doi:10.1016/j.jmb.2008.03.066 J. Mol. Biol. (2008) 379, 188–199

Available online at www.sciencedirect.com

Hybridization between mitochondrial heavy strand tDNAand expressed light strand tRNA modulates the functionof heavy strand tDNA as light strand replication origin

Hervé Seligmann

Department of Evolution,Systematics and Ecology,The Hebrew University ofJerusalem, 91904, Israel

Received 17 November 2007;received in revised form23 March 2008;accepted 31 March 2008Available online4 April 2008

E-mail address: hselig1@yahoo.coPresent address: Department of L

Gurion University, 84105 Beer ShevAbbreviations used: HS, heavy st

OL, replication origin; tDNA, DNA

0022-2836/$ - see front matter © 2008 E

Mitochondrial heavy strand (HS) tDNA codes for tRNAs and frequentlyfunctions as the light strand (LS) replication origin (OL). During rep-lication, HS sites remain single-stranded until their LS complement issynthesized, a state prone to hydrolytic deaminations of C→T and A→G,causing genome-wide deamination gradients starting at OLs and pro-portional to time spent single-stranded. Gradient strength is proportionalto OL formation by HS tDNAs. Hypothetically, hybridization betweenHS tDNA and its expressed complement tRNA should decrease OLactivity for LS-, but not HS-encoded tRNAs. Comparisons betweenprimate genomes and between pathogenic and non-pathogenic humanpolymorphisms both confirm corresponding predictions on OL activity.In primates, strengths of deamination gradients starting at tDNAs func-tioning as OLs and coding for LS tRNAs decrease proportionally tostabilities of HS tDNA-LS tRNA hybridization; not so for HS tRNAs.Similarly, in mutants of human HS tDNAs coding for LS tRNAs, patho-genic mutants of tDNAs usually not forming OLs form weaker HS tDNA-LS tRNA duplexes than non-pathogenic ones; the opposite is true fortDNAs usually forming OLs. No trend was detected for HS tDNA codingfor HS tRNA. tDNA-tRNA hybridization of the modal (most frequent)human tDNA sequence is more stable than of other, rarer non-pathogenicpolymorphisms, suggesting similar but weaker mutational effects ontDNA/tRNA functions than in pathogenic mutants. HS tDNA-LS tRNAhybridization appears to compete with OL formation by HS tDNAself-hybridization.

© 2008 Elsevier Ltd. All rights reserved.

Keywords: Alzheimer's disease; oxidative stress; transition; hydrolyticdeamination gradients; mutational robustness

Edited by J. Karn

Introduction

In vertebrate mitochondrial genomes, a singleunidirectional replication fork initiated at a 30 bpstem-loop structure, called the LS origin of replica-tion1–3 (OL, see Fig. 1) presumably replicates thelight strand (LS) DNA. This OL is formed by theheavy strand (HS) DNA, located in the midst of aconserved tRNA cluster (five tRNAs: Trp, W; Ala, A;

m.ife Sciences, Bena, Israel.rand; LS, light strand;coding for tRNAs.

lsevier Ltd. All rights reserve

Asn, N; Cys, C; Tyr, Y), the largest tRNA cluster invertebrate mitochondrial genomes.Some evidence suggests that LS replication is not

necessarily initiated unidirectionally from a singleOL: the LS was reported to replicate bidirectionallyat multiple locations by Okazaki fragments,4 remi-niscent of nuclear chromosome replication; otherevidence suggests that multiple OLs exist in ver-tebrate mitochondria.5,6 New evidence on mito-chondrial transcription factors suggests that tworeplication modes might co-exist, and that thesemight be regulated by mitochondrial metabolism.7

Another line of investigation suggests that OL-likestructures formed by HS tDNA (DNA coding fortRNAs) sometimes function as OL. In that case, mostresults suggest unidirectional replication.8–10 Com-

d.

Fig. 1. Mitochondrial light strand replication origin (OL)of Chlorocebus tantalus (heavy strand sequence from site 5146to site 5176 according to annotation in GenbankNC_009748).Secondary structure from http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi.20

189tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

putational evidence presented here confirms theOL activity of HS tDNA: hybridization between theHS DNA coding for LS tRNAs with its expressed,complementary LS tRNA decreases OL activityproportionally to the stability of the HS tDNA-LStRNA duplex, presumably by competing with OLformation by self-hybridization.

†http://frontend.bioinfo.rpi.edu/zukerm/cgi-bin/rna-index.cgi

Deamination gradients during LSreplication

During classical unidirectional LS DNA replica-tion, the HS DNA remains single-stranded until thecomplementary LS DNA is synthesized. The dura-tion that various HS locations in the genome remainsingle-stranded (Dssh) depends on their distancefrom the HS replication origin in the D loop andfrom the OL.11 Rates of hydrolytic deamination inthe single-stranded state are much higher than thosein the double-stranded state.12,13 Therefore, rates ofC to T and A to G deamination occurring on the HSare directly proportional to theDssh of that site. As aresult, gradients exist across mitochondrial genomesfor evolutionary deamination rates,14,15 and for re-sulting nucleotide contents, especially at third codonpositions (see the example from Chlorocebus tantalus,Fig. 2).8 These gradients are considered as one of thestrongest pieces of evidence in favor of unidirec-tional replication.16

