very-
long-chain substrates, and is the first ACD from any organ-
ism known to oxidize phenylalkanoyl-CoA compounds
other than phenylpropionyl-CoA, which is a substrate only
for MCAD (Rinaldo et al., 1990).
All other ACDs use electron-transferring flavoprotein
(ETF) as the natural electron acceptor. Two ETF genes have
been identified in the genome of P. putida (Nelson et al.,
2002), but neither is close to the gene for PACD and neither
protein product has been purified. Interestingly, however,
human ETF is active with the bacterial enzyme, catalyzing
electron transfer from the phenylheptanoyl-CoA-reduced
PACD to 2,6-dichlorophenolindophenol with an apparent
Km for ETF of 1.9� 0.2mM and an apparent kcat (76 mol
substrate min�1 mol�1 FAD in PACD) that is about half that
measured with ferrocenium as the electron acceptor.
Comparison of amino-acid sequence
Of the 601 residues in the derived amino-acid sequence of
P. putida PACD, about 30% of the first 451 residues at the
N-terminal end are identical with or similar to those in
human ACDs and human acyl-CoA oxidase. The remainder,
toward the C-terminus, has its counterpart in the mamma-
lian VLCAD (Andresen et al., 1996) and the oxidase
(Aoyama et al., 1994), but with no similarities in sequence.
It has been proposed that mammalian VLCAD associates
with the mitochondrial membrane through the C-terminus
Table 1. Catalytic properties of Pseudomonas putida PACD�
Substrate
kcat (mmol
substratemmol
enzyme
FAD�1 min�1) Km (mM)
kcat/Km
(M�1 min�1)
Phenylbutyryl-CoAw 145�8 8� 1 18.1
Phenylpentanoyl-CoA 78�3 9� 1 8.6
Phenylhexanoyl-CoA 257�11 19� 3 13.5
Phenylheptanoyl-CoA 154�7 22� 3 7
Phenyloctanoyl-CoA 600�29 9� 1 66.6
Phenylundecanoyl-CoA 185�18 27� 4 6.9
Butyryl-CoA 143�7 20� 3 7.2
Pentanoyl-CoA 98�3 21� 2 4.6
Hexanoyl-CoA 105�3 17� 2 6.1
Heptanoyl-CoA 227�8 24� 3 9.5
Octanoyl-CoA 478�6 27� 1 17.7
Nonanoyl-CoA 230�6 26� 2 8.8
Decanoyl-CoA 403�13 7� 1 57.6
Dodecanoyl-CoA 340�10 16� 2 21.3
Palmitoyl-CoA 1955�145 20� 2 97.8
Stearoyl-CoA 1033�55 12� 1 86.1
�The kinetic assays were performed using the standard ferrocenium
hexafluorophosphate assay at 25 1C and enzyme isolated from cells
cultured on phenylhexanoic acid. The initial rate data obtained over a
range of concentrations of each substrate were fitted to the Michaelis–
Menten equation to calculate Km and kcat. Very similar kinetic constants
were determined for PACD isolated from P. putida cultured on octanoate
and for the purified recombinant enzyme.wThe enzyme was inactive with propionyl-CoA and phenylpropionyl-
CoA.
FEMS Microbiol Lett 273 (2007) 50–57c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
52 B. McMahon & S.G. Mayhew
(Souri et al., 1998), a region that is lacking from the smaller
tetrameric ACDs (Kim & Miura, 2004). There is no
evidence that P. putida PACD is membrane bound. Many
of the active site residues found in human MCAD also
occur in P. putida PACD and in human VLCAD. For
example, the catalytic glutamate-376 in human MCAD
occurs as glutamate-441 in the P. putida PACD and as
glutamate-422 in human VLCAD, indicating that the active
sites are similar. MCAD is a tetrameric enzyme that may be
regarded as a dimer of two dimers (Andresen et al., 1996;
Kim & Miura, 2004). Residues in MCAD that form hydro-
gen bonds with the pyrophosphate of the FAD in the
neighboring subunit of the dimer are conserved in the
dimeric P. putida PACD (arginine-321, glutamine-414) and
in human VLCAD (arginine-326, glutamine-395), suggest-
ing that the regions involved in FAD binding and dimer-
ization are similar. In contrast, glutamate-300 and
arginine-383, which form an important salt bridge between
the two dimers of the tetrameric MCAD (Kim & Miura,
2004), are not present in the dimeric P. putida PACD or in
human VLCAD.
