Identification and Functional Characterization of the NovelEdwardsiella tarda Effector EseJ

Hai-Xia Xie,a Jin-Fang Lu,a,b Ying Zhou,a,b Jia Yi,a,b Xiu-Jun Yu,c Ka Yin Leung,d,e Pin Niea

State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province, Chinaa; University ofChinese Academy of Sciences, Beijing, Chinab; Section of Microbiology, MRC Centre for Molecular Bacteriology and Infection, Imperial College London, London, UnitedKingdomc; Department of Biology, Faculty of Natural and Applied Sciences, Trinity Western University, Langley, British Columbia, Canadad; State Key Laboratory ofBioreactor Engineering, East China University of Science and Technology, Shanghai, Chinae

Edwardsiella tarda is a Gram-negative enteric pathogen that causes hemorrhagic septicemia in fish and gastro- and extraintesti-nal infections in humans. The type III secretion system (T3SS) of E. tarda has been identified as a key virulence factor that con-tributes to pathogenesis in fish. However, little is known about the associated effectors translocated by this T3SS. In this study,by comparing the profile of secreted proteins of the wild-type PPD130/91 and its T3SS ATPase �esaN mutant, we identified anew effector by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry. This effector con-sists of 1,359 amino acids, sharing high sequence similarity with Orf29/30 of E. tarda strain EIB202, and is renamed EseJ. Thesecretion and translocation of EseJ depend on the T3SS. A �eseJ mutant strain adheres to epithelioma papillosum of carp (EPC)cells 3 to 5 times more extensively than the wild-type strain does. EseJ inhibits bacterial adhesion to EPC cells from within bacte-rial cells. Importantly, the �eseJ mutant strain does not replicate efficiently in EPC cells and fails to replicate in J774A.1 macro-phages. In infected J774A.1 macrophages, the �eseJ mutant elicits higher production of reactive oxygen species than wild-type E.tarda. The replication defect is consistent with the attenuation of the �eseJ mutant in the blue gourami fish model: the 50% le-thal dose (LD50) of the �eseJ mutant is 2.34 times greater than that of the wild type, and the �eseJ mutant is less competitive thanthe wild type in mixed infection. Thus, EseJ represents a novel effector that contributes to virulence by reducing bacterial adhe-sion to EPC cells and facilitating intracellular bacterial replication.

Edwardsiella tarda is a Gram-negative intracellular pathogenand is recognized worldwide as a causative agent of hemor-

rhagic septicemia in fish and is an emerging agent for gastrointes-tinal infection in humans (1, 2). E. tarda is able to invade andreplicate in epithelial cells such as Hep-2 (3, 4), HeLa (5), and fishepithelioma papillosum of carp (EPC) cells (6), as well as phago-cytic cells such as murine macrophage J774A.1 cells (7) and fishprimary macrophages (6). By means of whole-genome screeningapproaches such as transposon tagging mutagenesis and compar-ative proteomics, several virulence genes have been identified andshown to contribute to E. tarda pathogenicity (8, 9). Conse-quently, type III and type VI secretion systems (T3SS and T6SS)were identified as two of the most important components contrib-uting to virulence in E. tarda (6, 10).

T3SSs are assembled spanning the two cell membranes ofmany Gram-negative bacteria. They secrete three classes of pro-teins: subunits with a needle-like structure; translocon proteins,which form pores in the host membrane; and effectors, which passthrough the needle channel and translocon pore into the host cell,where they manipulate cellular processes and promote bacterialvirulence (11–15). Genes encoding the components of a T3S ap-paratus are normally clustered to form a pathogenicity island. TheE. tarda T3SS gene cluster contains 35 genes (6). Deleting a singlegene, such as eseB, eseD, escA, escC, or esaN, increased the 50%lethal dose (LD50) by approximately 1 log in blue gourami fish(16–18). EseB, EseC, and EseD are homologous to SseB, SseC, andSseD of the Salmonella pathogenicity island 2 (SPI-2) T3SS, whichare involved in the translocation of effectors (6, 19, 20). EscA is thechaperon of EseC (17), EscC is the chaperon of EseB and EseD(16), and EscB is the chaperon of EseG (18). Mutating any of thesegenes impairs T3SS function with the exception of EseG, the only

characterized Edwardsiella effector to date, which has been shownto disassemble microtubule structures when overexpressed inmammalian cells (18).

Genes for a two-component regulatory system, EsrA-EsrB, anda regulator that belongs to the AraC family, EsrC, were found in aT3SS gene cluster of E. tarda (6, 21). EsrA is a histidine kinasesensor, and EsrB is a response regulator; EsrB binds directly to thepromoters of T3SS genes to regulate their expression. In E. tarda,it also regulates expression of T6SS secreted proteins through EsrC(21, 22). The E. tarda T3SS gene cluster contains several putativegenes of unknown function, such as orf29 and orf30, which arepredicted to encode two effector proteins (21). orf29 and orf30 areflanked upstream by esrB and downstream by orfA, the boundarygene of the T3SS gene cluster (6). Expression of orf29-lacZ in a�esrC mutant strain was shown to be 4 times lower than that in thewild-type strain and more than 20-fold lower in a �esrA or �esrB

Received 29 August 2014 Returned for modification 11 October 2014Accepted 1 February 2015

Accepted manuscript posted online 9 February 2015

Citation Xie H-X, Lu J-F, Zhou Y, Yi J, Yu X-J, Leung KY, Nie P. 2015. Identificationand functional characterization of the novel Edwardsiella tarda effector EseJ. InfectImmun 83:1650 –1660. doi:10.1128/IAI.02566-14.

Editor: S. M. Payne

Address correspondence to Xiu-Jun Yu, x.yu@imperial.ac.uk, orPin Nie, pinnie@ihb.ac.cn.

H.-X.X. and J.-F.L. contributed equally to this work.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.02566-14

1650 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

mutant strain background (21). Consistently, the affinity of EsrBfor the promoter region of orf29 was found to be higher than thatof EsrC (22).

In this study, we show that orf29 and orf30 of E. tarda PPD130/91actually encode one protein, EseJ. Analysis of a �eseJ mutantstrain revealed that EseJ displays a dual function: inhibiting bac-terial adhesion to fish epithelial cells and facilitating intracellularbacterial replication in host cells.

MATERIALS AND METHODSCells and culture conditions. Murine J774A.1 macrophages were cul-tured in DMEM (Invitrogen) with 10% fetal bovine serum (FBS) and 10mM L-glutamine. Epithelioma papillosum of carp (Cyprinus carpio)(EPC) cells (23) were grown in MEM medium (HyClone) supplementedwith 10% FBS, 10 mM HEPES, 5 mM glutamine, and 18 mM NaHCO3.

Bacterial strains and culture. Bacterial strains and plasmids used inthis study are described in Table 1. E. tarda strains were grown in trypticsoy broth (TSB; BD Biosciences) at 25°C, while Escherichia coli strainswere cultured in Luria-Bertani broth (LB; BD Biosciences) at 37°C. Forthe induction of T3SS proteins, E. tarda strains were grown in Dulbecco’s

modified Eagle medium (DMEM) at 25°C under a 5% (vol/vol) CO2

atmosphere. When required, appropriate antibiotics were supplementedat the following concentrations: 100 �g/ml ampicillin (Sigma), 12.5�g/ml colistin (Sigma), 15 �g/ml tetracycline (Amresco), and 34 �g/mlchloramphenicol (Amresco).

