In

Xa

b

c

a

ARRAA

KNCME

1

ptcSecnoctw42s

G

(tq

0d

Virus Research 140 (2009) 188–193

Contents lists available at ScienceDirect

Virus Research

journa l homepage: www.e lsev ier .com/ locate /v i rusres

dentification and characterization of a native epitope common toorovirus strains GII/4, GII/7 and GII/8

iao Lia,b, Rong Zhouc,∗, Youshao Wanga, Huiying Shengc, Xingui Tianc, Haitao Li c, Hongling Qiuc

South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou, Guangdong 510301, ChinaGraduate University of Chinese Academy of Sciences, Beijing 100049, ChinaSouth China Institute of Medical Virology, Guangzhou, Guangdong 510663, China

r t i c l e i n f o

rticle history:eceived 12 September 2008eceived in revised form 1 December 2008ccepted 4 December 2008vailable online 20 January 2009

a b s t r a c t

Norovirus is an important cause of acute non-bacterial gastroenteritis in humans. The norovirus genus iscomprised of at least five genogroups based on sequence differences. The norovirus genogroup II (GII/4)strain is recognized as the predominant genotype worldwide. We expressed a 60 kDa full-length recom-binant capsid protein of norovirus GII/4 in Escherichia coli and generated three monoclonal antibodies

eywords:orovirusapsid proteinonoclonal antibodies

pitope

(MAbs) against it. Western blotting indicated that all three MAbs had reactivity against the recombinantcapsid protein and a 58 kDa native capsid protein of norovirus obtained from stool samples. MAb-captureELISA showed that MAb detected segmental strains within GII antigens in clinical material. To identifythe existent range of this epitope, epitope analyses were processed by expressing 12 amino acids of theGST-fusion peptides. The epitope analyses revealed that the MAb N2C3 recognized a continuous nativeepitope 55WIRNNF60 in the shell domain, which not only belongs to strain GII/4, but also to strains GII/7and GII/8. This is a new native epitope to be reported for norovirus GII/4.

. Introduction

Noroviruses, which belong to the family Caliciviridae, are theredominant etiological agent of outbreaks of infectious gastroen-eritis, and is highly prevalent in both developing and developedountries (Fankhauser et al., 2002; Glass et al., 2001). In the Unitedtates, the CDC (Centers for Disease Control and Prevention) hasstimated that noroviruses are responsible for at least 23 millionases of food borne illness each year (Mead et al., 1999). In Japan,oroviruses account for 28% of cases of food poisoning and 99%f purely viral cases, which are attributed to the customs of foodonsumption (Nishida et al., 2003). Furthermore, strains belongingo the GII/4 cluster are recognized as the predominant genotypeorldwide and, in a precious study, GII/4 strains accounted for

3.7% of the sporadic cases and 85.8% of the outbreaks (Bull et al.,006). In China, the GII/4 strains have continued to be the dominanttrain identified in norovirus outbreaks (Fang et al., 2007).

∗ Corresponding author at: A-308, Technology Innovation Base, Science City,uangzhou, Guangdong 510663, China. Tel.: +86 20 32068018; fax: +86 20 32290712.

E-mail addresses: xiao 2005@hotmail.com (X. Li), zhou3218@yahoo.comR. Zhou), yswang@scsio.ac.cn (Y. Wang), shy-gir4020@163.com (H. Sheng),ianxingui7902@yahoo.com.cn (X. Tian), lht05102000@yahoo.com.cn (H. Li),tyunying@yahoo.com (H. Qiu).

168-1702/$ – see front matter © 2008 Elsevier B.V. All rights reserved.oi:10.1016/j.virusres.2008.12.004

© 2008 Elsevier B.V. All rights reserved.

Noroviruses possesses a single strand of positive-sense RNAgenome, 7–7.5 kb long, and comprise three open reading frames(ORFs) (Jiang et al., 1993). ORF1 encodes a nonstructural polypro-tein containing six genes, namely p48, nucleotide triphosphatase(NTPase), p22, VPg, 3CL protease and RNA polymerase (RdRp)(Hardy, 2005). ORF2 encodes a 58–65 kDa protein, which is themajor structural component of the capsid (Greenberg et al., 1981).ORF3 encodes a minor structural protein about 25–28 kDa. Recently,on the basis of phylogenetic analyses, noroviruses have beendivided into five genogroups: viruses in genogroup (G) I, II and IVcause human infections, while GIII and GV are associated with ani-mals, particularly bovine and mice (Fankhauser et al., 2002; Karstet al., 2003).