Physico-chemical properties
The absorption spectrum of PACD has maxima at 272, 367
and 448 nm, with relative intensities of 8.3 : 0.67 : 1, respec-
tively (Fig. 1). The extinction coefficient of the protein-
bound FAD is 15.1 mM�1 cm�1 at 448 nm compared with
11.3 mM�1 cm�1 at 450 nm of free FAD. The flavin is
fluorescent with excitation peaks at 365 and 447 nm, while
emission occurs at 522 nm with 20% of the fluorescence
intensity of FAD.
Sodium dodecylsulfate-polyacrylamide gel electrophor-
esis showed that the subunit molecular mass is around
60 kDa compared with the theoretical molecular mass of
65 540 Da from the predicted amino-acid sequence. The
native molecular mass of the enzyme, estimated by gel
filtration, was 132 kDa, indicating that the protein is a
homodimer. The molar ratio of FAD to protein was
found to be 0.9 : 1, showing that there is one FAD/sub-
unit�1. The molecular mass of the subunit, and the dimeric
nature of the holoenzyme, are therefore similar to those
of mammalian VLCAD but different from those of most
other ACDs.
The FAD in PACD was removed reversibly by dialysis
against KBr. The resulting apoenzyme bound FAD, allowing
the dissociation constant of the complex to be determined as
in Lostao et al. (2000) by adding aliquots of apoenzyme to
1 mM FAD and measuring the flavin fluorescence after each
addition. The Kd calculated was 17� 5 nM.
The enzyme was shown to be reduced under anaerobic
conditions by light irradiation in the presence of EDTA, by
dithionite ion and by several substrates. Photo-reduction for
200 s caused the generation of a featureless spectrum,
characteristic of the flavin hydroquinone (Fig. 1). The
spectra at intermediate times of irradiation showed the
formation of a weak band of absorbance between about 530
and 700 nm. After each period of irradiation, the initial
reduction of the flavin was followed by partial reoxidation as
evidenced by an increase in A448 nm and a decrease in A580 nm
during about 30 min in darkness. The shape of the spectrum
of the intermediate formed initially identifies it as the blue
neutral flavin semiquinone; the subsequent changes may
have been due partly to disproportionation of the semiqui-
none to form fully oxidized FAD (quinone) and fully
reduced FAD (hydroquinone), but they were also due to
the transfer of electrons to a second redox center in the
enzyme (see later).
When air was mixed with the photo-reduced (Fig. 2) or
dithionite-reduced enzyme, about 80% of the A448 nm re-
turned in about 10 min, but the remainder required about
10 h (Fig. 2, inset a). Pseudo-first-order rate constants of 6
and 0.16 h�1 at 25 1C were calculated for the two reactions.
Intermediate spectra at the end of the more rapid phase
showed a weak band of long-wavelength absorbance (Fig. 2,
inset b) that differed from the long-wavelength band
attributed to the semiquinone (Fig. 1). It formed to the
maximal extent at the end of the rapid phase of oxidation
and then decreased to zero during the second reaction.
Similar long-wavelength bands formed during stepwise
oxidation by anaerobic 2,6-dichlorophenolindophenol or
ferricyanide ion, indicating that the transient formation of
long-wavelength absorbance was not due to air oxidation
per se.
Fig. 1. Photo-reduction of PACD. The oxidized enzyme (28.5 mM) (curve
1) in anaerobic buffer A and 1 mM 5-deazariboflavin was irradiated for
20 s and the spectrum was recorded immediately at 25 1C (curve 3). The
cuvette was left in the dark and the spectrum was recorded continuously
until no further changes were observed (curve 2). The enzyme was then
fully reduced by a further 180 s light irradiation (curve 4).
FEMS Microbiol Lett 273 (2007) 50–57 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
53Pseudomonas putida phenylacyl-CoA dehydrogenase
The enzyme was reduced rapidly following each in-
cremental addition of dithionite ion under anaerobic
conditions (Fig. 3). Long-wavelength absorption formed
initially, as occurred during photo-reduction, but it then
partly decayed during 30–60 min. In the experiment of Fig. 3,
this reoxidation of the enzyme FAD was allowed to go to
completion before making a further addition of dithionite.