Genes coding for tRNAs as OLs

Several previous observations suggest that mito-chondrial tDNA sometimes functions as OL.17,18 Inaddition to the classical cloverleaf, sequences codingfor tRNAs form frequently spontaneously OL-likesecondary structures (see the experimental resultsfor human tRNA Lys in Fig. 4b of Helm et al.19). Thiswas recently confirmed by correlation analyses bet-ween the strengths of whole-genome deaminationgradients starting at mitochondrial tDNA clustersand the ability of HS tDNA in these clusters to formOL-like secondary structures: the deamination gra-dient starting at a given tDNA location is strongwhen the tDNA in that vertebrate species is likely toform OL-like structures, and weak in species wherethe homologous tDNA does not form such struct-ures.8 These analyses compared 19 primate mito-chondrial genomes. The secondary structures oftDNA were predicted using the online algorithmMfold†.20 All alternative secondary structures atleast half as stable as the optimal structure wereexamined visually, and the percentage of structuresforming a single linear stem-loop resembling theclassical recognized OL was calculated. Gradientstrength was estimated by t-statistics of the regres-sion coefficients from multiple regressions betweentime spent single stranded by HS DNA during repli-cation (independents) and the light strand T or Ccontent at third codon positions in the 13 mito-chondrial protein coding genes as dependent vari-able (T and C coded binary as zero and unity).Multiple regressions regressed nucleotide contentswith 12 independent variables, Dssh values calcu-lated considering each of the 12mitochondrial tDNAclusters as potential OLs (calculations as described;8

explicit instructions are given in Appendix A).Correlations between gradient strength and the

above-mentioned percentage of OL formation by HStDNAwere positive in seven among 12 tRNA clus-ters, among which three were statistically significantat Pb0.05.8The hypothesis examined here is that hybridiza-

tion between HS tDNA and its expressed LS tRNAcompetes with OL formation by self-hybridizationof the HS tDNA. If so, the stability of the HStDNA-LS tRNA duplex should decrease the strengthof the deamination gradient starting at that loca-tion, assuming that tDNA-tRNA hybridizationoccurs.

RNA-DNA hybrids

Indeed, DNA–RNAduplexes are possible accordingto thermodynamic criteria,21,22 and have been ob-served in several cases.23–25 For example, in Droso-phila, DNA–RNA hybridization associates positivelywith gene expression.26 Apparently, bacterial replica-tion sometimes uses transcription-related DNA–RNA

‡http://lowelab.ucsc.edu/tRNAscan-SE/§http://www.bioinfo.rpi.edu/applications/hybrid/

twostate.php

Fig. 2. Proportion of light strand cytosines (opencircles) among pyrimidines and adenosines (filled circles)among purines at third codon positions for protein-coding genes in the mitochondrial genome of Chlorocebustantalus (NC_009748) as a function of the duration re-maining single-stranded of the heavy strand during rep-lication (Dssh). The strong linear gradient for cytosinereflects the chemically slower deamination occurring onthe heavy strand, of A→G; the weaker gradient for ade-nosine reflects the chemically faster heavy strand deami-nation of C→T. The latter, presumably due to its greaterrate, is closer to saturation, as indicated by the higherproportion of LS as than that of LS Cs and that the best fitregression model is not linear. The identity of the geneand its length in base pairs is indicated next to pyrimidinedatapoints.

190 tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

hybrids as primers.27,28 In vertebrate mitochondria,the sequence that contains HS and LS transcription,and the HS replication enhancers, the D-loop, formshybrid duplexes and triplexes with RNA, termedR-loop,29–31 suggesting a role for DNA–RNA hybridsin protecting against DNA digestion and in initia-tion of transcription and replication: RNA trans-cripts initiated at the light-strand promoter are theprimers for mtDNA replication at the mitochondrialHS replication origin.32–36 This suggests that tDNA–tRNA hybridization could eventually occur also inmitochondria.

Predictions: tDNA-tRNA hybridization decreasesOL formation

Hence tDNA–tRNA duplex formation might com-pete with structures formed by HS tDNA self-hybridization, such as OL-like structures, but onlyfor the 14 HS tDNAs coding for LS tRNAs, becausethe latter are complementary to the HS tDNA. Inorder for this mechanism to be a valid hypothesis,patterns should be inexistent or much weaker for theeight HS tDNAs coding for HS tRNAs, because theexpressed HS tRNAs are not complements of theirrespective HS tDNAs. These predictions are con-firmed below in analyses of two effects of OL forma-tion: deamination gradients in primate mitochondrialgenomes,8,14,15 and pathogenicity of human mito-chondrial tRNA polymorphisms presumably due tounusual OL activity.9

Results and Discussion

Empirical tests: deamination gradients inprimates

In order to test the hypothesis that tDNA–tRNAhybrids regulate OL function in tRNA genes, Icalculated the −ΔG of HS tDNA–LS tRNA hybri-dization for all primate mitochondrial tRNA se-quences as extracted by tRNAscan-SE with theirinverse complement‡.37 Calculations were based ontemperature-dependent, nearest-neighbor thermo-dynamic parameters and do not include the con-stant effect of hybridization initiation.38 I do notshow the results based on alternative methods tocalculate duplex stabilities because the patternswere very similar when using the temperature-independent parameters39 for DNA-RNA duplexes,as well as the DNA–DNA or RNA–RNA duplexesfrom DNAMelt§.40

The most straightforward effects of OL formationare deamination gradients starting at regionsforming OLs. Hence, prevention of OL formationby hybridization between HS tDNA and theexpressed tRNA for LS-, but not HS-encodedmitochondrial tRNAs should decrease the strengthof these deamination gradients. The strength ofsuch gradients was estimated for all 12 mitochon-drial tDNA clusters in 19 primate taxa (Table 1 inprevious analyses8). This analytical method isdesigned to detect whether any of the 12 tRNAclusters functions as OL. Negative correlations areexpected between HS tDNA–LS tRNA duplexstability and gradient strength for LS-encodedtRNAs, but not for HS-encoded ones.Results in Table 1 show that correlations

between gradient strength and duplex stabilities(rHG, the parametric Pearson correlation coeffi-cient, and rsHG, the statistically more robust non-parametric Spearman rank correlation coefficient)are negative for nine among 14 LS tDNAs (64%),three among which were statistically significant atPb0.05, one-tailed t-tests: tRNA Gly (see Fig. 3),Leu-CTN and Val. These three significant casesrepresent 21% of all 14 tests for LS tRNAs, whichis four times greater than 0.7 cases, the averagenumber expected by chance at Pb0.05 consideringthe number of tests.For HS tRNAs, two of eight (25%) correlationswere

negative, three other, positive correlations were sta-tistically significant (tRNA Ala, Glu, Tyr). The aver-age rHG of HS tRNAs differs significantly from thatof LS tRNAs: the mean of z-transformed Pearsoncorrelation coefficients of HS tDNAs coding for HStRNAs (z=0.5 log[(1+r)/(1−r)], where r is the Pear-son correlation coefficient;41) is significantly more