Studies of human noroviruses have been hampered by the lackof a cell culture system or an animal model. Nevertheless, a sig-nificant advance in studying the noroviruses has been achievedby inducing the expression of Norwalk virus (NV) capsid proteinin the baculovirus translation system; the end-product, a 58 kDaprotein, self-assembles to form empty virus-like particles (VLPs)similar to native NV both morphologically and antigenically (Greenet al., 1993; Jiang et al., 1992). Furthermore, the capsid protein

of norovirus expressed in an Escherichia coli system resemblesnative capsid protein characteristics in immunological research,and the monoclonal antibodies (MAbs) generated against this E.coli-expressed capsid protein can be used to detect the homologousantigens in clinical material (Yoda et al., 2001).

earch

np1darataale

rd(smwocbwGncet

2

2

sGRi2tiu

CbDNwn

2

rawsamsasap

X. Li et al. / Virus Res

Subsequently, the X-ray crystallographic structure of theorovirus has been resolved. The norovirus protein folds into tworincipal domains, the S domain, which is located at the N-terminal–225 amino acids, is the most conservated domain; and the Pomain, which is divided into two subdomains, has the most vari-ble P2 subdomain that is thought to play an important role ineceptor binding and host immune reactivity (Hardy, 2005; Tan etl., 2003). The S domain forms the interior shell of the capsid, whilehe P domain is located at the most exterior surface, and builds uprch-like structures extending from the shell (Bertolotti-Ciarlet etl., 2002). The S domain has been reported to form smooth, thin-ayer particles with a smaller size than VLPs when it, alone, wasxpressed in insect cells (Tan et al., 2004).

In previous studies, several MAbs have been generated againstecombinant norovirus capsid proteins, which were reported withifferent binding characteristics and different binding epitopesHardy et al., 1996; Treanor et al., 1988; Yoda et al., 2003). One studyhowed that an epitope that bound to the P1 domain was com-on to norovirus GI (Hale et al., 2000). In another study, an epitopeas identified on the P2 domain, which is involved in inhibitionf norovirus–cell interactions (Lochridge et al., 2005). Recently, aross-reactive linear epitope on the S domain in human GI andovine GIII was reported (Batten et al., 2006). In the present study,e generated three MAbs that against E. coli expressed norovirusII/4 capsid protein and these MAbs all recognized the 58 kDaative norovirus capsid protein. Epitope analyses showed that N2C3ould recognize an epitope common to GII/4, GII/7 and GII/8. Thispitope is a useful tool to further dissect the structural and antigenicopography of the norovirus virion.

. Materials and methods

.1. Virus, plasmid, E. coli and clinical specimens

Norovirus strain NVgz01, which was isolated from patient’s stoolample in our institute in Guangzhou in China, belongs to norovirusII/4 and was sequenced in our previous study (Zeng et al., 2007).ecombinant capsid protein of this strain was also prepared and

ts antigenicity was tested as described (Li et al., 2007). The pET-8a(+) expression vector, carrying a nucleotide sequence encodingwo hexahistidine tags, and the pGEX-4T3 expression vector carry-ng GST were used in the present study. The E. coli strain BL21 wassed as the host cell for these vectors.

Sixty clinical stool specimens were obtained from Guangzhouhildren’s Hospital (Guangzhou, GD). Fifty-three specimens hadeen previously characterized by IDEIA Norovirus (Dako, Glostrup,enmark) and real-time quantitation polymerase RT-PCR asorovirus GII positive (Kojima et al., 2002). Other seven samplesere taken from patients with diarrhea but who were known to beorovirus-negative was used as negative controls.

.2. Production of monoclonal antibodies

Balb/c mice were primed intraperitoneally with purified NVecombinant capsid protein (50 �g/mouse) in Freund’s completedjuvant and were then boosted intraperitoneally after 15 daysith this protein in Freund’s incomplete adjuvant. Production and

election of monoclonal antibodies were performed essentiallys described previously (Kohler and Milstein, 1975) with some

odifications. The culture medium of hybridomas collected from

uccessful fusions was screened for NV capsid by indirect ELISA withnegative control that was prepared using the pET-28a(+) expres-

ion vector. Positive hybridomas were cloned by limiting dilutionnd ascites fluid was generated by injecting hybridoma cells intoristine primed mice.

140 (2009) 188–193 189

2.3. Western blot analyses

The reactivity of the MAbs with the NVgz01 capsid protein wasanalyzed by Western blotting. Capsid proteins (10 �g) were mixedwith 2× loading buffer (1% SDS, 10% 2-mercaptoethanol, 0.0025%phenol red, 10% glycerol in 50 mM Tris–HCl, pH 6.8) and boiled for4 min at 95 ◦C. When proteins were separated by SDS-PAGE, thegels were electroblotted to a nitrocellulose sheet in transfer buffer(25 mM Tris–HCl, 192 mM glycine, 20% methanol (v/v)) and blockedin blocking buffer (1% BSA (w/v), 5% skimmed milk (w/v) in 10 mMPBS). Each MAb was used as a primary antibody at final dilutionsof 1:500 to 1:3000. The methods were performed as previouslydescribed (Burns et al., 1988).