Construction of mutant and plasmids. A nonpolar eseJ deletionmutant was generated by sacB-based allelic exchange as described pre-viously (21, 24). The primer pairs eseJ-for plus eseJ-int-rev and eseJ-int-for plus eseJ-rev were used to amplify DNA fragments fromPPD130/91 genomic DNA. The resulting products were a 1,151-bpfragment containing the upstream region of eseJ and a 962-bp frag-ment containing the downstream region of eseJ. A 17-bp overlappingsequence introduced into the flanking DNA fragments permitted fus-ing them together by a second PCR with primers eseJ-for and eseJ-rev.The resulting PCR product, with the deletion of whole coding se-quence of eseJ, was digested and ligated into the KpnI restriction site ofsuicide vector pRE112 (24) to create pRE-�eseJ and subsequentlytransferred to E. coli S17-1�pir (25) for conjugation with E. tardaPPD130/91. Deletion mutant strains were screened on 10% sucrose–tryp-tic soy agar (TSA) plates. Candidate mutant strains were verified by PCR,SDS-PAGE and Western blot analysis. No mutant strains tested showed

TABLE 1 List of strains used in this study

Strain or plasmid Description and/or genotypea Reference or source

StrainsE. tarda

PPD130/91 Wild type; Kms Colr Amps 28�eseJ mutant PPD130/91, in-frame deletion of eseJ This study�esaN mutant PPD130/91, in-frame deletion of esaN 18�eseB mutant PPD130/91, in-frame deletion of eseB 16�eseB �eseJ mutant PPD130/91, in-frame deletion of eseJ and eseB This study�esaN �eseJ mutant PPD130/91, in-frame deletion of eseJ and esaN This study�esrB mutant PPD130/91, in-frame deletion of esrB 21�esaN mutant/pACYC-esaN �esaN mutant transformed with pACYC-esaN 18�eseJ mutant/pACYC-eseJ-2HA �eseJ mutant transformed with pACYC-eseJ-2HA This studywt/gfp PPD130/91 transformed with pFPV25.1 This study�eseJ-gfp mutant �eseJ mutant transformed with pFPV25.1 This study�eseB-gfp mutant �eseB mutant transformed with pFPV25.1 This study�esaN-gfp mutant �esaN mutant transformed with pFPV25.1 This study�esrB-gfp mutant �esrB mutant transformed with pFPV25.1 This study�eseB �eseJ-gfp mutant �eseB �eseJ mutant transformed with pFPV25.1 This study�esaN �eseJ-gfp mutant �esaN �eseJ mutant transformed with pFPV25.1 This studywt/pACYC-eseJ::cyaA PPD130/91 transformed with pACYC-eseJ::cyaA This study�esaN mutant/pACYC-eseJ::cyaA �esaN mutant transformed with pACYC-eseJ::cyaA This study�eseB mutant/pACYC-eseJ::cyaA �eseB mutant transformed with pACYC-eseJ::cyaA This studywt/pACYC-gst-2HA PPD130/91 transformed with pACYC-gst-2HA This study�eseJ mutant/pACYC-gst-2HA �eseJ mutant transformed with pACYC-gst-2HA This study�eseJ mutant/pACYC-gst-eseJ-2HA �eseJ mutant transformed with pACYC-gst-eseJ-2HA This study�eseJ mutant/pACYC-eseJ-2HA/gfp �eseJ mutant transformed with pACYC-eseJ-2HA and pFPV25.1 This study

E. coliDH5� � complementation StratageneS17-1 �pir RK2 tra regulon, �pir 25

PlasmidspFPV25.1 Derivative of pBR322; gfpmut3A under constitutive promoter 27pRE112 Suicide plasmid, pir dependent; Cmr oriT oriV sacB 24pRE-�eseJ pRE112 with eseJ-flanking fragments This studypACYC184 Tetr Cmr AmershampACYC-eseJ-2HA pACYC184 with eseJ-2HA; Tetr This studypACYC-orf13::cyaA pACYC184 with orf13::cyaA; Tetr This studypACYC-eseJ::cyaA pACYC184 with eseJ::cyaA; Cmr This study

a Km, kanamycin; Col, colistin; Amp, ampicillin; Tet, tetracycline; Cm, chloramphenicol.

EseJ Inhibits Adhesion and Facilitates Replication

April 2015 Volume 83 Number 4 iai.asm.org 1651Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

growth defects when cultured in TSB or DMEM. All primers used in thiswork are listed in Table 2.

To construct �eseB �eseJ and �esaN �eseJ double mutants, pRE-�eseJwas transferred to E. coli S17-1 �pir (25) to conjugate with the �eseB or�esaN mutant. Deletion mutants were screened as described above.

The DNA sequence including the eseJ gene and its ribosome bindingsite was amplified with primers eseJ-com-for and eseJ-com-rev and ligatedinto the EcoRI and ScaI restriction sites of pACYC184 (Amersham) tocreate pACYC-eseJ-2HA. A DNA sequence encoding amino acids (aa) 2 to406 of Bordetella pertussis cyaA (GenBank no. Y00545.1) fused at the Cterminus of Orf13 of E. tarda with a linker (orf13-linker-cyaA) was syn-thesized by GenScript and cloned into the BamHI and SphI restrictionsites of pACYC184 to create pACYC-orf13::cyaA. The eseJ gene without itsstop codon was amplified with primers eseJ-cyaA-for and eseJ-cyaA-revand digested with KpnI and BglII to replace orf13 of pACYC-orf13::cyaA,yielding pACYC-eseJ::cyaA. All the plasmids constructed were verified byDNA sequencing and transferred into E. tarda strains by electroporationfor investigation.

The gst::orf13-2HA fusion gene was synthesized by GenScript and li-gated into EcoRV-digested pUC57-Simple to obtain pUC57-gst::orf13-2HA, from which gst::orf13-2HA was digested and ligated into the EcoRIand NcoI sites of pACYC-184 to construct pACYC-gst::orf13-2HA. Toconstruct pACYC-gst::eseJ-2HA, eseJ-2HA was amplified with the primerpair pACYC-gst-eseJ-for plus pACYC-gst-eseJ-rev and ligated into the Bg-lII and KpnI sites of pACYC-gst::orf13-2HA to replace orf13-2HA andcreate the recombinant plasmid pACYC-gst::eseJ-2HA. For constructingpACYC-gst-2HA, gst-2HA was amplified from pUC57-gst::orf13-2HAwith the primer pair pACYC-gst-for plus pACYC-gst-rev and ligated intothe EcoRI and NcoI sites of pACYC-184 to create the control plasmidpACYC-gst-2HA.

Secretion assay. Overnight cultures of E. tarda strains were subcul-tured at 1:200 in DMEM and grown without shaking for 24 h at 25°C. Thesupernatant (labeled extracellular proteins [ECP]) and the total bacterialproteins (TBP) were prepared as described by Zheng and Leung (10). Fivepercent of TBP and 10% of ECP were separated by SDS-PAGE and sub-jected to Coomassie blue staining or transferred onto a polyvinylidenedifluoride (PVDF) membrane for immunoblotting. Membranes wereprobed with rabbit anti-EseJ antibody (1:2,000, raised against peptideLSGNAAGSESTESL of EseJ [positions 11 to 24] by Bio-Genes [Berlin,Germany] and purified by using specific peptide as the ligand) orrabbit anti-EvpP antibody at 1:5,000 (10) followed by horseradish per-oxidase (HRP)-conjugated goat anti-rabbit IgG at 1:2,000 (Millipore)and mouse anti-DnaK monoclonal antibody (Abcam) at 1:1,000 fol-lowed by goat anti-mouse IgG-HRP at 1:5,000 (Sigma). Antigen-anti-

body complexes were visualized with Super Signal West Pico chemi-luminescent substrate (Thermo), followed by exposure in a FluorChem Q machine (Alpha Innotech).

Identification of EseJ. On 5% to 10% SDS-PAGE gel, a protein bandbetween 130 and 250 kDa was observed in ECP of the wild type but not ofthe T3SS mutant �esaN strain. The band was excised and subjected tomatrix-assisted laser desorption ionization-time of flight mass spectrom-etry (MALDI-TOF MS). To recheck the DNA sequence encoding the C-terminal region of Orf29 and the N-terminal region of Orf30 of E. tardaPPD130/91, we used high-fidelity DNA polymerase (Fermentas) to am-plify the corresponding DNA with primers eseJ-frameshift-check-for andeseJ-frameshift-check-rev (Table 2). The resultant PCR product was pu-rified and subjected for DNA sequencing.