Table 1. Duplex stabilities of HS tDNA-LS tRNA hybrids in primate mitochondrial tRNAs

tRNA LS rHG rsHG Patho sd n Pol sd n tp P tCove rHC rCH tnon

Arg −0.31 −0.31 50.25 2.19 2 50.91 1.13 11 −0.68 −0.53 0.32 −0.04 −0.64Asp 0.11 0.18 54.60 1 53.68 1.12 13 0.79 −1.35 −0.38 −0.21 −0.81Gly −0.44 −0.51 55.28 1.03 5 55.56 1.11 14 −0.51 −0.46 −0.13 0.18 −1.09His 0.32 0.29 63.87 0.35 3 66.25 1.15 11 −5.96 0.047 −1.45 −0.02 0.21 −0.67Ile −0.30 −0.20 60.77 1.45 13 60.73 1.91 10 0.06 −1.32 −0.42 −0.74 −0.22Leu-TTR 0.32 0.14 72.74 1.40 24 72.97 1.01 6 −0.37 −1.54 −0.25 −0.29 −0.57Leu-CTN −0.63 −0.47 66.42 1.53 9 67.02 1.45 10 −0.87 −0.68 0.10 −0.41 −0.43Lys 0.30 0.13 63.36 1.61 14 64.08 1.85 10 −1.02 0.03 0.30 −0.56 −0.54Met −0.08 −0.02 73.37 1.70 3 73.48 0.73 6 −0.11 −3.45 −0.04 −0.53 −1.03Phe −0.27 −0.28 71.41 1.60 7 71.57 1.12 12 −0.22 −3.99 −0.45 0.59 −0.15Ser-AGY 0.10 0.06 61.97 0.29 3 63.12 1.21 17 −3.43 0.004 −0.27Thr −0.11 −0.03 63.16 1.69 8 63.82 1.46 37 −1.12 −1.90 0.01 −0.51 −0.36Trp −0.02 0.13 62.22 1.05 5 64.12 1.58 15 −2.48 0.023 −2.08 0.35 −0.25 −0.33Val −0.48 −0.48 70.16 1.09 5 71.10 1.21 12 −1.50 −3.06 −0.13 0.22 0.17

tRNA HSAla 0.44 0.45 75.78 1.54 4 75.72 1.27 10 0.07 −1.38 −0.21 −0.57 0.14Asn −0.19 −0.26 76.83 1.88 4 76.6 2.66 8 0.15 −0.88 −0.65 −0.33 0.07Cys −0.27 −0.25 71.85 1.62 4 71.79 1.3 18 0.07 −0.84 0.37 −0.38 0.16Gln 0.16 0.38 85.68 1.24 4 85.54 1.63 17 0.16 −2.04 −0.16 −0.89 −0.14Glu 0.52 0.70 68.63 1.37 6 68.37 1.18 7 0.37 0.92 −0.29 −0.59 −0.14Pro 0.24 0.36 62.87 1.67 3 63.94 1.67 11 −0.98 0.84 −0.60 0.04 −0.26Ser-TCN 0.13 0.16 78.49 1.53 7 76.92 1.51 13 2.20 −1.55 −0.51 −0.80 0.38Tyr 0.45 0.52 71.9 1.57 4 70.96 1.42 8 1.05 −2.86 −0.50 −0.32 0.31

Abbreviations: rHG and rsHG, parametric Pearson and Spearman non-parametric correlation coefficients, respectively, between duplexstabilities in 19 primate species and strength of deamination gradient starting at that tDNA in the same species; Patho, mean duplexstability for HS tDNA-LS tRNA hybrids of human pathogenic tRNA polymorphisms; Pol, same for non-pathogenic polymorphisms, Sd,standard deviationsl; n, number of polymorphisms; tp, t statistics of difference between means of non-pathogenic and pathogenicpolymorphisms for duplex stability; tCove, t statistics of difference between mean cloverleaf stability (Cove42) between pathogenic andnon-pathogenic human tRNA polymorphisms; rHC, Pearson correlation coefficient between HS tDNA-LS tRNA stability and tCove forhuman polymorphisms; rCH, same as previous, but for 19 primate species; tnon, t statistics of difference betweenmean duplex stability ofrare non-pathogenic human polymorphisms and duplex stability of the modal, most common human tDNA sequence. Values indicatestatistical significance at P≤0.05: bold, two-tailed t-test; italics, one-tailed t-test.

191tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

positive than that of HS tDNAs coding for LS tRNAs(t=2.19, P=0.02, one-tailed test).These analyzes of between-species variation are

positive evidence that HS tDNA–LS tRNA hybridi-zation depresses OL activity at HS tDNAs.

Empirical tests: human tRNA mutants anddiseases

The HS tDNA of primates frequently functions asOL. In tDNA that usually does not function as OL,

Fig. 3. Deamination gradientstrength (t-statistics for gradientstarting at tDNA Gly) as a functionof stability of HS tDNA-LS tRNAGly in 19 primate species. Gradientstrengths are taken from Seligmannet al.8 P values are for one-tailedt-tests.