2.4. Detection of Norwalk virus antigen in stool samples byMAb-capture ELISA (MACE)

Stool samples to be tested by MAb Antigen-Capture ELISAwere processed as described previously (Graham et al., 1994).96-Well polyvinylchloride microtiter plates (Greiner Bio-one, Frick-enhausen, Germany) were coated overnight at 4 ◦C with 100 �l ofMAb at a dilution of 1:500 in carbonate–bicarbonate buffer (pH 9.6).The plates were washed once (0.01 M PBS with 0.05% (v/v) Tween-20) and were blocked for 2 h at 37 ◦C in blocking buffer (1% (w/v)BSA and 5% (w/v) triton in 0.01 M PBS). A 10% suspension of the stoolsample in 0.01 M PBS was prepared and clarified by centrifugationfor 5 min at 10,000 rpm in 4 ◦C, then, 100 �l samples were addedto the plate wells and incubated for 1 h at 37 ◦C. The plates werewashed five times and 100 �l of rabbit anti-rNV polyclonal antiseraat a final dilution of 1:5000 in block buffer was added and the plateswere incubated for 1 h at 37 ◦C. The plates were washed five timesand 100 �l of horse radish peroxidase-conjugated goat anti-rabbitIgG (Boster Bio-technology, Wuhan, China) diluted 1:10,000 in 5%newborn calf serum (v/v) was added. The plates were incubated for1 h at 37 ◦C and were then washed five times. TMB peroxidase sub-strate was added and the plates were incubated for 10 min at 37 ◦C.The reaction was stopped by adding 1 M phosphoric acid and theabsorbance was determined at 450 nm with Multiskan MK3 platereader (Thermo Electron Corporation).

2.5. Expression of NVgz01 capsid protein fragments and S domainfragments

The pET-28a(+) expression vector was used to construct fusionprotein with a hexahistidine tag at the N-terminal region, and thepGEX-4T3 expression vector was used to express the short frag-ments (S domain fragments) by fusion GST. A series of NVgz01capsid protein fragments were generated from the recombi-nant plasmid pMD-18T-gz01-CP according to the domains of thenorovirus capsid protein structure. The pET-28a(+) primers hadsticky Nde1 sites at the upstream end and sticky EcoR1 sites atthe downstream end as indicated in bold letters in Table 1. All thedownstream oligonucleotides had a terminator (TAA) that followedthe EcoR1 sites to stop the C-terminal hexahistidine tag connectingwith recombinant capsid protein. The PCR experiments consisted of30 cycles of denaturation (94 ◦C for 45 s), primer annealing (49 ◦C for50 s) and extension (72 ◦C for 1 min). All PCR products were digestedwith appropriate enzymes followed by purification on agarosegel, and were ligated with Nde1 and EcoR1 previously digestedwith pET-28a(+) vector to generate the plasmids pET-gz01P1-1,pET-gz01P1-2, pET-gz01P2, and pET-gz01S. After transforming the

ligation mixtures to E. coli BL21, colonies were screened by PCRusing the same primers used to generate the fragments and recom-binants carrying the correct insert were used for expression. The Sdomain fragments were expressed by the pGEX-4T3 vector, whichwas developed using the same process as above, except the primers

190 X. Li et al. / Virus Research 140 (2009) 188–193

Table 1Primers used for the construction of NVgz01 capsid fragments and S domain fragments.

Clone Fragment Primer pair Oligonucleotide sequence

pET-gz01P1-1 NVgz01P1-1 NVgz01P1-1a 5′ GGGTATTCCATATGCCATTCACCGTCCCAATTTTA 3′

NVgz01P1-1b 5′ CCGGAATTCTTATTGGGTAGTGCCTAAGAGCAC 3′

pET-gz01P1-2 NVgz01P1-2 NVgz01P1-2a 5′ GGGTATTCCATATGCTCCCAGATTACTCAGGTAG 3′

NVgz01P1-2b 5′ CCGGAATTCTTAATCAAATCTAAAATAGCCAT 3′

pET-gz01P2 NVgz01P2 NVgz01P2a 5′ GGGTATTCCATATGCTGTCCCCCGTCAGCATCTG 3′

NVgz01P2b 5′ CCGGAATTCTTATACCCATTGTTGGGGTTCAT 3′

pET-gz01S NVgz01S NVgz01Sa 5′ GGGTATTCCATATGAAAATGTAATTGACCCCTGGA 3′

NVgz01Sb 5′ CCGGAATTCTTATTTGGTTCTTGACTCAACTGT 3′

pGEX-S1 S-1 pGEX-S1a 5′ CGCGGATCCTGGATTAGGAATAATTTTGTG 3′

pGEX-S1b 5′ AACGCCTCGAGAGAAAGGTATGGATTCAGATC 3′

pGEX-S2 S-2 pGEX-S2a 5′ CGCGGATCCAATCCATACCTTTCTCACCTG 3′

pGEX-S2b 5′ AACGCCTCGAGAGTTGGGAAATTTGGTGGGAC 3′

pGEX-S3 S-3 pGEX-S3a 5′ CGCGGATCCCCAAATTTCCCAACTGAAGGC 3′

pGEX-S3b 5′ AACGCCTCGAGGGTGGAATCATTTGATTGATT 3′

p X-S4aX-S4b

N sed fo

hase

2f

tcawwawcCTtiaa

2

aabpTdui

2

pocp

GEX-S4 S-4 pGEpGE

ucleotides in italics indicate the terminator and in bold indicate restriction sites u

ad sticky BamH1 sites and Xho1 sites (Table 1) and the primernnealing temperature was 54 ◦C. Protein expression and expres-ion products analyses were performed as described previously (Lit al., 2007).