CyaA-based translocation assay. The CyaA translocation assay wasbased on a protocol reported previously (26). In brief, 24 h before infec-tion, EPC cells were seeded into 24-well tissue culture plates at 5 � 105

cells/well, and bacteria were applied to cell monolayers at a multiplicity ofinfection (MOI) of 10. Cultures were then centrifuged at 170 � g for 5 minat room temperature (RT) and incubated at 25°C for 30 min. After incu-bation, the medium was aspirated, and the monolayers were washed oncewith prewarmed culture medium followed by incubation with mediumsupplemented with 100 �g/ml gentamicin (Sigma) for 1 h. Subsequently,the monolayer was washed once again, followed by incubation with me-dium supplemented with 17.5 �g/ml gentamicin for another 4.5 h. Attime zero (T0; before incubation in MEM supplemented with 100 �g/mlgentamicin) and 5.5 h postinfection (T5.5), the monolayers were lysedwith 250 �l of 0.2% Triton X-100 (Sigma) diluted in sample diluent.Plates were incubated for 10 min at 25°C to lyse the cells. The lysed cellswere centrifuged, and the resultant supernatants were collected and ana-lyzed for cyclic AMP (cAMP) levels, using an enzyme-linked immunoas-say according to the instructions of the manufacturer (K019-H1; ArborAssays).

Adhesion assay by confocal microscopy. Adhesion assays were per-formed as described by Tan et al. (6) with minor modifications. EPC cellswere seeded at 5 � 105 cells per well and grown for 24 h to 100% conflu-ence in 24-well tissue culture plates. The cell monolayers were washedonce with prewarmed Hanks’ balanced salt solution (HBSS; Invitrogen)and infected with E. tarda strains expressing GFP from pFPV25.1 (27) atan MOI of 10. The plate was centrifuged at 170 � g for 5 min at roomtemperature and incubated at 25°C in a 5% CO2 incubator for 30 min. Themonolayers were washed five times with prewarmed HBSS and fixed in4% paraformaldehyde–PBS (pH 7.4). The cell-associated E. tarda cellswere counted from more than 15 fields of view over three coverslips perinfection condition tested by using confocal microscopy.

TABLE 2 Oligonucleotides used in this study

Oligonucleotide Sequence

eseJ-frameshift-check-for GCTGGACGCCATCGAGGACTATeseJ-frameshift-check-rev GCAGCGCCAGGAGATCCGCGCGeseJ-for TAGGTACCGAGCCGGTGGGTCTCCACGGTTeseJ-int-rev ACAAGGCACCGGTCGTTCGCCGGAACATGGTGCGATeseJ-int-for AACGACCGGTGCCTTGTGGATCGACCAGGGCGGTCGGGTeseJ-Rev TAGGTACCAGTATGACGTTGCCGCCGTCAA�eseJcheck-for AGGCCAATACCCGAAAGCCT�eseJcheck-rev TCATCCAGTGCGTCGTCCCGCAeseJ-com-for AGAATTCAGGCCAATACCCGAAAGCCTCCCAATeseJ-com-rev AAGTACTTACTAGAGGCTAGCATAATCAGGAACATCATACGGATATATCGCCGCCGCCGTCTCATGCeseJ-CyaA-for GGGGTACCAGGCCAATACCCGAAAGCCTCCCAATeseJ-CyaA-rev GAAGATCTTATCGCCGCCGCCGTCTCATGCpACYC-gst-for GAATTCAGAAGGAGATATACATATGTCCCCpACYC-gst-rev CCATGGTTACTAGAGGCTAGCATAATCAGGAACATCATACGGATATGATCCACCTCCGCCCGATCCACCTCpACYC-gst-eseJ-for GGAAGATCTATGGTGAATGCTTTTACGTTATCCCCCGpACYC-gst-eseJ-rev CGGGGTACCCTAGAGGCTAGCATAATCAGGAACATCATACGGATATATCGCCGCCGCCGTCTCATGC

Xie et al.

1652 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Adhesion and internalization assay by CFU. EPC monolayers wereinfected with bacterial strains as described above. At time zero postinfec-tion (i.e., after 30 min of incubation), the monolayers were washed fivetimes with prewarmed HBSS and lysed with 0.2% Triton X-100, and thebacteria were quantified by plating a dilution series onto TSA plates. Tomeasure the numbers of internalized bacteria, infected monolayers werewashed once with prewarmed HBSS and then maintained in MEM withgentamicin at 100 �g/ml for 1 h to kill any remaining extracellular bacte-ria. Subsequently, the EPC monolayers were washed five times with pre-warmed HBSS and lysed with 0.2% Triton X-100 for plating. Adhesion isdefined as percentage of input bacteria still adherent after washing with-out gentamicin treatment, and internalization is defined as percentage ofinput bacteria surviving after gentamicin treatment for 1 h.

Replication assay in EPC and J774A.1 cells. EPC cells were infected asdescribed for the internalization assay. After 1 h of 100 �g/ml gentamicintreatment, intracellular bacteria were recovered by plating, or after 1 htreatment with 100 �g/ml gentamicin, the medium was replaced withMEM containing 17 �g/ml gentamicin and incubated for a further 4.5 hbefore intracellular bacteria were recovered, as described above, forplating.

J774A.1 macrophages were seeded at 5 � 105 cells per well in 24-welltissue culture plates 24 h before infection. Bacterial strains were opsonizedwith naive mouse serum (Millipore) and added to the monolayers at anMOI of 5. The monolayers were centrifuged at 170 � g for 5 min at RT,and the infection was allowed to proceed at 35°C for 30 min. Cells werewashed with and kept in prewarmed DMEM supplemented with 100�g/ml gentamicin for 1 h and changed to DMEM containing 17 �g/mlgentamicin for the remainder of the infection. At 1 h, 3 h, and 5 h postin-fection, macrophages were washed three times with PBS, lysed with 0.2%Triton X-100 for 10 min, and a dilution series was plated onto TSA platesfor enumeration. Three replicates for each infection condition were ana-lyzed, and the results were averaged.

DCF assay on reactive oxygen species from infected J774A.1 cells.For the measurement of reactive oxygen species (ROS) in infected J774A.1cells, we used an OxiSelect intracellular ROS assay kit (Cell Biolabs, SanDiego, CA) according to the manufacturer’s protocol. J774A.1 cells (5 �104) were seeded into 96-well plates with black walls and clear bottoms.Before infection, the J774A.1 cell monolayers were washed twice withprewarmed HBSS; the cell monolayers were then pretreated with 1 mM2=,7=-dichlorodihydrofluorescin diacetate (DCFH-DA) diluted in FBS-free DMEM for 40 min at 35°C, the DCFH-DA-containing mixture wasthen aspirated, and cell monolayers were again washed with prewarmedHBSS before infection at an MOI of 20 with opsonized wild-type or �eseJmutant E. tarda strains. Standard control samples were loaded on thesame plate before plate reading. Green fluorescence (excitation, 485 nm;emission, 538 nm) was detected by a plate reader (Spectramax M5; Mo-lecular Devices) at 1 h postinfection. The assay employs the cell-perme-ative fluorogenic probe DCFH-DA. Nonfluorescent DCFH-DA is dif-fused into cells and is deacetylated by cellular esterases to nonfluorescent2=,7=-dichlorodihydrofluorescin (DCFH), which is rapidly oxidized tohighly fluorescent 2=,7=-dichlorodihydrofluorescein (DCF) by ROS. Therelative fluorescence units (RFU) were calculated against the standardcurve.

Single-strain infection in blue gourami fish. The experiments withfish were performed in accordance with the Guide for the Care and Use ofLaboratory Animals of the Chinese Academy of Sciences. The protocolwas approved by the Committee on the Ethics of Animal Experiments ofthe Institute of Hydrobiology (permit Y213201301).

Healthy naive blue gourami fish (Trichogaster trichopterus Pallas) wereinfected with E. tarda as described previously by Ling et al. (28) with slightmodifications. PPD130/91 wild-type and �eseJ mutant strains were cul-tured and subcultured separately at 25°C before injection. Doses of 106,105, and 104 bacteria were injected intramuscularly near the dorsal fins,with 10 fish per infection. Fish mortalities were recorded over a period of7 days. The LD50 was calculated using the method of Reed and Muench

(29). For each strain, the LD50 estimation was performed at least in trip-licate.

Mixed infection in blue gourami fish. Eight naive blue gourami fish(9.20 � 1.55 g) were used for mixed infection. Equal amounts of thewild-type PPD130/91 and the �eseJ mutant strains were mixed togetherand injected intramuscularly at 1 � 105 CFU per fish. At 72 h postinocu-lation, head kidneys and livers were harvested and homogenized for CFUcounting. The wild-type strain was discriminated from the �eseJ mutantstrain by using PCR to amplify the eseJ gene region with the primers�eseJ-check-for and �eseJ-check-rev (Table 2). One hundred forty-fourcolonies per organ per fish were examined for the ratio of �eseJ mutant towild type. The competitive index (CI) is defined as the ratio of the �eseJand wild-type strains within the output divided by their ratio within theinput.

