Molecular Biology of Pharmacology

Indwiani AstutiDept. of Pharmacology & Toxicology

Fac. Of Medicine Gadjah Mada University

Structure of DNA

The central dogma of molecular biology

The flow of the expression of genetic information in cells is almost exclusively one way: DNA RNA Protein

A gene codes for a protein

Protein

mRNA

DNA

transcription

translation

CCTGAGCCAACTATTGATGAA

PEPTIDE

CCUGAGCCAACUAUUGAUGAA

Introduction

Pharmacology: knowledge of how drugs interact with body constituents to produce therapeutic effects

The elucidation of molecular mechanisms of drug response, the development of new drugs, & the formulation of clinical guidelines for safe & effective use of drugs in therapy or prevention of disease & in relief symptoms.

Pharmacological responses by molecular interaction of drugs with cells, tissues, or other body constituents

The key word is “molecular” What specific biological molecules must be present ? How do drugs & biological molecules interact to

produce changes ? How are these changes converted into observable

responses ?

GENETIC POLYMORPHISMS

Pharmacokinetic Pharmacodynamic

•Transporters•Plasma protein binding•Metabolism

•Receptors•Ion channels•Enzymes•Immune molecules

Efficacy & Safety

Pharmacogenomic/genetic

There is substantial heterogenesity in the way individuals respond to medications, in terms of both toxicity and treatment efficacy.

"pharmacogenetics," which initially focused largely on genetic polymorphisms in drug metabolizing enzymes, and how this translates into inherited differences in drug effects

Pharmacogenetics developed

The first observations of genetic variation in drug response date from the 1950s,

involving the muscle relaxant suxamethonium chloride, and drugs metabolized by N-acetyltransferase.

One in 3500 Caucasians has less efficient variant of the enzyme (butyrylcholinesterase) that metabolizes suxamethonium chloride (muscle relaxant) drug’s effect is prolonged, with slower recovery from surgical paralysis.

Variation in the N-acetyltransferase gene divides people into “slow acetylators” and “fast acetylators”, with very different half-lives and blood concentrations of such important drugs as isoniazid (antituberculosis) and procainamide (antiarrhythmic).

slow acetylator recessive ratio fast : slow

Europe 40 : 60; USA 55 : 45 Japan 85 : 15; Oriental 10 : 90 Inuit 95 : 5

From: Evans WE, Relling MV. Pharmacogenomics: Translating functional genomics into rational therapeutics. Science 286:487-491, 1999.

Genetic polymorphisms in drug metabolizing enzymes

In the 1960s it became apparent that other drug metabolising enzymes, particularly the cytochrome P450-dependent monooxygenases, were also polymorphic.

in the 1970s with the identification of the cytochrome P450 CYP2D6 debrisoquine hydroxylase polymorphism

Polymorphisms in further cytochrome P450s, as well as in other drug metabolising enzymes, were subsequently discovered.

With the development of recombinant DNA technology, the molecular basis of most of these polymorphisms

The study of Pharmacogenomics focuses on drug action based on a patient’s genotype (DNA) and/or molecular phenotype (DNA/RNA/protein).

Pharmacogenomics tests resultant from such analyses will allow for the recognition of those patients for whom a particular therapy would be most efficacious, or for which there would be least likely incidence of adverse events.

Thus, the major goal of pharmacogenomics is to individualize patient therapy.

APPLICATION OF PHARMACOGENETICS TO DRUG DISCOVERY AND USE

Most therapeutic drugs are administered orally and need to be absorbed across the GI tract to enter the circulation.

This process can be influenced by the presence of drug transporters, such as the multi-drug resistance protein, MDR1, and metabolic enzymes such as the cytochrome P450-dependent monooxygenases, in particular members of the cytochrome P450 CYP3A gene family (CYP3A4, CYP3A5 and CYP2D6) (4). The importance of the drug transporter proteins is exemplified by the finding that marked changes in drug absorption and pharmacokinetics are observed in mice nulled at the Mdr1 gene locus

Pharmacogenetics and cancer chemotherapy

polymorphism of drug-metabolizing enzymes

polymorphism of receptors leads to a prolonged half-life and a

reduced elimination of cytotoxic drugs. A consequence could be an adverse

side reaction due to an excessive drug toxicity in non-cancer tissues.