.6. Detection of NVgz01 capsid protein fragments and S domainragments by indirect ELISA

NVgz01 capsid protein fragments and S domain fragments wereested by MAbs. 96-Well polyvinylchloride microtiter plates wereoated overnight at 4 ◦C with 100 �l of each fragment, preparedt 5 �g in carbonate–bicarbonate buffer (pH 9.6). The plates wereashed once with washing buffer and blocked for 2 h at 37 ◦Cith blocking buffer. 100 �l of each MAb was added to the plate

t a dilution of 1:5000 and incubated for 1 h at 37 ◦C. The platesere washed five times and 100 �l of horse radish peroxidase-

onjugated goat anti-mouse IgG (Boster Bio-technology, Wuhan,hina) diluted 1:10,000 in 5% newborn calf serum (v/v) was added.he plates were incubated for 1 h at 37 ◦C and washed a final fiveimes. TMB peroxidase substrate was added and the plates werencubated for 10 min at 37 ◦C. The reaction was stopped by theddition of 1 M phosphoric acid and absorbance was determinedt 450 nm with the Multiskan MK3 plate reader.

.7. Epitope analysis

Six 36 bp oligonucleotides (overlapping 18 bp) with BamH1 sitest the 5′ end and Xho1 sites at the 3′ end were synthesized as sensend antisense strands (Table 2). Each pair of oligonucleotides wereoiled at 95 ◦C and then slowly annealed for 1–2 h at room tem-erature at a concentration of 100 �mol/l in DEPC-treated water.he adapters were ligated with the pGEX-4T3 vector previouslyigested by BamH1 and Xho1 to generate the plasmids that weresed for expression. All of the expressed products were tested by

ndirect ELISA.

.8. Competitive inhibition analysis

The epitopes to be tested by competitive inhibition ELISA wererocessed. 96-Well polyvinylchloride microtiter plates were coatedvernight at 4 ◦C with 100 �l of full-length norovirus recombinantapsid protein at 5 �g in carbonate–bicarbonate buffer (pH 9.6). Thelates were washed once with washing buffer and were blocked for

5′ CGCGGATCCTCAAATGATTCCACCATTAAA 3′

5′ AACGCCTCGAGTTTGGTTCTTGACTCAACTGT 3′

r cloning.

2 h at 37 ◦C in blocking buffer. The MAb N2C3 was incubated withthe S1-1 to S1-6 protein fragments and norovirus stool samples atdilutions of 1:800,000 for 1 h at 37 ◦C. 100 �l of these mixtures wereadded to the wells and incubated for 1 h at 37 ◦C. The subsequentprocesses were performed as described for the detection of NVgz01capsid protein fragments and S domain fragments by indirect ELISA.

3. Results

3.1. Antibodies to recombinant norovirus capsid protein

Three monoclonal antibodies (MAbs), which were positive fornorovirus recombinant capsid protein ELISA, were produced andtheir isotypes were IgG2a and IgM. Using ELISA techniques, we gen-erated all of the protein components of the negative pET-28a(+)

vector in BL-21 as negative control to eliminate the hybridoma,which was producing antibodies to E. coli antigens. The ascites fluidELISA titer of N2C3, N7C2 and N4B1 were 25,600,000, 3,200,000 and160,000. All of the MAbs were specific for norovirus recombinantcapsid protein and native norovirus capsid protein present in stoolsamples, as demonstrated by Western blotting (Fig. 1), and showeda lack of reactivity with the negative control (not shown in the fig-ure). Competition ELISA revealed that N2C3 and N4B1 shared thesame epitope and N7C2 was positive on another epitope (Fig. 2).

3.2. MAbs to norovirus recombinant capsid protein can detectnative NV in stool samples using MAb-capture ELISA

A MACE was developed and tested with known positive and neg-ative stool samples to determine the utility of MAbs for detection ofNV antigen in stool samples. Fifty-three positive stool samples andseven negative controls were tested. N2C3 and N4B1 reacted withthirty-five norovirus positive samples, and none of them reactedwith negative controls. The positive rate was 66% (35/53). This resultindicated that the epitope recognized by this two MAbs was not acollective one in every stain of GII. This epitope might just exist incertain stains. The data for N7C2 and N8A9 are not shown becausethey were IgM.

