Molecular Biology of PharmacologyIndwiani AstutiDept. of Pharmacology & Toxicology Fac. Of Medicine Gadjah Mada University

IntroductionPharmacology: knowledge of how drugs interact with body constituents to produce therapeutic effectsThe elucidation of molecular mechanisms of drug response, the development of new drugs, & the formulation of clinical guidelines for safe & effective use of drugs in therapy or prevention of disease & in relief symptoms.

Structure of DNA

The central dogma of molecular biologyThe flow of the expression of genetic information in cells is almost exclusively one way: DNA RNA Protein

A gene codes for a protein CCTGAGCCAACTATTGATGAAPEPTIDECCUGAGCCAACUAUUGAUGAA

Pharmacological responses by molecular interaction of drugs with cells, tissues, or other body constituentsThe key word is molecularWhat specific biological molecules must be present ?How do drugs & biological molecules interact to produce changes ?How are these changes converted into observable responses ?

Efficacy & Safety

Drug discovery and development in genomics eraFluidsHigh-throughput technologiesRobotics & BioinformaticsSystem Biology Drug discovery & development Identification & validation of new drug targets Modeling of disease progression Identification of novel diagnostic or prognostic markers Pathogenesis of diseasesPharmacogenomics Drug respons

DNAGenomicsmRNATranscriptomicsProteinProteomicsProtein-complexFunctional ProteomicsMetabolitesMetabolomics Cell level Tissue level Organ level

Pharmacogenomic/geneticThere is substantial heterogenesity in the way individuals respond to medications, in terms of both toxicity and treatment efficacy."pharmacogenetics," which initially focused largely on genetic polymorphisms in drug metabolizing enzymes, and how this translates into inherited differences in drug effects

Pharmacogenetics developedThe first observations of genetic variation in drug response date from the 1950s, the muscle relaxant suxamethonium chloride, and drugs metabolized by N-acetyltransferase. One in 3500 Caucasians has less efficient variant of the enzyme (butyrylcholinesterase) that metabolizes suxamethonium chloride (muscle relaxant) drugs effect is prolonged, with slower recovery from surgical paralysis.

Variation in the N-acetyltransferase gene divides people into slow acetylators and fast acetylators, with very different half-lives and blood concentrations of such important drugs as isoniazid (antituberculosis) and procainamide (antiarrhythmic).slow acetylator recessiveratio fast : slow Europe 40 : 60; USA 55 : 45Japan 85 : 15; Oriental 10 : 90Inuit 95 : 5

From: Evans WE, Relling MV. Pharmacogenomics: Translating functional genomics into rational therapeutics. Science 286:487-491, 1999. Genetic polymorphisms in drug metabolizing enzymes

1960s it became apparent that other drug metabolising enzymes, particularly the cytochrome P450-dependent monooxygenases, were also polymorphic.1970s with the identification of the cytochrome P450 CYP2D6 debrisoquine hydroxylase polymorphismPolymorphisms in further cytochrome P450s, as well as in other drug metabolising enzymes, were subsequently discovered. With the development of recombinant DNA technology, the molecular basis of most of these polymorphisms

The study of Pharmacogenomics focuses on drug action based on a patients genotype (DNA) and/or molecular phenotype (DNA/RNA/protein). Pharmacogenomics tests resultant from such analyses will allow for the recognition of those patients for whom a particular therapy would be most efficacious, or for which there would be least likely incidence of adverse events. Thus, the major goal of pharmacogenomics is to individualize patient therapy.

APPLICATION OF PHARMACOGENETICS TO DRUG DISCOVERY AND USE

Most therapeutic drugs are administered orally and need to be absorbed across the GI tract to enter the circulation. This process can be influenced by the presence of drug transporters, such as the multi-drug resistance protein, MDR1, and metabolic enzymes such as the cytochrome P450-dependent monooxygenases, in particular members of the cytochrome P450 CYP3A gene family (CYP3A4, CYP3A5 and CYP2D6)The importance of the drug transporter proteins is exemplified by the finding that marked changes in drug absorption and pharmacokinetics are observed in mice nulled at the Mdr1 gene locus

Pharmacogenetics and cancer chemotherapy polymorphism of drug-metabolizing enzymes polymorphism of receptors leads to a prolonged half-life and a reduced elimination of cytotoxic drugs. A consequence could be an adverse side reaction due to an excessive drug toxicity in non-cancer tissues.