Statistical analysis. All data are presented as means � standard errorsof the means (SEM). Data were analyzed using Student’s t test, and Pvalues less than 0.05 were considered significant.

Nucleotide sequence accession number. The sequence of eseJ hasbeen deposited in GenBank under accession no. KF736986.

RESULTSIdentification of EseJ. When the secretion profiles of E. tardawild-type strain PPD130/91 and its isogenic T3SS ATPase �esaNmutant strain were compared on an SDS-PAGE gel, we noticed aprotein band between 130 kDa and 250 kDa in the ECP of thewild-type but not in that of the �esaN mutant (Fig. 1). The bandwas excised from the gel and subjected to MALDI-TOF MS. Out of28 peptides identified, 18 were matched with the predicted Orf29and 10 were matched with the predicted Orf30. This suggests thatthe orf29 and orf30 genes of E. tarda wild-type PPD130/91 re-ported previously (6) could encode one protein.

To test if orf29 and orf30 are actually one gene, the DNAfragment overlapping the predicted orf29 and orf30 was ampli-fied from E. tarda PPD130/91 genomic DNA and subjected tosequencing. The resultant sequence was found to contain 25 nu-cleotides more than that of the originally reported sequence(GenBank accession no. AY643478.1). Analysis of this new se-

FIG 1 Secretion profiles of E. tarda strains. Samples of ECPs from similaramounts of bacteria grown in DMEM were separated using SDS-PAGE andstained with Coomassie blue. T3SS proteins are EseJ, EseC, EseB, and EseD,and T6SS proteins are EvpI, EvpP, and EvpC.

EseJ Inhibits Adhesion and Facilitates Replication

April 2015 Volume 83 Number 4 iai.asm.org 1653Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

quence yielded a prediction that the orf29 and orf30 genes of E.tarda PPD130/91 actually encode one protein from a single openreading frame which is composed of 1,359 amino acids and has apredicted molecular mass of 145.7 kDa. This is consistent with ourobservations of a protein band at a similar molecular mass afterSDS-PAGE separation and with our results from the MALDI-TOFMS analysis (Fig. 1). Therefore, we renamed this gene eseJ (Ed-wardsiella secreted effector J). The EseJ protein of E. tardaPPD130/91 is 99% identical to ETAE_0888 of E. tarda EIB202(GenBank accession no. YP_003294944.1) and 80% identical tothe putative T3SS effector Orf29/30 of Edwardsiella ictaluri 93-146(GenBank accession no. ABC60092). orf29/30 from E. ictaluri wasalso reported to be a single open reading frame based on a 6-foldsequencing coverage genome project of strain 93-146 (30).

Next, we constructed an in-frame deletion mutant of eseJ toverify the MALDI-TOF MS result. SDS-PAGE analysis showedthat the corresponding band of EseJ was no longer detected in theECP of the �eseJ mutant strain cultured in DMEM and that it wasrestored in the �eseJ mutant strain carrying an eseJ-complement-ing plasmid (Fig. 1).

EseJ is secreted and translocated in a T3SS-dependent man-ner. To further confirm the T3SS-dependent secretion of EseJ byimmunoblotting, we raised a polyclonal antibody against a shortpeptide of EseJ (residues 11 to 24). The antibody specifically rec-ognizes EseJ, as we could detect EseJ by immunoblotting only inthe wild-type bacteria and eseJ-containing strains, not in the �eseJmutant strain (Fig. 2A). As shown in Fig. 2A, there was no secre-

tion of EseJ in the �esaN mutant strain, although EseJ was de-tected in the bacterial lysate. The secretion deficiency of EseJ in the�esaN mutant strain could be rescued using a plasmid-bornewild-type copy of esaN. The cytoplasmic protein DnaK was notdetected in the secreted proteins of all the strains tested. Theseresults demonstrate that secretion of EseJ depends on the T3SS.

To test whether EseJ is translocated into its host cells, we con-structed a reporter plasmid, pACYC-eseJ::cyaA, from which a chi-meric protein EseJ::CyaA is expressed and transformed the plas-mid into E. tarda strains. Fish EPC cells were infected with thewild-type strain or deletion mutant strains, i.e., the �esaN or�eseB strain (the �eseB mutant is a translocator mutant strain[16]), all carrying pACYC-eseJ::cyaA. Soon after infection (T0) or5.5 h after infection (T5.5), the intracellular levels of cAMP weremeasured as a readout of translocation of EseJ::CyaA. As shown inFig. 2B, the cAMP level in wild-type (wt)-infected cells was18.20 � 5.95 fmol per �g protein at T0, whereas it was less than 3fmol per �g protein in cells infected with the �esaN or the �eseBmutant strain. At 5.5 h after infection, the cAMP level in wt-in-fected cells was increased to 114.24 � 22.70 fmol per �g protein,while it was still less than 3 fmol per �g protein in cells infectedwith the �esaN or the �eseB mutant strain. These data demon-strate that EseJ is translocated into host cells and that the translo-cation of EseJ depends on the T3SS.

EseJ inhibits adhesion of E. tarda to fish EPC cells. E. tarda isable to adhere to and invade EPC cells (6). To investigate if EseJplays any role in this process, EPC cells were incubated for 30 minwith different strains expressing GFP. The infected monolayerswere then washed thoroughly before fixation, and 15 images perinfection were taken randomly to estimate the number of bacteriaassociated with host cells (Fig. 3A and B). Interestingly, the asso-ciation of the �eseJ mutant strain with EPC cells was consistentlyabout 5 times greater than that of the wild-type strain (Fig. 3A andB). Complementation of the �eseJ mutant strain reduced the hy-peradhesion phenotype back to the level of the wild-type strain(Fig. 3B). This indicates that EseJ plays a role in inhibiting E. tardaadhesion to EPC cells.

To determine whether the deletion of eseJ influences internal-ization of E. tarda by fish EPC cells, numbers of adherent bacteriaafter 30 min of incubation and internalized bacteria after 30 minof incubation and 1 h of treatment with gentamicin were esti-mated by CFU counting. As shown in Fig. 3C, the ratios of adher-ent bacteria to inoculated bacteria were 7.4% for the wild-typestrain and 22.1% for the �eseJ mutant strain. There were 0.59% ofthe inoculated wild type and 1.79% of the inoculated �eseJ mutantstrain internalized. However, the ratios of internalized bacteria toadherent bacteria were 8.0% for the wild-type strain and 8.1% forthe �eseJ mutant strain. These data suggest that EseJ inhibits ad-hesion but does not directly influence internalization by fish EPCcells.

To test if EseJ inhibits adhesion of E. tarda from outside orinside host cells, the �eseB translocator mutant strain was used inthe adhesion assay. EPC cells were incubated with bacteria for 30min, and adherent bacteria were enumerated with 15 images perinfection. Similar to the wild-type strain, the �eseB mutant strainhad about 5 times fewer adherent bacteria than the �eseJ mutantstrain (Fig. 4A). Deleting the eseJ gene in the �eseB mutant strain(�eseB �eseJ) led to enhanced adhesion that was indistinguishablefrom that of the �eseJ mutant strain. In agreement with previousreports (6, 31), a �esrB mutant strain displayed enhanced adhe-

FIG 2 Secretion and translocation of EseJ depend on the T3SS. (A) EseJ issecreted into the culture supernatant in a T3SS-dependent manner. Five per-cent of bacterial pellets (TBP) and 10% of culture supernatants (ECP) fromsimilar amounts of bacteria grown in DMEM were separated using SDS-PAGEand transferred onto PVDF membranes for immunoblotting. (B) Transloca-tion of EseJ depends on the T3SS. EPC cells were infected with the indicated E.tarda strains carrying the plasmid pACYC-eseJ::cyaA, and intracellular cAMPlevels were determined at different time points, as described in Materials andMethods. Means � SEM from three experiments are shown. ***, P � 0.001;NS, not significant.

Xie et al.