3.3. Characterization of the epitope recognized by MAb N2C3

In the test for MAbs detection of native norovirus, N2C3 showedunique reactivity to the capsid protein of norovirus GII/4 and, there-

X. Li et al. / Virus Research 140 (2009) 188–193 191

Table 2Oligonucleotides used for the construction of epitope analysis fragments.

Clone Fragment Oligonucleotide sequences

pGEXS1-1 S1-1 5′ GATCCTGGATTAGGAATAATTTTGTGCAAGCCCCTGGTGGAC 3′

5′ TCGAGTCCACCAGGGGCTTGCACAAAATTATTCCTAATCCAG 3′

pGEXS1-2 S1-2 5′ GATCCGTGCAAGCCCCTGGTGGAGAGTTCACAGTATCCCCTC 3′

5′ TCGAGAGGGGATACTGTGAACTCTCCACCAGGGGCTTGCACG 3′

pGEXS1-3 S1-3 5′ GATCCGAGTTCACAGTATCCCCTAGAAACGCTCCAGGTGAAC 3′

5′ TCGAGTTCACCTGGTGCGTTTCTAGGGGATACTGTGAACTCG 3′

pGEXS1-4 S1-4 5′ GATCCAGAAACGCTCCAGGTGAAATACTATGGAGCGCGCCCC 3′

5′ TCGAGGGGCGCGCTCCATAGTATTTCACCTGGAGCGTTTCTG 3′

pGEXS1-5 S1-5 5′ GATCCATACTATGGAGCGCGCCCTTAGGCCCTGATCTGAATC 3′

5′ TCGAGATTCAGATCAGGGCCTAAGGGCGCGCTCCATAGTATG 3′

pGEXS1-6 S1-6 5′ GATCCTTAGGCCCTGATCTGAATCCATACCTTTCTC 3′

5′ TCGAGAGAAAGGTATGGATTCAGATCAGGGCCTAAG 3′

Bold letters indicate restriction sites used for cloning.

Fig. 1. Western blot analysis of expression products in E. coli and native norovirus stool samples with three MAbs. Purified NVgz01 recombinant capsid protein expressed in E.c ransfes ein fuw

faaa(was(

Ffo((Nprn

oli system and positive norovirus stool samples were separated by SDS-PAGE and tupernatants of MAb N2C3, N7C2 and N4B1. The NVgz01 recombinant capsid proteights of the recombinant capsid protein and native capsid protein are shown.

ore, it is necessary to characterize the epitope of N2C3 for furthernalysis. The NVgz01 capsid protein fragments, S domain fragmentsnd epitope analysis fragments were all tested by N2C3 and N4B1nd are shown in Fig. 3. N2C3 and N4B1 bound to the S1-1 fragmentWIRNNFVQAPGG) but not the S1-2 fragment (VQAPGGEFTVSP),

55 60

hich contained WIRNNF in the S domain. N7C2 showed char-cteristic that recognized an incontinuity epitope, which bound toeveral fragments, needed to be confirmed by further experimentsdata not shown).

ig. 2. Competition ELISA results for mAb N2C3, N7C2 and N4B1 reacted withull-length norovirus recombinant capsid protein. The letters from A to I markedn abscissa represent the two MAbs which used for coated (5 mg/l) and labeled25 mg/l) in one group of competition ELISA. (A) N7C2 (coated) + N7C2-E (labeled);B) N7C2 + N2C3-E; (C) N7C2 + N4B1-E; (D) N2C3 + N2C3-E; (E) N2C3 + N7C2-E; (F)2C3 + N4B1-E; (G) N4B1 + N4B1-E; (H) N4B1 + N7C2-E; (I) N4B1 + N2C3-E. The fiveillars from left to right in one group represent the concentrations of norovirusecombinant capsid protein, which were 0.16, 0.084, 0.056 and 0.042 mg/l, and theegative control.

rred to a nitrocellulose membrane, which was reacted with hybridoma cell culturesed with two His-tags and its molecular weight was about 60 kDa. The molecular

Norovirus capsid protein sequences available from GenBankwere aligned to determine the distribution of this epitope withinthe norovirus genus. The 55WIRNNF60 epitope was conserved inGII/4, GII/7 and GII/8, but not GI or other noroviruses (Fig. 4).

3.4. Competitive inhibition analysis

To confirm the accuracy of the 55WIRNNF60 epitope, a competi-tive inhibition test was constructed. The MAb N2C3 was separatelyincubated with S1-1 to S1-6 fragment proteins, NVgz01S fragmentprotein, norovirus stool samples and negative stool samples. Then

Fig. 3. A comparison of the reactivity between the MAb N2C3 and N4B1 recog-nized capsid protein fragments, S domain fragments and epitope analysis fragments.Reactivity of the MAbs was measured by indirect ELISA. The dilutions of N2C3 andN4B1 were 5 × 104 and 5 × 103. The letters a to n represent the fragment proteins:NVgz01P1-1, NVgz01P1-2, NVgz01P2, NVgz01S, S1, S2, S3, S4, S1-1, S1-2, S1-3, S1-4,S1-5, S1-6.