Fig. 4. Strength of association between tDNA–tRNAduplex stability and pathogenicity (the y axis is tp fromTable 1) as a function of the tendency to form OL-likesecondary structures in the most common human tRNApolymorphism. The y axis is the t-statistic of differencesbetween average stabilities of duplexes formed by patho-genic tRNA mutants with non-pathogenic tRNA poly-morphisms. The x axis is the percentage of alternativesecondary structures formed by HS tDNA that are linearstem–loops resembling the classical OL in Fig. 1. Second-ary structure predictions are according to mfold, http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi.20 Light strand-encoded tRNAs are indi-cated by filled symbols (continuous regression line),heavy strand-encoded tRNAs are indicated by circles.The datapoints for the heavy strand tRNAs Ala and Asnare hidden by a cluster of datapoints for light strandtRNAs at 0% OL formation. The non parametric Spear-man rank correlation coefficients and their one-tailed sta-tistical significances for each LS and HS-encoded tRNAare indicated.

192 tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

pathogenic mutants tend to form, on average, moreOL-like structures than non-pathogenic polymorph-isms; and the opposite is true in those tDNAs thatusually form OLs.9 This suggests that mitochondrialageing-related pathologies sometimes result fromdisruption of OL formation in the latter tDNAs, andfrom its formation in the former tDNAs. Thesepresumably cause unusual mutation patterns accu-mulating along the genome, and these unusual dea-mination gradients would be the cause of disease.The hypothesis that the stability of HS tDNA–LStRNA hybridization modulates OL activity predictsthat pathogenicity associates negatively with stabi-lity of tDNA–tRNA duplexes in HS tDNA coding forLS tRNA that usually does not function as OL; andpositively in those functioning as OL. No associationis expected for HS tDNA coding for HS tRNA.

Pathogenic mutants of light strand tRNAs formweaker duplexes

I compared by t-tests, for each tRNA species, meansof the negative of the free energies of HS tDNA–LStRNA duplexes for pathogenic mutants with meansof homologous, non-pathogenic polymorphismsoccurring in the human population at large (Table1; polymorphisms are shown in Appendix B).Pathogenic mutants were from mitomap, as edited19 of January 2008,43 and from another review;44

non-pathogenic polymorphisms were from thatreview,44 and from screening with tRNAscan-SEabout 1900 complete human mitochondrial genomesavailable in GenBank (NCBI) at the end of 2005(about 4000 are available now).9 The majority ofhuman tDNAs do not (or only weakly) form OLs inthe normal human mitochondrial physiology, andhence in the majority of cases the duplex stability ofnon-pathogenic polymorphisms is expected to behigher than that of pathogenic mutants. Meanstabilities of pathogenic mutants were indeed lowerthan mean stabilities of non-pathogenic polymorph-isms in 12 among 14 HS tDNAs coding for LS tRNAspecies (86%, P=0.0065, one-tailed sign test), and thisdifference was significant at Pb0.05 for 3 LS tRNAs(tRNA His, t=−3.45, P=0.005; tRNA Ser AGY, t=−3.04, P=0.009; and tRNA Trp, t=−2.42, P=0.026;two-tailed t-tests), which is four times more than the0.7 significant cases expected due to the multiplicityof tests. Duplex stability of pathogenic variants wasnever statistically significantly more stable than thatof non-pathogenic ones. Among the eight HS tRNAs,there was only one negative association betweenpathogenicity and duplex stability and it was notsignificant. The association between tDNA–tRNAduplex stability and pathogenicity (estimated by tp)was significantly lower than zero for HS tDNAscoding for LS tRNAs (t=−2.7, P=0.009, one-tailedtest) and significantly more negative for these thanfor HS tDNA coding for HS tRNAs (t=−2.47,P=0.012, one-tailed test). The working hypothesisexpects this difference, because for HS tDNA codingfor HS tDNA, the expressed tRNA is not comple-mentary to the HS tDNA and hence hybridization

between them does not compete with OL formationby self-hybridization of the HS tDNA.A further analysis explains also differences in the

strength of the association between pathogenicityand DNA–RNA duplex stability, as estimated by thet-statistics observed for various tDNA species (tp inTable 1). Figure 4 plots the t-statistics of these testsfor each tRNA species as a function of the tendencyto form OL-like structures by the most commonhuman mitochondrial tRNA sequence in that tRNAspecies.8 It shows that the association betweenpathogenicity and duplex stability is most negativein HS tDNA coding for LS tRNAs that tend to formOL-like structures in humans, and most positive forthose with low tendencies to form OL-like structures(Spearman rank correlation coefficient rs=−0.61,P=0.01, one-tailed test), but there was no correlationbetween tendencies to form OL-like structures andthe strength of the association between pathogeni-city and duplex stability in HS tRNAs (rs=−0.31,P=0.22, one-tailed test). Hence here again, for HStDNA coding for LS tRNA, the lack of competingability of weak HS tDNA–LS tRNA duplexes withOL formation by HS tDNA self-hybridization has aneffect (on mutant pathogenicity) only if the tDNAusually functions as an OL. This is a further strongconfirmation of the OL prevention hypothesis by HStDNA–LS tRNA hybridization.

193tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

The analyses presented above include threeindependent confirmations of the hypothesis thatHS tDNA–LS tRNA hybridization decreases the OLactivity of HS tDNA: (1) for the significant majorityof LS tRNAs, pathogenicity associates negativelywith HS tDNA–LS tRNA duplex stability; (2) for HStDNA coding for LS tRNA, this association becomesmore negative the more the modal (most common)human tDNA sequence for that HS tDNA formsOL-like structures (Fig. 4), meaning that tDNA–tRNA hybridization does not prevent pathogenicitydue to OL activity in that tDNA if there is no OLactivity in that tDNA; and (3) as expected by thehypothesized mechanism, results were negative forHS tDNAs coding for HS tRNAs. Point (3) functionsas negative control for both points (1) and (2).