1654 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

sion compared with the wild-type strain (Fig. 4A). The �eseB mu-tant strain displayed no effect on the secretion of EseJ and EvpP, aprotein secreted by the T6SS (10), whereas there was no detectablesecretion of EseJ and EvpP by the �esrB mutant strain (Fig. 4B).These data suggest that EseJ inhibits bacterial adhesion from out-side host cells and that this inhibition is not associated with itstranslocation.

As translocation of EseJ was not required for inhibition of bac-terial adhesion, we tested if secretion of EseJ is essential for inhib-iting bacterial adhesion. For this, we used the �esaN mutant strainand a �esaN �eseJ strain for adhesion assay. As shown in Fig. 4A,the �esaN mutant strain displayed even less adhesion than thewild-type strain, whereas the �esaN �eseJ strain had adhesionsimilar to that of the �eseJ strain. Taken together, the data dem-onstrate that secretion of EseJ is not essential for inhibiting bacte-rial adhesion and that EseJ can function from within bacteria toinhibit bacterial adhesion.

EseJ facilitates E. tarda replication in host cells. Havingfound that EseJ inhibits bacterial adhesion to EPC cells, we testedif EseJ could also affect bacterial replication in EPC cells. For this,

FIG 3 (A and B) EseJ inhibits E. tarda adhesion to fish EPC cells. Fish EPC cellswere infected at an MOI of 10 with strains expressing GFP. After 30 min ofincubation (T0), cells were fixed and scanned using confocal microscopy. (A)Representative images after confocal microscopy analysis. (B) Quantificationof cell-associated bacteria per field. Fifteen fields from each infection werequantified, and averages from three independent experiments are shown. Dataare means � SEM. ***, P � 0.001. (C) EseJ is not directly involved in bacterialinternalization. Fish EPC cells were infected with wild-type or �eseJ mutant

strains. After 30 min of incubation (T0; adhesion) or 30 min of incubationfollowed by 1 h gentamicin treatment (T1; internalization), cells were washedand lysed to enumerate bacteria by plating. The ratios of adherent bacteria toinput bacteria, internalized bacteria to input bacteria, and internalized bacteriato adherent bacteria are shown. Data are means � SEM. ***, P � 0.001; NS,not significant.

FIG 4 EseJ inhibits E. tarda adhesion to EPC cells from inside bacteria. (A)EseB and EsaN are not required for inhibiting bacterial adhesion. Fish EPCcells were infected with E. tarda strains expressing GFP and fixed to quantifyadherent bacteria, as described for Fig. 3. Data are means � SEM. ***, P �0.001; NS, not significant. (B) Secretion of EseJ by �eseB, �eseJ, and �esrBmutant and wild-type strains. (Left) Coomassie blue staining; (right) immu-noblotting.

EseJ Inhibits Adhesion and Facilitates Replication

April 2015 Volume 83 Number 4 iai.asm.org 1655Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

EPC cells were infected with the wild-type and �eseJ mutantstrains, followed by enumeration of intracellular bacteria by plat-ing at 1 h and 5.5 h postinfection. Although the internalization ofthe �eseJ mutant strain was significantly more extensive than thatof the wild-type strain at 1 h postinfection, the numbers of intra-cellular bacteria were similar between the wild-type and �eseJ mu-tant strains at 5.5 h postinfection (Fig. 5A, left). When normalizedto the bacterial number at 1 h postinfection, the increase (n-fold)of the wild-type strain was significantly higher than that of the�eseJ mutant strain (Fig. 5A, right). This indicates that EseJ isrequired for efficient replication of E. tarda in EPC cells.

As E. tarda is reported to replicate in fish primary macrophagesand mouse macrophages (6, 7) in addition to EPC cells, we alsoevaluated EseJ’s contribution to replication in this cell type usingJ774A.1 macrophages. Expression of T3SS genes of E. tardaPPD130/91 is drastically downregulated when the bacteria aregrowing at 37°C; therefore, we performed infections at 35°C, con-ditions under which the T3SS genes are well expressed (18, 32).J774A.1 macrophages were incubated with the wild-type or �eseJmutant strain for 30 min at 35°C and then washed extensivelybefore cells were lysed for plating (T0) or for infection for eitheranother 30 min (T0.5) or 1 h (T1) in DMEM containing 100�g/ml gentamicin followed by bacterial enumeration. As shownin Fig. 5B, uptake of the �eseJ mutant strain was significantlyhigher than uptake of the wild type at T0 and T0.5. However, byT1, the intracellular �eseJ mutant was 2 times less numerous thanthe wild type. This indicates that EseJ inhibits uptake of E. tarda bymacrophages and is required for E. tarda survival in macrophages.Next, we compared uptake of opsonized wild-type and �eseJ mu-tant strains by J774A.1 macrophages. Unlike with nonopsonizedbacteria, there was no difference in uptake by J774A.1 macro-phages at 1 h postinfection between wild-type and �eseJ mutantstrains (Fig. 5B). To examine bacterial replication with a similarnumber of internalized bacteria, we used opsonized forms of bothstrains prior to infecting macrophages. At 1 h, 3 h, and 5 h postin-fection, intracellular bacteria were enumerated by plating. Com-pared to the numbers of intracellular bacteria at 1 h postinfection,the wild-type strain’s bacterial load increased 3.7 and 8.7 times at3 h and 5 h postinfection, respectively. However, the numbers ofthe intracellular �eseJ mutant strain did not significantly increaseduring the course of the experiment (Fig. 5C). The replicationdefect of the �eseJ mutant was partially rescued by introducing acomplementing plasmid into the mutant (Fig. 5C). These dataindicate that EseJ is required for E. tarda replication in J774A.1macrophages.

EseJ can inhibit bacterial adhesion to EPC cells from withinbacterial cells (Fig. 4A), so we asked if blocking secretion/trans-location of EseJ would impair bacterial replication in J774A.1macrophages. To specifically block secretion/translocation ofEseJ, we fused GST to the N terminus of EseJ by constructingplasmid pACYC-gst::eseJ-2HA. The plasmid was transferredinto the �eseJ mutant strain for analysis. As shown in Fig. 5D,there was no detectable secretion of GST::EseJ-2HA. However,the intracellular replication defect of the �eseJ mutant could becomplemented by introducing the plasmid pACYC-gst::eseJ-2HA, suggesting that blocking secretion/translocation of EseJdoes not impair bacterial replication in J774A.1 macrophagesor that a small amount of undetectable free secreted/translo-cated EseJ is sufficient to facilitate bacterial replication inJ774A.1 macrophages.

Production of ROS by wt-infected macrophages is less thanthat by �eseJ mutant-infected macrophages. Virulent E. tardaPPD130/91 could replicate within phagocytes, while the avirulentstrain PPD125/87 could not. Furthermore, only avirulent E. tardaelicited a higher production of ROS by phagocytes, indicating thatthe avirulent strain was unable to avoid and/or resist reactive ox-ygen radical-based killing by the fish phagocytes (33). The �eseJmutant strain was unable to replicate within J774A.1 macro-phages; therefore, we examined whether deletion of eseJ affectsproduction of ROS by J774A.1 macrophages. Cells were infectedwith opsonized bacteria for 1 h, and ROS were evaluated usingCell Biolabs’ Oxiselect intracellular ROS assay kit, which is a cell-based assay for measuring hydroxyl, peroxyl, or other reactiveoxygen species activity within a cell. As shown in Fig. 6, the �eseJmutant strain stimulated a significantly higher level of ROS thanwild-type did. This indicates that EseJ may prevent the efficientproduction of ROS by infected macrophages.

EseJ contributes to E. tarda pathogenesis in vivo. To deter-mine the contribution of EseJ to E. tarda pathogenesis, we deter-mined the 50% lethal dose (LD50) of the �eseJ mutant strain usingthe blue gourami fish model. In this study, LD50 refers to theminimum lethal dose of E. tarda required to kill half of the bluegourami tested within 7 days. The LD50 of the �eseJ mutant strainwas 2.34 times higher than that of the wild-type strain (Table 3).

Next, mixed-infection assays were performed in blue gouramifish to test if the �eseJ mutant strain is less competitive than thewild-type in vivo. When equal numbers of wild-type and �eseJbacteria were mixed and used to infect naive blue gourami, the�eseJ mutant was less competitive than the wild type in both headkidneys (CI 0.41 � 0.16) and livers (CI 0.55 � 0.23) (Fig. 7).Together, these in vivo experiments demonstrate that EseJ con-tributes to E. tarda pathogenesis.