192 X. Li et al. / Virus Research 140 (2009) 188–193

Fig. 4. Sequence alignment of the epitope 55WIRNNF60 in genogroups I, II, III and MVN of the noroviruses. The partial capsid sequences are located between amino acids4 d is loa ; Bab,A own in

tnstcNnatt

Ffsrst

0 and 70, and the shaded box represents the epitope recognized by MAb N2C3 ans follows: NV, M87661; SeV, AB031013; SV, L07418; DSV, U04469; ChV, AB042808J277608; JV, AJ011099; NA-2, AF097917. Accession numbers of other strains are sh

he mixtures were reacted with full-length norovirus recombi-ant capsid protein which was coated in the plants. The result ishown in Fig. 5. N2C3 incubated with S1-1, NVgz01S (S) and posi-ive norovirus stool sample (A) did not react with the full-lengthapsid protein, which indicated that the antigen-binding site of2C3 was inhibited by the linear 55WIRNNF60 epitope and the

ative epitope of the norovirus capsid protein. Another fragmentnd negative stool sample could not inhibit N2C3 because no epi-ope 55WIRNNF60 was found in them. This result indirectly confirmshat 55WIRNNF60 is the epitope recognized by N2C3.

ig. 5. Competitive inhibition analysis of pre-incubated MAb N2C3 reacted withull-length norovirus recombinant capsid protein. All of the fragment proteins andamples incubated with N2C3 were marked on abscissa. The letters S, A, B and Cepresent the NVgz01S fragment, norovirus positive stool sample, norovirus negativetool sample and positive control (pre-incubated with PBS). S1-1 to S1-6 representshe epitope analysis fragments. The dilution of N2C3 was 1:800,000.

cated between amino acids 55–60. Accession numbers of strains in this figure areAM263418; HwV, U07611; Melks, X81879; MxV, U22498; gz01, DQ369797; Leeds,the figure.

4. Discussion

In this study, we used immunization with complete norovirusGII/4 recombinant capsid protein expressed by E. coli to producea hybridoma secreting a MAb (N2C3) that recognized an epitopecommon to the S domain of GII/4, GII/7 and GII/8 norovirus cap-sid proteins. MAbs were selected based on its reactivity in indirectELISA and Western blotting with negative control, which was gen-erated by an empty pET-28a(+) vector in E. coli BL-21. This controlcan eliminate MAbs that were reacted with E. coli connatural com-ponents. In a further study, N2C3 showed utility, but not a completematch to the PCR results from MAb-capture ELISA, to detect nativenorovirus in stool samples. The difference between these twoexperimental results probably reflects the extremely low levels ofnorovirus in some specimens and that they can be detected by real-time quantitation RT-PCR but not by ELISA, or it suggests that theepitope recognized by N2C3 is not a very broad reactive epitope ofhuman GII norovirus capsid protein.

The reactivity of MAb N2C3 suggests that it recognized a con-tinuous native epitope, and the MAbs generated against the E.coli-expressed capsid protein can be used to detect GII antigensin clinical material. Strain-specific and genogroup-specific MAbswere obtained from mice immunized orally, although to date theepitopes recognized by these antibodies have not been reported(Kitamoto et al., 2002). With the expectation of confirming the rea-son for differences between the ELISA results and the PCR results,and the utility of N2C3 that can be used in diagnostic assays, it isnecessary to fully characterize the epitope of N2C3.

To characterize the epitope of MAb N2C3, the S domain fragment(amino acid residues 50–225), P1-1 domain fragment (amino acid

residues 225–279), P1-2 domain fragment (amino acid residues406–520) and P2 domain fragment (amino acid residues 279–406)were constructed. When the reactivity of the MAb to the S domainwas confirmed, S-1 (amino acid residues 50–90), S-2 (amino acidresidues 85–130), S-3 (amino acid residues 125–170), S-4 (amino

earch

aset5

satn5

tsbts

e5

spatcN

peaNsnp

A

aT

Mofle

R

B

B

B

B

F

X. Li et al. / Virus Res

cid residues 165–225) and the six overlapping dodecamers off-et by six amino acids were constructed and expected to carry thepitope. The reactivity of N2C3 to the S1-1 fragment and not tohe S1-2 fragment confirmed the epitope to be the six amino acids5WIRNNF60.

There are 20 different types of clinically isolated norovirustrain capsid amino acid sequences in GenBank, which we alignednd found that GII/4, GII/7 and GII/8 have the same epitope inhis region. Sequence alignments for all these four genogroups oforovirus indicated that the 1, 2, 5 and 6 amino acids of epitope5WIRNNF60 were highly conserved, and all mutations appeared inhe 3 and 4 amino acid region, even in the two animal norovirustrains. The epitope with these mutations that can be recognizedy N2C3 are still not known. The precise characterization of epi-ope 55WIRNNF60 with broad reactivity will be examined in furthertudies.