The titration was continued until free dithionite ion
appeared in solution, as indicated by an increase in absor-
bance around 315 nm, and until the total dithionite added
was 3 mol mol�1 enzyme-FAD. At this point in the titration,
1.49 mol of sodium dithionite had been used per mol of
enzyme-FAD (Fig. 3, inset a), and summation of the small
increases at 448 nm due to reoxidation of the flavin after
each addition of reductant showed that they accounted for a
change in A448 nm of 0.22, corresponding to 0.44 mol FAD
reoxidized mol�1 of enzyme FAD. A part of the excess
dithionite was then consumed during about 7 h, as judged
by the decrease in A315 nm (to the point indicated by the solid
triangle in inset A, Fig. 3). After this period, the A315 nm was
constant for 8 h. Based on the extinction coefficient
7050 M�1 cm�1 at 315 nm experimentally determined for
dithionite ion (Mayhew, 1978), 21 mM of the excess dithio-
nite was consumed after the flavin had been fully reduced.
Thus the total dithionite oxidized in titrating 34.5 mM PACD
was 72.5mM or 2.1 mol dithionite/mol�1 enzyme flavin,
suggesting that the enzyme contains a second redox-active
center that accepts two electrons.
When reduced enzyme was titrated with anaerobic ferri-
cyanide ion, an initial lag occurred during which the flavin
remained reduced while the absorbance due to dithionite
ion disappeared (Fig. 3, inset b). The overall stoichiometry
of the reaction in the phase in which the flavin was oxidized
was 134.5 mM ferricyanide consumed in the oxidation of
34.5 mM enzyme FADH2, or 3.9 mol of the 1-electron
acceptor mol�1 of enzyme flavin, and consistent with the
observation that 2 mol dithionite had been required to
reduce the enzyme. The identity of the second redox center
(center-X) is not known and therefore it is not known
whether a single two-electron center is involved or two
one-electron centers. The low rate of equilibration between
the flavin and center-X makes it unlikely that center-X acts
in the catalytic cycle of the enzyme. However, it is evidently
close to the flavin. It might be a noncovalently bound ligand
that associates with the enzyme, such as an oxidized CoA-
containing compound that is a poor substrate, and that is
present in P. putida where it associates with native enzyme,
and in E. coli where it binds to recombinant enzyme.
However, analysis of the enzyme by MS has suggested that
flavin is the only dissociable ligand in the protein. A more
likely possibility is that center-X is associated with (an)
amino acid(s) in the protein, such as a cystine disulfide
similar to the redox-active disulfides found in a variety of
Fig. 3. Reductive titration of PACD with sodium dithionite. Aliquots of
sodium dithionite (3.13 mM) were added to the anaerobic oxidized
enzyme (34.5 mM) (curve 1) at 25 1C and the spectrum was recorded
continuously after each addition until no further changes occurred.
Spectrum 2 was 60 min after addition of dithionite to 16.6 mM; spectrum
3 was immediately after addition of 27.7 mM dithionite, while spectrum 4
was recorded 60 min later when the enzyme had reached equilibrium.
Spectra 5 and 6 were taken after the additions of 44.3 and 55.4 mM
sodium dithionite and when all spectroscopic changes were finished.
Inset (a) shows a plot of A448 nm (�) and A315 nm (&) vs. sodium dithionite
added. The total dithionite added was 110 mM. The A315 nm due to
dithionite ion decreased during 7 h after the final addition to the point
indicated by the solid triangle; it then remained constant for 8 h.
Anaerobic potassium ferricyanide was then added in aliquots to the
solution. Inset (b) is a plot of A448 nm vs. potassium ferricyanide added.
Fig. 2. Reoxidation by air of photo-reduced PACD. The oxidized enzyme
(curve 1) was reduced anaerobically (curve 2) as in Fig. 4, and then
saturated with air. Spectra were recorded after 1 min (curve 3), 10 min
(curve 4) and 600 min (curve 5, �) at 25 1C. Inset (a) shows a plot of
A448 nm vs. time. Inset (b) shows the spectra between 500 and 800 nm on
an expanded scale.