DISCUSSION

E. tarda is an intracellular pathogen that uses T3SS to facilitate itsintracellular lifestyle in both epithelial and phagocytic cells (6, 7).Apart from EseG (18), little is known about T3SS effectors of thisimportant fish pathogen. In this study, we identified the secondT3SS effector of E. tarda known to date, EseJ.

Tan et al. (6) first identified the T3SS of E. tarda PPD130/91through a combination of genome walking and PCR, and theypredicted that orf29 and orf30 encode two proteins. In this study,by comparing the secretion profiles of the wild-type strainPPD130/91 and its T3SS ATPase �esaN mutant, we found an un-known protein band, and MALDI-TOF mass spectrometry re-vealed that it contains the predicted protein products of both orf29and orf30. DNA sequencing confirmed that the predicted orf29and orf30 are actually one open reading frame, encoding a singleprotein composed of 1,359 amino acids, which has been namedeseJ according to the established nomenclature for Edwardsiellaeffectors (6). Based on DNA sequence data, EseJ and its homo-logue are predicted to be present in E. tarda EIB202 (GenBankaccession no. YP_003294944.1) and E. ictaluri 93-146 (GenBankaccession no. ABC60092), suggesting that EseJ is a general effectorof Edwardsiella species.

We show here that EseJ is an important virulence factor of E.tarda. Deletion of eseJ results in attenuation of E. tarda in bluegourami fish, as shown by single infection and mixed infectionafter intramuscular injection (Table 3 and Fig. 7). One possibleexplanation for the attenuation of the �eseJ mutant strain in vivo

Xie et al.

1656 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

FIG 5 EseJ facilitates E. tarda replication in EPC cells and J774A.1 cells. (A) Replication assay in EPC cells. EPC cell monolayers were infected by wt or �eseJmutant strains and lysed at 1 h or 5.5 h postinfection for bacterial enumeration by plating. (Left) Actual bacterial numbers at the indicated time points; (right)increase. The increase was calculated as the ratio of the number of intracellular bacteria at 5.5 h to that at 1 h postinfection. Data are means � SEM. NS, notsignificant; ***, P � 0.001; **, P � 0.01. (B) Assay of uptake by J774A.1 macrophages at 35°C. J774A.1 macrophages were incubated with nonopsonized oropsonized bacteria for 30 min and lysed (T0) or infected for another 30 min (T0.5) or 1 h (T1) in DMEM containing 100 �g/ml gentamicin before being lysedfor bacterial enumeration by plating. NS, not significant; ***, P � 0.001. (C) Replication assay in J774A.1 macrophages at 35°C. J774A.1 monolayers were infectedwith opsonized bacteria for 1 h, 3 h, and 5 h. The intracellular bacteria were enumerated by plating the cell lysates. The increase was calculated as a ratio of thenumber of intracellular bacteria at 3 h or 5 h to that at 1 h postinfection. The wt and complemented (�eseJ/pACYC-eseJ-2HA) strains were compared with the�eseJ mutant strain at corresponding time points. ***, P � 0.001. (D) Blocking secretion of EseJ does not impair bacterial replication in J774A.1 macrophages.(Left) Expression and secretion of GST-2HA, GST::EseJ-2HA, and EseJ-2HA. Five percent of bacterial pellets (TBP) and 10% of culture supernatants (ECP) fromsimilar amounts of bacteria grown in DMEM were separated using SDS-PAGE and transferred onto PVDF membranes for immunoblotting. (Right) Expressionof GST::EseJ-2HA in the �eseJ mutant strain restores bacterial replication in J774A.1 macrophages. J774A.1 monolayers were infected with opsonized bacteriafor 1 h, 3 h, and 5 h. The intracellular bacteria were enumerated by plating the cell lysates. The wt/pACYC-gst-2HA and �eseJ/pACYC-gst::eseJ-2HA strains werecompared with the �eseJ/pACYC-gst-2HA strain at corresponding time points. ***, P � 0.001.

April 2015 Volume 83 Number 4 iai.asm.org 1657Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

could be its inability to grow in macrophages. Consistently, the�eseJ mutant fails to grow in murine macrophage cells J774A.1(Fig. 5). Production of ROS by macrophages plays an impor-tant role in killing intracellular bacteria and inhibiting bacte-rial replication (34, 35, 36). Srinivasa Rao et al. (33) reportedthat opsonized E. tarda PPD130/91 replicates within bluegourami phagocytes, while the avirulent strain E. tarda PPD125/87 fails to survive because it elicits higher levels of ROS in phago-cytes. We found by Southern blotting that E. tarda PPD125/87does not have the eseJ gene (data not shown). Furthermore, whencomparing production of ROS by J774A.1 macrophages infectedwith wild-type and �eseJ mutant strains, we found that the �eseJmutant strain elicits higher production of ROS than the wild-typestrain (Fig. 6). We propose that EseJ prevents efficient productionof ROS by macrophages and hence is involved in avoiding/resist-ing reactive oxygen radical-induced killing in macrophages, thuspromoting bacterial replication.

EseJ not only facilitates growth of E. tarda in macrophages butalso plays a role in bacterial adhesion to fish EPC cells. Adhesion isoften an initial step critical for bacterial pathogenesis (37). Likeother bacteria, E. tarda PPD130/91 utilizes fimbriae to adhere tohost cells. Mutation of fimA in E. tarda PPD130/91 leads to itsadhesion being 5 times lower than that of the parent strain, result-ing in an attenuation in blue gourami fish after an intramuscularinfection protocol (38). Fimbriae are not the only adhesin utilizedby E. tarda, as several avirulent strains without the fimA gene ad-here to fish EPC cells at higher levels than E. tarda PPD130/91 (28,38). Afimbrial factors, such as hemagglutinin (39) and autotrans-

porter adhesin AIDA (40) of E. tarda, might also be involved inbacterial adhesion. Deletion of eseJ results in enhanced bacterialadhesion to fish EPC cells (Fig. 3); the adhesion of the �eseJ mu-tant strain is 5 times greater than that of the wild-type strain whendetermined by direct microscopic observation and 3 times greaterwhen assessed by CFU counting. Discrepancies between the abso-lute numbers obtained via the two methods may be attributed toassay sensitivity or other interassay technicalities. Nevertheless,our data demonstrate that EseJ reduces E. tarda adhesion to EPCcells. Invasion of host cells is the next process after adherence forpathogenic bacteria. Although the �eseJ mutant strain shows en-hanced adhesion to fish EPC cells, its internalization is similar tothat of the wild-type strain when internalized bacteria are normal-ized to the amount of adherent bacteria (Fig. 3C). This indicatesthat EseJ is not directly involved in E. tarda internalization. There-fore, we propose that EseJ inhibits E. tarda adherence to EPC cells.As in macrophages, EseJ is required for efficient replication of E.tarda in EPC cells. How E. tarda uses EseJ to control its adhesion toEPC cells is not clear at this stage. It is possible that EseJ repressesthe expression of bacterial adhesins or counteracts their function.This is supported by the following observation. (i) Secretion andtranslocation of EseJ are not necessary for the inhibition of E.tarda adhesion, as there is no enhanced bacterial adhesion to EPCcells for the translocator �eseB mutant strain and the secretion�esaN mutant strain (Fig. 4A). (ii) The �esaN �eseJ double mu-tant strain, the two-component regulatory system mutant strain(�esrB strain), and the �eseJ mutant strain show similar enhancedadhesion to EPC cells (Fig. 4A). (iii) Culture supernatant of thewild-type strain slightly but significantly suppresses the increasedadhesion phenotype of the �eseJ mutant strain, while culture su-pernatant of the �eseJ mutant strain does not (our unpublisheddata).