The competitive inhibition analysis is a confirmatory test forpitope analysis. We found that MAb N2C3 recognized epitope5WIRNNF60. It is theoretically possible that the antigen-bindingite of N2C3 is inhibited by 55WIRNNF60. This assumption was sup-orted by the results of competitive inhibition analysis. The S1-1nd NVgz01 fragments and norovirus stool sample including epi-ope 55WIRNNF60 inhibited the reaction of N2C3 to the full-lengthapsid protein. This result is evident for the interaction between2C3 and epitope 55WIRNNF60.

Characterization of epitope sequences of the norovirus capsidrotein will help us to develop an epitope map, and will enable thexpression of relevant antigenic peptides to improve immunologynd diagnostic assays for norovirus. The characteristics of the MAb2C3 epitope indicates that 55WIRNNF60 is not specific to the GII/4

train epitope, but it still can be a useful tool for detecting GII/4orovirus in China, where the GII/4 strain is thought to be the majorrevalent strain of norovirus infection gastroenteritis.

cknowledgements

This project was supported by Guangdong Provincial Sciencend Technology program for social development from Science andechnology Bureau of Guangdong Province.

The authors wish to thank Dr. Yiwei Tang (Vanderbilt Universityedical Center Nashville, TN) and Dr. Qiwei Zhang (Department

f Microbiology Faculty of Medicine, The University of Hong Kong)or their thoughtful comments. They also wish to thank many col-eagues who kindly provided assistance and information with thexperiments.

eferences

atten, C.A., Clarke, I.N., Kempster, S.L., Oliver, S.L., Bridger, J.C., Lambden, P.R., 2006.Characterization of a cross-reactive linear epitope in human genogroup I andbovine genogroup III norovirus capsid proteins. Virology 356 (1–2), 179–187.

ertolotti-Ciarlet, A., White, L.J., Chen, R., Prasad, B.V., Estes, M.K., 2002. Structuralrequirements for the assembly of Norwalk virus-like particles. J. Virol. 76 (8),4044–4055.

ull, R.A., Tu, E.T., McIver, C.J., Rawlinson, W.D., White, P.A., 2006. Emergence of anew norovirus genotype II.4 variant associated with global outbreaks of gas-troenteritis. J. Clin. Microbiol. 44 (2), 327–333.

urns, J.W., Greenberg, H.B., Shaw, R.D., Estes, M.K., 1988. Functional and topographi-cal analyses of epitopes on the hemagglutinin (VP4) of the simian rotavirus SA11.J. Virol. 62 (6), 2164–2172.

ang, Z.Y., Xie, H.P., Lv, H.X., Zhang, Q., Duan, Z.J., Steele, D., Jiang, B., Jiang, X., 2007.Investigation of human calicivirus (HuCV) diarrhea among infantile and youngchildren in China, 1999—2005. Bing Du Xue Bao 23 (1), 9–15.

140 (2009) 188–193 193

Fankhauser, R.L., Monroe, S.S., Noel, J.S., Humphrey, C.D., Bresee, J.S., Parashar, U.D.,Ando, T., Glass, R.I., 2002. Epidemiologic and molecular trends of “Norwalk-like viruses” associated with outbreaks of gastroenteritis in the United States. J.Infect. Dis. 186 (1), 1–7.

Glass, R.I., Bresee, J., Jiang, B., Gentsch, J., Ando, T., Fankhauser, R., Noel, J., Parashar,U., Rosen, B., Monroe, S.S., 2001. Gastroenteritis viruses: an overview. NovartisFound Symp. 238, 5–19 (discussion 19–25).

Graham, D.Y., Jiang, X., Tanaka, T., Opekun, A.R., Madore, H.P., Estes, M.K., 1994. Nor-walk virus infection of volunteers: new insights based on improved assays. J.Infect. Dis. 170 (1), 34–43.

Green, K.Y., Lew, J.F., Jiang, X., Kapikian, A.Z., Estes, M.K., 1993. Comparison of thereactivities of baculovirus-expressed recombinant Norwalk virus capsid antigenwith those of the native Norwalk virus antigen in serologic assays and someepidemiologic observations. J. Clin. Microbiol. 31 (8), 2185–2191.

Greenberg, H.B., Valdesuso, J.R., Kalica, A.R., Wyatt, R.G., McAuliffe, V.J., Kapikian,A.Z., Chanock, R.M., 1981. Proteins of Norwalk virus. J. Virol. 37 (3),994–999.

Hale, A.D., Tanaka, T.N., Kitamoto, N., Ciarlet, M., Jiang, X., Takeda, N., Brown, D.W.,Estes, M.K., 2000. Identification of an epitope common to genogroup 1 “norwalk-like viruses”. J. Clin. Microbiol. 38 (4), 1656–1660.

Hardy, M.E., 2005. Norovirus protein structure and function. FEMS Microbiol. Lett.253 (1), 1–8.