Dehydropyrimidine dehydrogenase (DPD) is the initial rate limiting enzyme in the catabolism of 5 fluorouracil (5FU) located on chromosome 1p22 as a single copy and consists

of 23 exons for a total lenght of 950 kb 1 splice-site mutation, 2 deletions and 4 missense mutations.

Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that preferentially catalyzes the S-methylation of mercaptopurine (6MP), azothioprine and thioguanine hematopoietic toxicity (leucopenia, anaemia, pancytopenia) located to human chromosome 6 and several mutant alleles

have been isolated from TPMT-deficient patients.

Glutathione S--transferases catalyze the conjugation of electrophilic compounds to cellular glutathione absence of GSTm 1 in children with acute

lymphoblastic leukemia is associated with a 82% remission versus only 52% in children positive for GSTm .

Busulfan is an alkylating agent

N-acetyltransferases exist as two isoforms respectively termed NAT1 and NAT2 and have been initially described as the enzymes responsible for the acetylation of isoniazid and caffeine (conversion of 1-methylxanthine into 5-acetylamino 6-amino 3-methyl uracil). NAT2 is located on human chromosome 8q11.

Amonafide (NSC308847) fast acetylators defined by their caffeine phenotype of NAT2 have significantly greater leukopenia than slow acetylators, as well as higher bone marrow toxicity at the standard dose of 300mg/m2 daily for 5 days.

Angiotensinogen: the application of pharmacogenomics to the treatment of hypertension

The AGT gene, in particular, has shown the strongest and most consistent associations (5 — 9) with the risk of CHD and certain forms of hypertension.

The AGT gene, located on chromosome 1, consists of approximately 13,000 nucleotide base pairs organized into 5 exons, and 4 introns

PHARMACOGENETICS IN PSYCHIATRY

CYP2D6 genotyping in patients receiving drugs for the treatment of depression and psychiatric disorders.

This enzyme is responsible for the metabolism of the majority of drugs used in the treatment of psychiatric illness and many of the patients suffer drug side effects

New drugs design (for exz.)

Receptor with intrinsic Tyrosine Kinase ActivityLarge group of receptors for growth factors

(insulin, EGF, PDGF, hepatocyte GF etc)Extracellular domain contains regions bind

GF, Intracellular domain contains a kinase activity capable of phosphorylating proteins on tyrosine residues

Herceptin (c-erb2)

Product oncogen (EGFR)Receptor Growth factors familyIndication: Solid tumor with Her-2 +Breast Cancer

Tyrosine kinase sensitive

CML expression of gene bcr-abl + (Chr. Ph)

Imatinib (ST1571) Gleevec

Signal cascades are useful:1. At each step of the cascade, the signal is amplified 2. The information that arrived at the plasma membrane in the form of a

signal is communicated to the nucleus3. The multitude of steps enables a signal to have different effects in

different cells (because they have different target proteins)

BLOCK EGFR

Tyrosine kinaseinhibitors

Nanotechnology

Artificial bone, cartilage, & skin with no immune rejection

Vitoss (Orthovita): nanoparticels bone growth (orthopaed)

Navavax-estrasorb (cream): nanoparticels Skin burns

Nucrest-Silcrest : nanocrystaline Skin burns

Nanodot (Nasa): cells repairs

Improved, direct chemotherapy and radiotherapy

Drug deliveryMaximizing bioavailability both over a period

of time and at specific places in the bodyDeliver drug directly to the site without

interacting with the rest of the body

Smart drugs

Nanotechnology for Drug Delivery

Molecule encapsulated within nanoscale cavities inside polymer : time-released drugs

Grind solid drugs into fine powders : to increase surface area and reactivity & to increase solubility

Encapsulate polar drug in a nonpolar coating : easily pass through the cell membrane

Coat DNA with cholesterol to easily pass through the oily cell membrane

Liposome structures to deliver soluble protein (cytokine) such as interferon to cancer cells

Magnetic nanoparticles : local bioavailability control by external magnetic field

Triggered response : inactive drug molecule“wakes up” on encountering a particular signal

Antacid enclosed in a coating of polymer that dissolves only in highly acidic conditions