It is clear that EseJ can inhibit bacterial adhesion to EPC cellsfrom within E. tarda. However, it is not conclusive that secretionand translocation of EseJ are not essential to facilitate E. tardareplication in host cells. By fusing EseJ to the C terminus of GST,we observed that it blocks secretion of EseJ in vitro but still com-plements the �eseJ mutant strain replicating in J774A.1 macro-phages (Fig. 5D). This seems to suggest that secretion/transloca-tion of EseJ is not required for bacterial replication in J774A.1macrophages. However, one cannot rule out the possibility thatGST::EseJ could somehow release free EseJ, which is then secreted

TABLE 3 LD50 of the wild type and the �eseJ mutant of E. tardaPPD130/91

StrainWT proteinlength (aa)

Codonsdeleted LD50 P valuea

PPD130/91 105.07 � 0.04 NA�eseJ mutant 1,359 1–1359 105.44 � 0.10 �0.01�esaN18 mutant 438 21–421 105.94 � 0.19 �0.001a All P values refer to the wild-type LD50 and were determined by Student’s t test. NA,not available.

FIG 6 Production of ROS by J774A.1 macrophages. J774A.1 macrophageswere pretreated with 1 mM DCFH-DA for 40 min at 35°C and then infectedwith opsonized bacteria. ROS production at 1 h postinfection was quantifiedby comparing it with the DCF standard curve. The negative control was con-sidered the basal level of ROS produced by macrophages that were not infectedwith bacteria; the positive control was the level of ROS produced by macro-phages treated with the same amount of heat-killed wild type. Results aremeans � SD from one representative experiment. *, P � 0.05.

FIG 7 Competitive index analysis. Eight naive blue gourami fish were injectedintramuscularly with a mixture of equal numbers of wild-type and �eseJ mu-tant bacteria and sacrificed 72 h postinjection. CIs from livers and head kid-neys are given for individual fish, and means � SD are shown by the horizontallines. Student’s t test was used to calculate the P value with the hypotheticalmean of 1.0. ***, P � 0.001.

Xie et al.

1658 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

and translocated into host cells to facilitate bacterial replicationeven though it is undetectable by immunoblotting.

The physiological relevance of EseJ inhibiting E. tarda adhe-sion to EPC cells is unclear. Several antivirulence factors have beenidentified in Salmonella enterica serovar Typhimurium (41–44). Itis believed that these antivirulence factors prevent bacterial over-growth in the host and enable the pathogen to be transmitted toother vulnerable hosts. Although EseJ is not directly involved inbacterial internalization, it does downregulate bacterial internal-ization by downregulating bacterial adhesion (Fig. 3). We specu-late that E. tarda may utilize EseJ to fine-tune its interaction withhost cells in the initial infection to avoid uncontrolled hostilitytoward its host. This could help bacteria avoid host overreactionwhich would trigger the immune system to kill the bacteria ordecrease lethality, thereby increasing the transmission of E. tarda.

In summary, we identified a new E. tarda effector, EseJ, thatplays a role in inhibiting bacterial adhesion to fish EPC cells, pre-venting efficient production of ROS by macrophages to facilitatebacterial replication in macrophages and contributing to bacterialvirulence in fish. How EseJ regulates bacterial adhesion to EPCcells and prevents ROS production by macrophages is under in-vestigation.

ACKNOWLEDGMENTS

We are grateful to Kieran McGourty (University College London, UnitedKingdom) for his help with the manuscript.

This work was funded by NSFC grants 31172442 and 30972278 toH.-X.X., the National Basic Research Program of China, 973 program2009CB118703, to P.N. and Natural Sciences and Engineering ResearchCouncil of Canada (NSERC) Discovery Grant (372373-2010) and OpenFunding Project of the State Key Laboratory of Bioreactor Engineering ofChina to K.Y.L. X.-J.Y. acknowledges support from David W. Holden andDepartment of Medicine, Imperial College London.

REFERENCES1. Schlenker C, Surawicz CM. 2009. Emerging infections of the gastrointes-

tinal tract. Best Pract Res Clin Gastroenterol 23:89 –99. http://dx.doi.org/10.1016/j.bpg.2008.11.014.

2. Leung KY, Siame BA, Tenkink BJ, Noort RJ, Mok YK. 2012. Edward-siella tarda—virulence mechanisms of an emerging gastroenteritis patho-gen. Microbes Infect 14:26 –34. http://dx.doi.org/10.1016/j.micinf.2011.08.005.

3. Strauss EJ, Ghori N, Falkow S. 1997. An Edwardsiella tarda strain con-taining a mutation in a gene with homology to shlB and hpmB is defectivefor entry into epithelial cells in culture. Infect Immun 65:3924 –3932.

4. Okuda J, Kiriyama M, Yamanoi E, Nakai T. 2008. The type III secretionsystem-dependent repression of NF-kappaB activation to the intracellulargrowth of Edwardsiella tarda in human epithelial cells. FEMS MicrobiolLett 283:9 –14. http://dx.doi.org/10.1111/j.1574-6968.2008.01147.x.

5. Marques LRM, Toledo MRF, Silva NP, Magalhäes M, Trabulsi LR.1984. Invasion of HeLa cells by Edwardsiella tarda. Curr Microbiol 10:129 –132. http://dx.doi.org/10.1007/BF01576772.

6. Tan YP, Zheng J, Tung SL, Rosenshine I, Leung KY. 2005. Role of typeIII secretion in Edwardsiella tarda virulence. Microbiology 151:2301–2313. http://dx.doi.org/10.1099/mic.0.28005-0.

7. Okuda J, Arikawa Y, Takeuchi Y, Mahmoud MM, Suzaki E, Kataoka K,Suzuki T, Okinaka Y, Nakai T. 2006. Intracellular replication of Edward-siella tarda in murine macrophage is dependent on the type III secretionsystem and induces an up-regulation of anti-apoptotic NF-kappaB targetgenes protecting the macrophage from staurosporine-induced apoptosis.Microb Pathog 41:226 –240. http://dx.doi.org/10.1016/j.micpath.2006.08.002.

8. Tan YP, Lin Q, Wang XH, Joshi S, Hew CL, Leung KY. 2002. Com-parative proteomic analysis of extracellular proteins of Edwardsiella tarda.Infect Immun 70:6475– 6480. http://dx.doi.org/10.1128/IAI.70.11.6475-6480.2002.

9. Rao PS, Yamada Y, Tan YP, Leung KY. 2004. Use of proteomics toidentify novel virulence determinants that are required for Edwardsiellatarda pathogenesis. Mol Microbiol 53:573–586. http://dx.doi.org/10.1111/j.1365-2958.2004.04123.x.

10. Zheng J, Leung KY. 2007. Dissection of a type VI secretion system inEdwardsiella tarda. Mol Microbiol 66:1192–1206. http://dx.doi.org/10.1111/j.1365-2958.2007.05993.x.

11. Galán JE, Wolf-Watz H. 2006. Protein delivery into eukaryotic cells bytype III secretion machines. Nature 444:567–573. http://dx.doi.org/10.1038/nature05272.

12. Alto NM, Dixon JE. 2008. Analysis of Rho-GTPase mimicry by a family ofbacterial type III effector proteins. Methods Enzymol 439:131–143. http://dx.doi.org/10.1016/S0076-6879(07)00410-7.

13. Ogawa M, Handa Y, Ashida H, Suzuki M, Sasakawa C. 2008. Theversatility of Shigella effectors. Nat Rev Microbiol 6:11–16. http://dx.doi.org/10.1038/nrmicro1814.

14. Roehrich AD, Martinez-Argudo I, Johnson S, Blocker AJ, VeenendaalAK. 2010. The extreme C terminus of Shigella flexneri IpaB is required forregulation of type III secretion, needle tip composition, and binding. In-fect Immun 78:1682–1691. http://dx.doi.org/10.1128/IAI.00645-09.

15. Buttner D. 2012. Protein export according to schedule: architecture, as-sembly, and regulation of type III secretion systems from plant- and ani-mal-pathogenic bacteria. Microbiol Mol Biol Rev 76:262–310. http://dx.doi.org/10.1128/MMBR.05017-11.

16. Zheng J, Li N, Tan YP, Sivaraman J, Mok YK, Mo ZL, Leung KY. 2007.EscC is a chaperone for the Edwardsiella tarda type III secretion systemputative translocon components EseB and EseD. Microbiology 153:1953–1962. http://dx.doi.org/10.1099/mic.0.2006/004952-0.

17. Wang B, Mo ZL, Mao YX, Zou YX, Xiao P, Li J, Yang JY, Ye XH, LeungKY, Zhang PJ. 2009. Investigation of EscA as a chaperone for the Edward-siella tarda type III secretion system putative translocon component EseC.Microbiology 155:1260 –1271. http://dx.doi.org/10.1099/mic.0.021865-0.