Confounding effects of cloverleaf stability

The possibility exists that the results describedabove, where HS tDNA–LS tRNA duplex stabilitiesassociate with pathogenicity, are due to confound-ing effects. Indeed, on average, tRNA mutants asso-ciated with diseases form weaker cloverleaf struc-tures than non-pathogenic polymorphisms.45,46

Sequences that form stable cloverleaf structuresmight also form stable duplexes. In that eventuality,the negative associations between pathogenicityand duplex stability presented above might not re-flect prevention of OL formation by hybridization ofthe HS DNA sequence coding for LS tRNAs withtheir tRNA, but low capacity to function as regulartRNAs due to low cloverleaf stability. However, it isimportant to note that such putative confoundingeffects are unlikely to cause the observed differencesbetween LS- and HS-encoded tRNAs.Table 1 shows the t-statistics for differences in the

stability of the cloverleaf structure formed by thattRNA (estimated by Cove, see above) between patho-genic and non-pathogenic tRNA mutants (tCove):pathogenic polymorphisms have on average lessstable cloverleaves than non-pathogenic ones in 18among 21 tRNA species (two exceptions were HS-encoded tRNAs), confirming patterns observed pre-viously.45 This result was statistically significant bysign test (P=0.0005).At the level of single tRNA species, t-tests revealed

seven cases significant at Pb0.05, 5 among LS, andtwo among HS-encoded tRNAs. These results onnegative associations between Cove and pathoge-nicity, specifically in LS tRNAs, suggest that con-founding effects due to cloverleaf stabilities mightaffect the results on associations between weak du-plex stabilities and pathogenicity of tRNA mutants.Hence, further analyses are warranted to explore thehypothesis of confounding effects by stable clover-leaf structures.These further analyses do not warrant the suspi-

cion that positive results are due to confoundingeffects. Such effects would require that Cove andtDNA–tRNA duplex stabilities are positively corre-lated, which is the case in only six among 21 tRNAs(this analysis excludes tRNA Ser AGY, which is

undetected by tRNAscan-SE and hence no Coveindex is available), significantly so at Pb0.05 onlyin one positive case and six negative ones (rHC inTable 1). This indicates that generally, an unexpectednegative association exists between duplex andcloverleaf stabilities, which is not compatible withthe simple confounding effect suggested above. Thistendency for negative correlations between duplexand cloverleaf stabilities suggests a tradeoff bet-ween the stabilities of cloverleaves and duplexes,rather than the assumed positive correlation bet-ween them. Only confounding effects due to therarer positive correlations could invalidate the con-clusion that weaker duplex formation contributes topathogenicity of tDNA mutants. Such a tradeoff,according to evolutionary thinking, could suggestthat both structures are functional, but they mightalso result from structural constraints.Further analyses, based on residuals of duplex

stabilities from regressions between duplex stabili-ties (dependent) and Cove as independent, confirmthis principle: t-tests between residual duplex sta-bilities of pathogenic and non-pathogenic polymor-phisms yield results qualitatively similar to thosepresented by tp (results not shown). Hence, becausethese residuals are independent of effects fromCove, the hypothesis that duplex stability is asso-ciated negatively with pathogenicity because ofindirect associations between duplex and cloverleafstabilities does not account for the results.

Tradeoffs between functional structures:OL, duplex and cloverleaf

The evidence suggesting competition betweencloverleaf formation and duplex stability for tRNAvariation within Homo sapiens (rHC, Table 1) is con-firmed for analyses of variation among primates(rCH, Table 1): duplex stability correlates negativelywith Cove in 16 among 21 (76%) tRNAs, signifi-cantly so in eight tRNA species. There is only onestatistically significant positive correlation, fortRNA Phe. It makes sense that the tradeoff bet-ween duplex and cloverleaf formation is more acutewhen both structures are to be formed by the samesequence, hence for HS-encoded tRNAs. Resultsconfirm this tendency: only one among the fiveexceptions where cloverleaf and duplex stabilitiesare positively correlated is for an HS-encoded tRNA,all others, including tRNA Phe for which this is sig-nificant, are LS-encoded tRNAs. The negative cor-relations between Cove and duplex stability weresignificant in half the HS-encoded tRNAs, but in lessthan a third of the LS-encoded tRNAs.Other similar analyses (not shown) suggest a posi-

tive association between OL and cloverleaf forma-tion, as the capacity for OL formation correlatedpositively with Cove in 13 among 21 tRNAs (62%)(significantly so for two LS-encoded tRNAs, LeuCTN and Met). Here too, (weaker) evidence for apossible competitive tradeoff effect between capa-cities for OL and cloverleaf formations exists, andit is mainly for HS-encoded tRNAs, which are those

194 tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

for which the HS sequence would have to formboth functional structures (OL and cloverleaf): fouramong the eight exceptions where OL formationand Cove are negatively correlated are among theeight HS encoded tRNAs, and only the remainingfour are among the 13 LS-encoded tRNAs (tests ex-clude tRNA Ser AGY that does not form a classicalcloverleaf structure). Hence, evidence suggests apositive association between OL and cloverleafformations for LS tRNAs, and no association forHS-encoded tRNAs, or an increase in frequencies ofnegative correlations as compared to their low fre-quency in LS tRNAs.Duplex stability is also affected by the tendency to

form OL-like structures (and/or vice versa) with 12among 23 tRNAs where duplex stability decreaseswith OL-forming capacity, four among these statis-tically significant at Pb0.05 (two-tailed tests), twoLS tRNAs (Asp and Gly) and two HS tRNAs (Proand Ser TCN). These results suggest that com-peting effects between cloverleaf and OL struc-tures might occur. This tendency is slightly strongerin HS tRNAs. It seems that a combination ofconstraints specific to three functional states (tRNAcloverleaf, HS DNA OL and HS DNA-LS RNAduplex) affect the details of the design of tRNAsequences.