FEMS Microbiol Lett 273 (2007) 50–57c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
54 B. McMahon & S.G. Mayhew
flavoenzymes (Williams et al., 2000). It appears that the
reduced form of center-X is responsible for the charge-transfer
band observed during photochemical or chemical reduction
of the enzyme and during reoxidation of reduced enzyme in
the absence of substrates (Fig. 4). Similarly detailed bio-
chemical analyses have not been carried out with the two
mammalian VLCADs that have been studied, and therefore
it is not known whether center-X is a characteristic that is
common to the group of ACDs to which P. putida PACD
seems to be related.
The reductive titration curves for three substrates
(phenylundecanoyl-CoA, decanoyl-CoA and palmitoyl-
CoA) were nonlinear and the extent of reduction after
addition of 1 mol substrate/mol�1 enzyme FAD varied with
the substrate (41%, 60% and 65% reduction by phenylun-
decanoyl-CoA (Fig. 5), decanoyl-CoA and palmitoyl-CoA).
The intermediate spectra during reduction by all three
substrates showed weak absorbance at long wavelength
similar to those of the charge–transfer complexes that have
been observed between the electron-rich reduced flavin
of other ACDs and the electron-poor enoyl-CoA formed
as the oxidation product (Engel & Massey, 1971; Thorpe
et al., 1979). Air oxidation of substrate-reduced enzyme
was slow and the reaction stopped after about 36 h even
though the spectrum had not returned to that of untreated
enzyme. Enzyme that had been reduced by phenylundeca-
noyl-CoA, decanoyl-CoA and palmitoyl-CoA was 74%
(Fig. 4, curve 4), 49% and 60% reoxidized, respectively,
after 36 h.
The observation that reduction by substrate was incom-
plete indicated that redox equilibria were established
between the oxidized and reduced forms of the flavin and
each substrate/product pair. Approximate values for the
redox potential of the enzyme FAD were calculated as in
McMahon et al. (2005) using the value � 0.003 V for the
palmitoyl-CoA/hexadecenoyl-CoA redox couple at pH 7
(Sato et al., 1999) and assuming the same value for the other
two substrates. The values of Em,7 for reduction of the
enzyme by palmitoyl-CoA, decanoyl-CoA and phenylunde-
canoyl-CoA were 10.012� 0.002, � 0.003� 0.001 and
� 0.011� 0.002 V, respectively. It should be noted that in
these calculations no account was taken of the proposed
second redox acceptor in the enzyme or of any substrate/
product bound to the enzyme; if electrons are passed from
the substrate-reduced flavin to the second site, the ratio
enoyl-CoA/acyl-CoA would be greater than assumed. Values
for the oxidation–reduction potential of the FAD in the
enzyme in the absence of substrate were determined at pH 7
by potentiometry and by spectrophotometric measurement
of the redox equilibrium formed with indigodisulfonate.
The potentiometric data gave the value � 0.103� 0.005 V,
while the value determined from the spectrophotometric
equilibration was � 0.119� 0.005 V. The average value,
� 0.110� 0.015 V, is less negative than the potential of free
FAD (� 0.219 V; Clark & Lowe, 1956) but clearly more
negative than the flavin in substrate-reduced enzyme. Simi-
lar shifts in redox potential on substrate/product binding
have been reported for other ACDs (Lenn et al., 1990; Pellett
et al., 2001).
The purification and characterization of P. putida PACD
identifies for the first time an enzyme that initiates b-
oxidation of phenylalkanoyl-CoA. It remains to be deter-
mined whether mammalian VLCAD has a similar activity
and is perhaps the enzyme that oxidizes the CoA derivatives
of the phenylalkanoates that were used in the initial experi-
ments that led to the discovery of the b-oxidation of fatty
acids (Knoop, 1904/5; Dakin, 1909).
Fig. 4. Possible involvement of center-X and the charge-transfer absor-
bance in reduction and oxidation of PACD. When the oxidized enzyme
(a) is treated with dithionite ion or by photoreduction, the flavin is
reduced (c) and electron transfer then slowly occurs to center-X,
resulting in a charge-transfer interaction (d) between reduced X and
FAD. Addition of a total of four electrons gives (e). The semiquinone (b) is
formed initially by photoreduction or dithionite reduction but it then
decays.