18. Xie HX, Yu HB, Zheng J, Nie P, Foster LJ, Mok YK, Finlay BB, LeungKY. 2010. EseG, an effector of the type III secretion system of Edwardsiellatarda triggers microtubule destabilization. Infect Immun 78:5011–5021.http://dx.doi.org/10.1128/IAI.00152-10.

19. Nikolaus T, Deiwick J, Rappl C, Freeman JA, Schröder W, Miller SI,Hensel M. 2001. SseBCD proteins are secreted by the type III secretionsystem of Salmonella pathogenicity island 2 and function as a translocon.J Bacteriol 183:6036 – 6045. http://dx.doi.org/10.1128/JB.183.20.6036-6045.2001.

20. Hölzer SU, Hensel M. 2010. Functional dissection of translocon proteins ofthe Salmonella pathogenicity island 2-encoded type III secretion system.BMC Microbiol 10:104. http://dx.doi.org/10.1186/1471-2180-10-104.

21. Zheng J, Tung SL, Leung KY. 2005. Regulation of a type III and a putativesecretion system in Edwardsiella tarda by EsrC is under the control of atwo-component system, EsrA-EsrB. Infect Immun 73:4127– 4137. http://dx.doi.org/10.1128/IAI.73.7.4127-4137.2005.

22. Chakraborty S, Sivaraman J, Leung KY, Mok YK. 2011. The two-component PhoB-PhoR regulatory system and ferric uptake regulatorsense phosphate and iron to control virulence genes in type III and VIsecretion systems of Edwardsiella tarda. J Biol Chem 286:39417–39430.http://dx.doi.org/10.1074/jbc.M111.295188.

23. Wolf K, Mann JA. 1980. Poikilotherm vertebrate cell lines and viruses, acurrent listing for fishes. In Vitro 16:168 –179. http://dx.doi.org/10.1007/BF02831507.

24. Edwards RA, Keller LH, Schifferli DM. 1998. Improved allelic exchangevectors and their use to analyze 987P fimbria gene expression. Gene 207:149 –157. http://dx.doi.org/10.1016/S0378-1119(97)00619-7.

25. Simon R, Priefer U, Pühler A. 1983. A broad-host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Biotechnology 1:784 –791. http://dx.doi.org/10.1038/nbt1183-784.

26. Urbanowski ML, Brutinel ED, Yahr TL. 2007. Translocation of ExsE intoChinese hamster ovary cells is required for transcriptional induction of thePseudomonas aeruginosa type III secretion system. Infect Immun 75:4432–4439. http://dx.doi.org/10.1128/IAI.00664-07.

27. Valdivia RH, Falkow S. 1997. Fluorescence-based isolation of bacterialgenes expressed within host cells. Science 277:2007–2011. http://dx.doi.org/10.1126/science.277.5334.2007.

28. Ling SHM, Wang XH, Xie L, Lim TM, Leung KY. 2000. Use of greenfluorescent protein (GFP) to track the invasive pathways of Edwardsiellatarda in the in vivo and in vitro fish models. Microbiology 146:7–19.

EseJ Inhibits Adhesion and Facilitates Replication

April 2015 Volume 83 Number 4 iai.asm.org 1659Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

29. Reed LJ, Muench H. 1938. A simple method of estimating fifty percentend points. Am J Hyg (Lond) 27:493– 497.

30. Thune RL, Fernandez DH, Benoit JL, Kelly-Smith M, Rogge ML, BoothNJ, Landry CA, Bologna RA. 2007. Signature-tagged mutagenesis ofEdwardsiella ictaluri identifies virulence-related genes, including a Salmo-nella pathogenicity island 2 class of type III secretion systems. Appl Envi-ron Microbiol 73:7934 –7946. http://dx.doi.org/10.1128/AEM.01115-07.

31. Wang X, Wang Q, Xiao J, Liu Q, Wu H, Zhang Y. 2010. HemolysinEthA in Edwardsiella tarda is essential for fish invasion in vivo and in vitroand regulated by two-component system EsrA-EsrB and nucleoid proteinHhaEt. Fish Shellfish Immunol 29:1082–1091. http://dx.doi.org/10.1016/j.fsi.2010.08.025.

32. Chakraborty S, Li M, Chatterjee C, Sivaraman J, Leung KY, Mok YK.2010. Temperature and Mg2 sensing by a novel PhoP-PhoQ two-component system for regulation of virulence in Edwardsiella tarda. J BiolChem 285:38876 –38888. http://dx.doi.org/10.1074/jbc.M110.179150.

33. Srinivasa Rao PS, Lim TM, Leung KY. 2001. Opsonized virulentEdwardsiella tarda strains are able to adhere to and survive and replicatewithin fish phagocytes but fail to stimulate reactive oxygen intermediates.Infect Immun 69:5689 –5697. http://dx.doi.org/10.1128/IAI.69.9.5689-5697.2001.

34. Vazquez-Torres A, Xu Y, Jones-Carson J, Holden DW, Lucia SM,Dinauer MC, Mastroeni P, Fang FC. 2000. Salmonella pathogenicityisland 2-dependent evasion of the phagocyte NADPH oxidase. Science287:1655–1658. http://dx.doi.org/10.1126/science.287.5458.1655.

35. Subbian S, Mehta PK, Cirillo SLG, Bermudez LE, Cirillo JD. 2007. AMycobacterium marinum mel2 mutant is defective for growth in macro-phages that produce reactive oxygen and reactive nitrogen species. InfectImmun 75:127–134. http://dx.doi.org/10.1128/IAI.01000-06.

36. Mantena RKR, Wijburg OLC, Vindurampulle C, Bennett-Wood VR,Walduck A, Drummond GR, Davies JK, Robins-Browne RM, StrugnellRA. 2008. Reactive oxygen species are the major antibacterials against

Salmonella Typhimurium purine auxotrophs in the phagosome of RAW264.7 cells. Cell Microbiol 10:1058 –1073. http://dx.doi.org/10.1111/j.1462-5822.2007.01105.x.

37. Finlay BB, Falkow S. 1997. Common themes in microbial pathogenicityrevisited. Microbiol Mol Biol Rev 61:136 –169.

38. Srinivasa Rao PS, Lim TM, Leung KY. 2003. Functional genomicsapproach to the identification of virulence genes involved in Edwardsiellatarda pathogenesis. Infect Immun 71:1343–1351. http://dx.doi.org/10.1128/IAI.71.3.1343-1351.2003.

39. Wong JD, Miller MA, Janda JM. 1989. Surface properties and ultrastruc-ture of Edwardsiella species. J Clin Microbiol 27:1797–1801.

40. Sakai T, Matsuyama T, Sano M, Iida T. 2009. Identification of novelputative virulence factors, adhesin AIDA and type VI secretion system, inatypical strains of fish pathogenic Edwardsiella tarda by genomic subtrac-tive hybridization. Microbiol Immunol 53:131–139. http://dx.doi.org/10.1111/j.1348-0421.2009.00108.x.

41. Ho TD, Slauch JM. 2001. Characterization of grvA, an antivirulence geneon the Gifsy-2 phage in Salmonella enterica serovar Typhimurium. J Bac-teriol 183:611– 620. http://dx.doi.org/10.1128/JB.183.2.611-620.2001.

42. Mouslim C, Hilbert F, Huang H, Groisman EA. 2002. Conflictingneeds for a Salmonella hypervirulence gene in host and non-host environ-ments. Mol Microbiol 45:1019 –1027. http://dx.doi.org/10.1046/j.1365-2958.2002.03070.x.

43. Parsons DA, Heffron F. 2005. sciS, an icmF homolog in Salmonella en-terica serovar Typhimurium, limits intracellular replication and decreasesvirulence. Infect Immun 73:4338 – 4345. http://dx.doi.org/10.1128/IAI.73.7.4338-4345.2005.

44. Gal-Mor O, Gibson DL, Baluta D, Vallance BA, Finlay BB. 2008. Anovel secretion pathway of Salmonella enterica acts as an antivirulencemodulator during salmonellosis. PLoS Pathog 4:e1000036. http://dx.doi.org/10.1371/journal.ppat.1000036.

Xie et al.

1660 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 3, 2018 by guest

http://iai.asm.org/

Dow

nloaded from