General discussion

The hypothesis that hybridization between tDNAand tRNA competes with OL formation by self-hybridization of the tDNA when DNA is single-stranded during replication is confirmed by ana-lyses of associations of duplex stabilities withstrengths of deamination gradients in primatesand with pathogenicity of tRNA polymorphisms.Effects exist for LS-encoded tRNAs, but not HS-encoded ones, as expected by the tDNA–tRNAhybridization hypothesis. The latter point is strongevidence for tDNA–tRNA hybridization as amechanism depressing OL activity by tDNAs.Patterns also reveal in some cases tradeoffs betweencapacities to form OL, duplex and cloverleafstructures. These patterns suggest that constraintsdue to the cloverleaf structure have the majorimpact on the sequence, while those for the otherstructures are frequently important, but secondary.This is in line with common sense and knowledge.This mechanism of prevention of OL formation byHS tDNA indicates also that the latter tDNAs tendto function as OLs during replication, occurringwhen the mitochondrial matrix is relativelydepleted of expressed tRNAs, meaning during rela-tively low metabolic activity. OL activity by HStDNA coding for HS tRNAs is not decreased bytRNA expression, which means that the OL activityof four among the five tDNAs adjacent to theregular OL is relatively independent of metabolicactivity. Hence, it is mainly OL activity distant fromthe regular OL that is depressed by tDNA–tRNAhybridization. This suggests that initiation of LSreplication at locations other than the region of the

regular OL is relatively confined to ontogenic stagescharacterized by a low level of metabolic activity, asis senescence. Hence, it is no surprise that manytRNA mutations tend to associate with ageing-associated diseases.

Alternative hypotheses: weak cloverleafstructures and protein synthesis

Several mechanisms for functional disruption ofprotein synthesis by tRNA mutations exist, such asprevention of amino-acylation,47 also by lack oftRNA maturation,48 or cloverleaf disruption.45,46

Cloverleaf disruption is a mechanism that mightconfound the prediction of the working hypothesisbecause sequences that form weak duplexes mightform also weak tRNA cloverleaf structures. There-fore, pathogenic tRNAs that are known to formweak cloverleaves46 might also formweak duplexes.However, results show that confounding effects dueto variation in cloverleaf stabilities do not affectqualitatively the fit of results to the predictions of thetDNA–tRNA hybridization hypothesis.It is also important to note in this context that no

competing hypothesis predicts differences betweenLS- and HS-encoded tRNAs.

DNA bubble formation as an alternativehypothesis for associations between duplexstabilities and pathogenicity of tRNA mutants

The analyses presented in Introduction confirmprevious results that self-hybridizing sequencesfunction as OLs in vertebrate mitochondria. Thissuggests that such local self-hybridizations shouldbe avoided, or at least controlled by a mechanism asHS tDNA–LS tRNA hybridization. This is probablyone of the reasons why vertebrate mitochondrialgenomes are among the few major exceptions toChargaff's second parity rule, which states that anysequence of genomic DNA that contains N copies ofmono- or oligonucleotide sequences, also containsN copies of its reverse complementary mono- oroligonucleotide on the same strand.49 The avoid-ance of such regions, which are likely to have OL-forming capacities, could be a cause for thisexception status. These self-hybridizing sequences,which form OLs in our particular case, enhance theformation of DNA bubbles. This occurs especiallywhen the stability of the double-stranded DNAhelix is weak in the region of the repeat. Note thatassociation of DNA with histones in nuclearchromosomes usually prevents this. These bubblesare mutagenic independently of their potential forOL activity because they cause excision of thelooped out sequence, decreasing mammalianlifespan,50–53 and hence probably also affect ageingprocesses, and associated processes such as thoseleading to developmental instability.54,55 Therefore,selection is expected to minimize the number ofregions containing inverse complement repeats,which have high tendencies to form such bubbles.This process presumably prevents accumulation of

195tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

inverse repeats in vertebrate mitochondrial gen-omes, and explains their non-compliance to Char-gaff's second parity rule.Considering that HS tDNA–LS tRNA duplex

stability is correlated strongly with HS–LS tDNAduplex stability, bubble excision is compatible withthe negative association between duplex stabilityand pathogenicity (Table 1). However, the bubbleexcision hypothesis is not compatible with the diffe-rences observed in this context between LS- and HS-encoded tRNAs, nor does it explain the results inTable 1 that show that tDNA–tRNA duplexes dec-rease the strengths of deamination gradients. There-fore, the working hypothesis that mutant patho-genicity is affected by the stability of HS tDNA–LStRNA hybridization (by preventing OL formation) ismore parsimonious than strong DNA–DNAduplexes preventing bubble formation and excision.However, these mechanisms are not mutually ex-clusive and pathogenic effects due to bubble excisionare probable and should not be excluded.Both bubble excision and OL formation predict

avoidance of inverse complement sequences, butsuch cannot be avoided for tRNA genes, whosefunction depends on self-hybridization for stemformation in cloverleaf structures. This couldexplain why a disproportionate amount of patho-genic mitochondrial mutations (more than 50%)concern tRNAs,9,44 considering that tRNAs repre-sent only 8.5% of mitochondrial genomes and that25% of all human tRNAmutations are pathogenic. Itseems that the fact that these sequences, either astDNA or tRNA, have several functions (as cloverleafstructures in protein synthesis, as OLs in replication,and as OL-depressors by DNA–RNA hybridization)increases the probability that single-nucleotidemutations cause at least some functional disruption,to an extent greater than in other functional se-quences of mitochondrial genomes.

Similarities between non-pathogenicpolymorphisms and pathogenic mutants

Previous analyses have shown that, on average,rare non-pathogenic human tDNA polymorphismstend to formmore OL-like structures than the modal(most common) tDNA sequence in humans,9 andthat they tend to form weaker cloverleaf struc-tures.56 This suggests that their rarity might be dueto functional disruptions similar to those found forclearly pathogenic mutants. This trend exists also forrare non-pathogenic polymorphisms as comparedto the modal sequence for tDNA–tRNA duplexstability: paralleling the trend observed in compar-isons between pathogenic and non-pathogenic poly-morphisms, tDNA–tRNA duplex stability of rarepolymorphisms is usually weaker than for themodal sequence (estimated by t-statistics, tnon, inTable 1) in all but one LS-encoded tRNA, but only inthree among eight HS-encoded tRNAs. Here too,alternative hypotheses, such as bubble excision dueto weak DNA duplexes, is unlikely, because of thedifference between HS- and LS-encoded tRNAs.