Fig. 5. Anaerobic titration of oxidized PACD (13.5 mM) (curve 1) with
phenylundecanoyl-CoA (1.05 mM). The spectra show the reduction of
the enzyme at 25 1C by additions of phenylundecanoyl-CoA to 16.5 mM
(curve 2) and 44.5 mM (curve 3), respectively. The cuvette contents were
fully aerated after the final addition (to 50 mM). The dashed line (curve 4)
is the spectrum after 36 h exposure to air when the absorbance changes
were complete. The inset shows a plot of flavin reduction at A448 nm (�)
and charge-transfer formation at A530 nm (&) vs. the concentration of
phenylundecanoyl-CoA added.
FEMS Microbiol Lett 273 (2007) 50–57 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
55Pseudomonas putida phenylacyl-CoA dehydrogenase
Acknowledgements
The authors thank Dr Dilip Rai at the UCD Centre for
Synthesis and Chemical Biology, University College Dublin,
for electrospray MS and Marie Fagan and Dr Zuhair
Nasrallah for a gift of human ETF. This study was supported
by UCD Centre for Synthesis and Chemical Biology and by
the Irish Research Council for Science, Engineering and
Technology (SC/2003/018).
References
Andresen BS, Bross P, Vianey-Saban C et al. (1996) Cloning and
characterization of human very-long-chain acyl-CoA
dehydrogenase cDNA, chromosomal assignment of the gene
and identification in four patients of nine different mutations
within the VLCAD gene. Hum Mol Genet 5: 461–472.
Aoyama T, Tsushima K, Souri M, Kamijo T, Suzuki Y, Shimozawa
N, Orii T & Hashimoto T (1994) Molecular cloning and
functional expression of a human peroxisomal acyl-coenzyme
A oxidase. Biochim Biophys Res Commun 198: 1113–1118.
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,
Smith JA & Struhl K (1993) Current Protocols in Molecular
Biology, John Wiley & Sons Inc., New York.
Clark WM (1960) Oxidation–Reduction Potentials of Organic
Systems, Williams & Wilkins, Baltimore, MD.
Clark WM & Lowe HJ (1956) Studies on oxidation–reduction.
XXIV. Oxidation–reduction potentials of flavin adenine
dinucleotide. J Biol Chem 221: 983–992.
Dakin H (1909) The mode of oxidation in the animal organism
of phenyl derivatives of fatty acids. Part IV. J Biol Chem 6:
203–220.
Engel PC & Massey V (1971) The purification and properties of
butyryl-coenzyme a dehydrogenase from Peptostreptococcus
elsdenii. Biochem J 125: 879–887.
Garcıa B, Olivera ER, Minambres B, Fernandez-Valverde M,
Canedo LM, Prieto MA, Garcıa JL, Martinez M & Luengo JM
(1999) Novel biodegradable aromatic plastics from a bacterial
source. Genetic and biochemical studies on a route of the
phenylacetyl-CoA catabolon. J Biol Chem 274: 29228–29241.
Izai K, Uchida Y, Orii T, Yamamoto S & Hashimoto T (1992)
Novel fatty acid beta-oxidation enzymes in rat liver
mitochondria. I. Purification and properties of very-long-chain
acyl-coenzyme A dehydrogenase. J Biol Chem 267: 1027–1033.
Jimenez JI, Minambres B, Garcıa JL & Dıaz E (2002) Genomic
analysis of the aromatic catabolic pathways from Pseudomonas
putida KT2440. Environ Microbiol 4: 824–841.
Kim JJ & Miura R (2004) Acyl-CoA dehydrogenases and acyl-
CoA oxidases. Structural basis for mechanistic similarities and
differences. Eur J Biochem 271: 483–493.
Knoop F (1904/05) Der Abbau der aromatischer fettsauren im
tierkorper. Beitr Chem Physiol Pathol 6: 150–162.
Lehman TC, Hale DE, Bhala A & Thorpe C (1990) An acyl-
coenzyme A dehydrogenase assay utilizing the ferricenium ion.
Anal Biochem 186: 280–284.
Lenn ND, Stankovich MT & Liu HW (1990) Regulation of the
redox potential of general acyl-CoA dehydrogenase by
substrate binding. Biochemistry 29: 3709–3715.
Lostao A, El Harrous M, Daoudi F, Romero A, Parody-
Morreale A & Sancho J (2000) Dissecting the energetics
of the apoflavodoxin–FMN complex. J Biol Chem 275:
9518–9526.