Dehydropyrimidine dehydrogenase (DPD) is the initial rate limiting enzyme in the catabolism of 5 fluorouracil (5FU)located on chromosome 1p22 as a single copy and consists of 23 exons for a total lenght of 950 kb 1 splice-site mutation, 2 deletions and 4 missense mutations. Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that preferentially catalyzes the S-methylation of mercaptopurine (6MP), azothioprine and thioguanine hematopoietic toxicity (leucopenia, anaemia, pancytopenia)located to human chromosome 6 and several mutant alleles have been isolated from TPMT-deficient patients.

Glutathione S--transferases catalyze the conjugation of electrophilic compounds to cellular glutathione absence of GSTm 1 in children with acute lymphoblastic leukemia is associated with a 82% remission versus only 52% in children positive for GSTm . Busulfan is an alkylating agent

N-acetyltransferases exist as two isoforms respectively termed NAT1 and NAT2 and have been initially described as the enzymes responsible for the acetylation of isoniazid and caffeine (conversion of 1-methylxanthine into 5-acetylamino 6-amino 3-methyl uracil).NAT2 is located on human chromosome 8q11. Amonafide (NSC308847) fast acetylators defined by their caffeine phenotype of NAT2 have significantly greater leukopenia than slow acetylators, as well as higher bone marrow toxicity at the standard dose of 300mg/m2 daily for 5 days.

Angiotensinogen: the application of pharmacogenomics to the treatment of hypertension

The AGT gene, in particular, has shown the strongest and most consistent associations (5 9) with the risk of CHD and certain forms of hypertension. The AGT gene, located on chromosome 1, consists of approximately 13,000 nucleotide base pairs organized into 5 exons, and 4 introns

New drugs design (for exz.)Receptor with intrinsic Tyrosine Kinase ActivityLarge group of receptors for growth factors (insulin, EGF, PDGF, hepatocyte GF etc)Extracellular domain contains regions bind GF, Intracellular domain contains a kinase activity capable of phosphorylating proteins on tyrosine residues

Biology target therapy.??

VEGF makes the tumour vessels abnormal1Jain RK. Semin Oncol 2002;29(Suppl. 16):39; 2Carmeliet P. Nat Med 2003;9:65360Maturation factorsNo growth factorsTightLeakyIntegrins Fewer support cellsGrowth factors (VEGF) Support cells Normal vesselTumour vessel

VEGF overexpression correlates with poor cancer prognosis1Jacobsen J, et al. BJU Int 2004;93:297302; 2Maeda K, et al. Int J Mol Med 2000;5:3738 3OByrne KJ, et al. Br J Cancer 2000;82:142732; 4Gasparini G, et al. J Natl Cancer Inst 1997;89:13947; 5Shih CH, et al. Clin Cancer Res 2000;6:11618; 6Verstovsek S, et al. Blood 2002;99:22657; 7Yamamoto S, et al. Br J Cancer 1997;76:12217

Cancer

n

Tumours (%)

Prognostic value

Breast1

260

95

Relapse-free survival, overall survival

Non-small cell lung2

223

47

Tumour size, vascular density

Colorectal3

100

37

Overall prognosis

Oesophageal4

117

31

Overall survival

Ovarian5

70

97

Overall survival

Renal6

229

100

Tumour size and stage, survival

Chronic myeloid leukaemia7

184

100

Survival

RhuMAb VEGF (bevacizumab/AvastinTM) Recombinant humanised monoclonal anti-VEGF antibody developed from murine anti-VEGF mAb A4.6.1193% human, 7% murinehas similar affinity to VEGF as murine antibodydoes not induce immune response in humansbinds to primate VEGF and rabbit VEGF but not to rat or mouse VEGFbinds to all isoforms of VEGF1Presta LG, et al. Cancer Res 1997;57:45939

Anti-VEGFReducesinterstitial fluid pressurevessel density

Increasesdrug deliveryAnti-VEGF antibody normalises the tumour vasculatureJain R. Nature Med 2001;7:9879; Willett CG, et al. Nat Med 2004;10:1457; Tong R, et al, Cancer Res 2004;64:37316

Herceptin (c-erb2)Product oncogen (EGFR)Receptor Growth factors familyIndication: Solid tumor with Her-2 +Breast Cancer

Tyrosine kinase sensitiveCML expression of gene bcr-abl + (Chr. Ph)Imatinib (ST1571) Gleevec