This suggests that for sequences that are not modal,associations with pathologies are frequently notdetected because the effect is relatively weak, orbecause it depends on combinations with othermutations (pleiotropic effects, as discussed earlier9).It is probable that a better understanding of suchpleiotropic effects will enable to understand whysome mutations (either already classified as patho-genic, or not yet) are pathogenic in some specificindividual cases, and not in others.

Expressed LS sequences for HS tRNAs?

Although results of analyses presented here donot suggest this, it is possible that sometimes tDNAof HS tRNAs also hybridizes with inverse comple-ment RNA sequences. This is because the matura-tion of mitochondrial RNA uses the capacity oftRNA sequences to form secondary structures astranscriptional punctuation signals for RNA matu-ration into mRNA, tRNAs and rRNAs.57,58 Onlyone transcriptional promoter exists for each LS andHS transcription, both at adjacent locations in theDloop.2 The complete genome is transcribed into asingle long RNA, hence includes also LS sequencesof HS-encoded tRNAs. It is plausible that sometimesLS sequences of HS tRNAs are matured, as thestructural properties of inverse complementsequences of tRNAs should resemble those of thetRNA. This “mirror” tRNA hypothesis should beexplored in the future, because it has potentialpathogenic implications: the mirror tRNA might beable to function as tRNA, with high probabilities thatit would be misloaded by tRNA synthetases. It ispossible that the unexpected positive correlationbetween duplex stability and gradient strength inHS-encoded tRNAs is due to similar phenomena ofinversions.

Multiple replication origins

The results presented here are in line andconfirm recent studies suggesting that multipleOLs exist in vertebrate mitochondria,4–6,59 and thatthe modes of mitochondrial replication are regu-lated by mitochondrial metabolism.7 They suggestthat tDNA–tRNA hybridization is one of theregulation mechanisms.

Appendix A

Dssh for the various tRNA clusters as LS replica-tion origins is calculated following the equationsgiven here, considering that the average location ofthe LS replication origin is in the middle of the tRNAcluster and the unique HS replication origin in theDloop; b is the location along the genome of the sitefor which one calculates Dssh, starting the count attRNA Phe; N is the total size of the genome; otheruppercase letters match the cognate amino acid oftRNAs and indicate the midlocation of that tRNAgene along the genome.

196 tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

– For the tRNA cluster containing tRNA-Thr andtRNA-Pro: Dssh=2 b/N

– For the tRNA cluster containing tRNA-Phe:Dssh=2 b/N

– For the tRNA cluster containing tRNA-Val:Dssh=2 b/N

– For the tRNA cluster containing tRNA-LeuTTR:Dssh=2 b/N

– For the tRNA cluster containing tRNA-Ile,tRNA-Gln and tRNA-Met: Dssh= (b–I) 2/Nfor most genes; and Dssh= (b–I) 2/N+1 forND1.

– For the tRNA cluster containing tRNA-Aspand tRNA-SerTCN: Dss= (b–D) 2/N for mostgenes; and Dssh= (b–D) 2/N+1 for ND1, ND2and CO1.

– For the tRNA cluster containing tRNA-Gly:Dssh=2 b/N for Nd1, ND2, Co1, Co2, At8,At6 and CO3; and Dssh=(b–G) 2/N for othergenes.

– For the tRNA cluster containing tRNA-Lys:Dssh=2 b/N for Nd1, ND2, Co1 and Co2; andDssh= (b–K) 2/N for other genes.

– For the tRNA cluster containing tRNA-Arg:Dssh=2 b/N for Nd1, ND2, Co1, Co2, At8, At6,CO3 and ND3; and Dssh=(b–R) 2/N for othergenes.

– For the tRNA cluster containing tRNA-His,tRNA-SerAGY, tRNA-LeuCTN: Dssh=2 b/Nfor most genes; and Dssh= (b–H) 2/N for ND5,ND6 and Cytb.

– For the tRNA cluster containing tRNA-Glu:Dssh=2 b/N for all genes but CytB; and Dssh=(b–E) 2/N for CytB.

Appendix B

Standard (most frequent, modal) human mito-chondrial tRNA sequences, pathogenic (italics) andnon-pathogenic polymorphisms. Numbers indicate5′ and 3′ limits of the tRNA according to the anno-tation used by Florentz et al.;44 — indicates deletionor insertion; + combines sites for variants wheremorethan one site differed from the standard sequence.

Arg10405TGGTATATAGTTTAAACAAAACGAATGATTTCG-

ACTCATTAAATTATGATAATCATATTTACCA 10469G10406A A10438G T10410C A10411G C10421T

A10423G A10424T G10427A T10448C T10454CT10457C T10463C

Asp7518AAGGTATTAGAAAAACCATTTCATAACT-

TTGTCAAAGTTAAATTATAGGCTAAATCCTATA-TATCTTA 7585A7543G G7521A C7533T T7547C A7559G T7561C

−7561.5C A7569G A7571G T7579C T7581C

−7559.5T+T7560C C7534T+T7563C+C7567T+A7571C+T7575C+A7576G

Gly9991ACTCTTTTAGTATAAATAGTACCGTTAACTTC-

CAATTAACTAGTTTTGACAACATTCAAAAAAG-AGTA 10058T9997C A10006G T10010C G10014A A10044G

T9995C T10001C T10003C A10005G T10007CG10014A T10031C T10034C A10042G C10043TA10049G T9997C+A10044G T10007C+A10044G

His12138GTAAATATAGTTTAACCAAAACATCAGATTG-

TGAATCTGACAACAGAGGCTTACGACCCCT-TATTTACC 12206G12147A G12183A G12192A A12142G C12153T

T12166C A12171G A12172G T12175C T12188CT12189C C12196T A12200G

Ile4263AGAAATATGTCTGATAAAAGAGTTACTTTGA-

TAGAGTAAATAATAGGAGCTTAAACCCCCT-TATTTCTA 4331A4267G A4269G T4274C G4284A T4285C T4290C

T4291C A4295G G4298A A4300G G4309A A4317GC4320T A4265G A4280G A4310G C4312T A4315T−4315.5T C4318G A4295G+A4300GG4284A+C4311T+T4313C+C4317T