Hardy, M.E., Tanaka, T.N., Kitamoto, N., White, L.J., Ball, J.M., Jiang, X., Estes, M.K.,1996. Antigenic mapping of the recombinant Norwalk virus capsid protein usingmonoclonal antibodies. Virology 217 (1), 252–261.

Jiang, X., Wang, M., Graham, D.Y., Estes, M.K., 1992. Expression, self-assembly,and antigenicity of the Norwalk virus capsid protein. J. Virol. 66 (11), 6527–6532.

Jiang, X., Wang, M., Wang, K., Estes, M.K., 1993. Sequence and genomic organizationof Norwalk virus. Virology 195 (1), 51–61.

Karst, S.M., Wobus, C.E., Lay, M., Davidson, J., Virgin, H.W.t., 2003. STAT1-dependentinnate immunity to a Norwalk-like virus. Science 299 (5612), 1575–1578.

Kitamoto, N., Tanaka, T., Natori, K., Takeda, N., Nakata, S., Jiang, X., Estes, M.K.,2002. Cross-reactivity among several recombinant calicivirus virus-like parti-cles (VLPs) with monoclonal antibodies obtained from mice immunized orallywith one type of VLP. J. Clin. Microbiol. 40 (7), 2459–2465.

Kohler, G., Milstein, C., 1975. Continuous cultures of fused cells secreting antibodyof predefined specificity. Nature 256 (5517), 495–497.

Kojima, S., Kageyama, T., Fukushi, S., Hoshino, F.B., Shinohara, M., Uchida, K., Natori,K., Takeda, N., Katayama, K., 2002. Genogroup-specific PCR primers for detectionof Norwalk-like viruses. J. Virol. Methods 100 (1–2), 107–114.

Li, X., Zhou, R., Hu, L.B., Tian, X.G., Zhong, J.Y., Sheng, H.Y., Wang, C.B., Wang, Y.S.,2007. Cloning, expression and immunocharacterization of the capsid protein ofhuman Norwalk virus Guangzhou strain NVgz01. Nan Fang Yi Ke Da Xue Xue Bao27 (9), 1410–1413.

Lochridge, V.P., Jutila, K.L., Graff, J.W., Hardy, M.E., 2005. Epitopes in the P2 domain ofnorovirus VP1 recognized by monoclonal antibodies that block cell interactions.J Gen Virol 86 (Pt 10), 2799–2806.

Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M.,Tauxe, R.V., 1999. Food-related illness and death in the United States. Emerg.Infect. Dis. 5 (5), 607–625.

Nishida, T., Kimura, H., Saitoh, M., Shinohara, M., Kato, M., Fukuda, S., Munemura,T., Mikami, T., Kawamoto, A., Akiyama, M., Kato, Y., Nishi, K., Kozawa, K., Nishio,O., 2003. Detection, quantitation, and phylogenetic analysis of noroviruses inJapanese oysters. Appl. Environ. Microbiol. 69 (10), 5782–5786.

Tan, M., Hegde, R.S., Jiang, X., 2004. The P domain of norovirus capsid proteinforms dimer and binds to histo-blood group antigen receptors. J. Virol. 78 (12),6233–6242.

Tan, M., Huang, P., Meller, J., Zhong, W., Farkas, T., Jiang, X., 2003. Mutations withinthe P2 domain of norovirus capsid affect binding to human histo-blood groupantigens: evidence for a binding pocket. J. Virol. 77 (23), 12562–12571.

Treanor, J., Dolin, R., Madore, H.P., 1988. Production of a monoclonal antibody againstthe Snow Mountain agent of gastroenteritis by in vitro immunization of murinespleen cells. Proc. Natl. Acad. Sci. U.S.A. 85 (10), 3613–3617.

Yoda, T., Suzuki, Y., Terano, Y., Yamazaki, K., Sakon, N., Kuzuguchi, T., Oda, H.,Tsukamoto, T., 2003. Precise characterization of norovirus (Norwalk-like virus)-specific monoclonal antibodies with broad reactivity. J. Clin. Microbiol. 41 (6),2367–2371.

Yoda, T., Terano, Y., Suzuki, Y., Yamazaki, K., Oishi, I., Kuzuguchi, T., Kawamoto, H., Uta-gawa, E., Takino, K., Oda, H., Shibata, T., 2001. Characterization of Norwalk virusGI specific monoclonal antibodies generated against Escherichia coli expressedcapsid protein and the reactivity of two broadly reactive monoclonal antibodies

generated against GII capsid towards GI recombinant fragments. BMC Microbiol.1, 24.

Zeng, Q.Y., Zhong, J.Y., Li, X., Su, X.L., Zu, B., Chen, Y., Lin, T., Xiao, M.S., Sheng, H.Y.,Zhou, R., Gong, S.T., 2007. The complete getmmic sequence analysis of humanNorovirus NVgz01 strain in Guangzhou. Chin. J. Microbiol. Immunol. 27 (4),332–336.