Luengo JM, Garcıa B, Sandoval A, Naharro G & Olivera ER
(2003) Bioplastics from microorganisms. Curr Opin Microbiol
6: 251–260.
Massey V & Curti B (1966) A new method of preparation of D-
amino acid oxidase apoprotein and a conformational change
after its combination with flavin adenine dinucleotide. J Biol
Chem 241: 3417–3423.
Mayhew SG (1978) The redox potential of dithionite and SO2�
from equilibrium reactions with flavodoxins, methyl
viologen and hydrogen plus hydrogenase. Eur J Biochem 85:
535–547.
Mayhew SG (1999) Potentiometric measurement of
oxidation–reduction potentials. Methods Mol Biol 131: 49–59.
McMahon B, Gallagher ME & Mayhew SG (2005) The protein
coded by the PP2216 gene of Pseudomonas putida KT2440 is
an acyl-CoA dehydrogenase that oxidises only short-chain
aliphatic substrates. FEMS Microbiol Lett 250: 121–127.
Nelson KE, Weinel C, Paulsen IT et al. (2002) Complete genome
sequence and comparative analysis of the metabolically
versatile Pseudomonas putida KT2440. Environ Microbiol 4:
799–808.
Olivera ER, Carnicero D, Garcıa B, Minambres B, Moreno MA,
Canedo L, DiRusso CC, Naharro G & Luengo JM (2001) Two
different pathways are involved in the beta-oxidation of n-
alkanoic and n-phenylalkanoic acids in Pseudomonas putida U:
genetic studies and biotechnological applications. Mol
Microbiol 39: 863–874.
Pellett JD, Becker DF, Saenger AK, Fuchs JA & Stankovich MT
(2001) Role of aromatic stacking interactions in the
modulation of the two-electron reduction potentials of flavin
and substrate/product in Megasphaera elsdenii short-chain
acyl-coenzyme A dehydrogenase. Biochemistry 40: 7720–7728.
Rinaldo P, O’Shea JJ, Welch RD & Tanaka K (1990) The
enzymatic basis for the dehydrogenation of 3-phenylpropionic
acid: in vitro reaction of 3-phenylpropionyl-CoA with various
acyl-CoA dehydrogenases. Pediatr Res 27: 501–507.
Sandoval A, Arias-Barrau E, Bermejo F, Canedo L, Naharro G,
Olivera ER & Luengo JM (2005) Production of 3-hydroxy-
n-phenylalkanoic acids by a genetically engineered strain
of Pseudomonas putida. Appl Microbiol Biotechnol 67:
97–105.
Sato K, Nishina Y, Setoyama C, Miura R & Shiga K (1999)
Unusually high standard redox potential of acrylyl-CoA/
propionyl-CoA couple among enoyl-CoA/acyl-CoA
couples: a reason for the distinct metabolic pathway of
propionyl-CoA from longer acyl-CoAs. J Biochem (Tokyo)
126: 668–675.
FEMS Microbiol Lett 273 (2007) 50–57c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
56 B. McMahon & S.G. Mayhew
Souri M, Aoyama T, Hoganson G & Hashimoto T (1998) Very
long chain acyl-CoA dehydrogenase subunit assembles to the
dimer form on the mitochondrial inner membrane. FEBS Lett
426: 187–190.
Thorpe C, Matthews RG & Williams CH Jr (1979) Acyl-coenzyme
A dehydrogenase from pig kidney. Purification and properties.
Biochemistry 18: 331–337.
Tobin KM & O’Connor KE (2005) Polyhydroxyalkanoate
accumulating diversity of Pseudomonas species
utilizing aromatic hydrocarbons. FEMS Microbiol 253:
111–118.
Vogel HJ & Bonner DM (1956) Acetylornithinase of Escherichia
coli: partial purification and some properties. J Biol Chem 218:
97–106.
Williams CH Jr, Arscott LD, Muller S, Lennon BW, Ludwig ML,
Wang P-F, Veine DM, Becker K & Schirmer RH (2000)
Thioredoxin reductase two modes of catalysis have evolved.
Eur J Biochem 267: 6110–6117.
FEMS Microbiol Lett 273 (2007) 50–57 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
57Pseudomonas putida phenylacyl-CoA dehydrogenase