Central DogmaGeneRNAProteinTranscriptionTranslationGenomeTranscriptomeProteome3-7 Agustus 2009 KURSUS TROPMED FK UGM*Indwiani Astuti & Sofia Mubarika FK UGM

Indwiani Astuti & Sofia Mubarika FK UGM

Nanotechnology

Artificial bone, cartilage, & skin with no immune rejectionVitoss (Orthovita): nanoparticels bone growth (orthopaed) Navavax-estrasorb (cream): nanoparticels Skin burnsNucrest-Silcrest : nanocrystaline Skin burnsNanodot (Nasa): cells repairs

Improved, direct chemotherapy and radiotherapyDrug deliveryMaximizing bioavailability both over a period of time and at specific places in the bodyDeliver drug directly to the site without interacting with the rest of the bodySmart drugs

Nanotechnology for Drug DeliveryMolecule encapsulated within nanoscale cavities inside polymer : time-released drugsGrind solid drugs into fine powders : to increase surface area and reactivity & to increase solubilityEncapsulate polar drug in a nonpolar coating : easily pass through the cell membrane

Coat DNA with cholesterol to easily pass through the oily cell membraneLiposome structures to deliver soluble protein (cytokine) such as interferon to cancer cells Magnetic nanoparticles : local bioavailability control by external magnetic fieldTriggered response : inactive drug moleculewakes up on encountering a particular signalAntacid enclosed in a coating of polymer that dissolves only in highly acidic conditions

*****For vessels to mature, they need to be exposed to a mix of angio- and arteriogenic factors for enough time for endothelial cells to tighten up and become covered with supporting cells. Flow is a critical determinant of vessel maintenance and durability.Tumour blood vessels are architecturally different from normal blood vessels. They are irregularly shaped, dilated, tortuous, and can have dead ends. They are not organised into definite venules, arterioles and capillaries like normal blood vessel, but instead have chaotic versions of all of them. The vascular network in tumours is often leaky and haemorrhagic, at least in part due to the overproduction of VEGF. When not enough angiogenic and arteriogenic factors are present, and angiogenesis inhibitors are present, endothelial cell channels remain naked, leaky and fragile, are easily ruptured and bleed, resulting in reduced flow and vessel regression.1,2Endothelial cells migrate through interactions between integrins and the matrix.3 Integrins are cell surface receptors for specific endothelial cell matrix molecules that transmit information between the outside and inside of vascular cells. Positive and negative roles in the induction of angiogenesis have been demonstrated in various studies, and the exact role of these receptors in different conditions has yet to be determined.2In an in-vitro model of human brain microvascular endothelial cells, VEGF significantly increased the penetration of highly metastatic breast cancer cells across the cell monolayer. This penetration was because the cancer cells adhesion onto the monolayer was increased, an effect that was reversed on treatment with a VEGF inhibitor (SU1498).4 The data suggest that, by increasing endothelial permeability, VEGF could contribute to breast cancer metastasis by enabling transendothelium migration of tumour cells.Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nature Reviews Cancer 2003;3:40110.Carmeliet P. Angiogenesis in health and disease. Nat Med 2003;9:65376.Jain R. Molecular regulation of vessel maturation. Nat Med 2003;9:68593.Lee TH, Avraham HK, Jiang S, Avraham S. Vascular endothelial growth factor modulates the transendothelial migration of MDA-MB-231 breast cancer cells through regulation of brain microvascular endothelial cell permeability. J Biol Chem 2003;278:527784.*The evidence linking tumour growth and metastasis with angiogenesis is compelling. Many studies have found that patients with elevated VEGF levels have poorer prognosis than those with lower or no detectable VEGF.See below for summary of outcomes for patients with VEGF-negative versus VEGF-positive tumours in the studies listed.Gasparini: when serum VEGF >1,096pg/mg protein, probability of relapse-free and overall survival decreased with increasing VEGF levelsToi: VEGF levels significantly associated with vascular density: MVD 50 VEGF negative 23% vs VEGF positive 5% MVD 51100 VEGF negative vs 35% VEGF positive 20% MVD >100 VEGF negative 10% VEGF positive 59%Imoto: survival significantly worse in patients with VEGF-positive tumours (p=0.003)O'Byrne: high VEGF levels significantly associated with high vascular grade tumours (p=0.009); significant marker for tumour size on multivariate analysis (p