Leu TTR3230GTTAAGATGGCAGAGCCCGGTAATCGCA-

TAAAACTTAAAACTTTACAGTCAGAGGTT-CAATTCCTCTTCTTAACA 3304G3242A A3243G A3243T G3244A G3249A T3250C

A3251G A3252G C3254G C3254T G3255A C3256TT3258C A3260G T3264C T3271C T3271− T3273CC3275A A3280G A3288G T3291C A3302G C3303TT3253C C3254A T3278C T3290C C3254T+G3277A+A3301G

Leu-CTN12266ACTTTTAAAGGATAACAGCTATCCATTGG-

TCTTAGGCCCCAAAAATTTTGGTGCAACTC-CAAATAAAAGTA 12336G12294A T12297C A12299C G12301A A12308G

T12311C G12315A A12320G G12334AG12276A A12280G C12284T T12285C T12298C

C12303T −12311.5A T12317G A12321G A12331G

Lys (problem in mitomap: C8302T does not fit,because A at that position)8295CACTGTAAAGCTAACTTAGCATTAACCTTTT-

AAGTTAAAGATTAAGAGAACCAACACCTC-TTTACAGTGA 8364A8296G C8302T G8313A T8316C A8326G G8328A

G8342A A8344G A8348G T8355C T8356C G8361AT8362G G8363A C8297−T8298C A8308G T8310C

197tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

T8329G G8334A A8343G A8347G T8310C+A8343G+A8347G

Met4402AGTAAGGTCAGCTAAATAAGCTATCGGGCC-

CATACCCCGAAAATGTTGGTTATACCCTTCCC-GTACTA 4469T4409C A4435G G4450A T4418C T4452C T4454A

T4454C A4469G

Phe577GTTTATGTAGCTTACCTCCTCAAAGCAATA-

CACTGAAAATGTTTAGACGGGCTCACAT-CACCCCATAAACA 647T582C G583A A606G A608G G611A T618C G622A

C591AT593C C594T −595.5T −595.5C C597TA603GT629C A633G −595.5T+T596C+C597T T593C+A621C+C628T+C630T

Ser AGY12207GAGAAAGCTCACAAGAACTGCTAACT-

CATGCCCCCATGTCTAACAACATGGCTTTCTCA12265G12207A C12246A C12258A A12210G T12215C

A12217G A12234G T12235C G12236A −12236.5CC12237− −12237.5T C12238T C12239T T12245CA12248G A12254G A12265− −12265.5A

Thr15888GTCCTTGTAGTATAAACTAATACACCAGTC-

TTGTAAACCGGAGATGAAAACCTTTTTCCAA-GGACA 15953G15915A A15923G A15924G G15927A G15928A

T15940− G15950A A15951G T15889C G15894AT15900C A15902G C15904T T15905C A15907GA15909G C15910A C15912T C15913T A15914GT15916C A15929G G15930A T15932C A15936GA15936T A15937T C15938T C15939T T15940CT15941C T15942C T15944− −15945.5T C15946TA15924G+G15928A A15924G+G15930AT15889C+A15937T T15900C+A15951G T15908C+

A15924G G15928A+A15935G G15930A+T19541CT15940C+T15941C G15930A+T15941C+A15951GT15889C+A15914G+T15932C+C15939T+T15942C

Trp5512AGAAATTTAGGTTAAATACAGACCAAGAGC-

CTTCAAAGCCCTCAGTAAGTTGCAATACTTA-ATTTCTG 5579G5521A G5532A −5537.5T G5540A G5549A

A5516G G5522A A5539G T5553C T5553G C5554TC5554A T5557C A5558G T5562C G5563A A5568GA5527G+T5528C+T5557C+G5563AA5512T+G5513A

ValError in site count for acceptor stem of tRNAVal in

Fig. 5 of Florentz et al.44, change 1704 to 1670

1602CAGAGTGTAGCTTAACACAAAGCACC-

CAACTTACACTTAGGAGATTTCAACTTAACTT-GACCGCTCTGA 1670G1606A C1624T G1642A G1644T T1659C A1603G

A1618G C1619T A1625G C1628T A1656G C1657TC1662T G1664A A1670T C1619T+T1654C+G1664A

Ala5655AAGGGCTTAGCTTAATTAAAGTGGCTG-

ATTTGCGTTCAGTTGATGCAGAGTGGGGTTT-TGCAGTCCTTA 5587C5591T A5628G C5650T A5655G A5587G T5592C

G5601A G5603A T5605C G5606A G5633A T5634CA5655G A5628G+G5603A

Asn5729TAGAT TGAAGCCAGT TGAT TAGGG -

TGCTTAGCTGTTAACTAAGTGTTTGTGGGTT-TAAGTCCCATTGGTCTAC 5657A5692G C5698T C5703T T5728C T5675A T5675C

G5704A T5705C T5711C T5715C C5703T+G5687A+G5663A+G5662A

Cys5826AGCTCCGAGGTGATTTTCATATTGAATTGCA-

AATTCGAAGAAGCAGCTTCAAACCTGCCGG-GGCTT 5761C5780T C5783T A5814G T5816C C5772T C5773T

A5774G A5774T C5777T A5786G A5788G G5790TC5809T T5811C A5814T G5817A C5821T C5822TT5823C C5824T A5826G

Gln4400TAGGATGGGGTGTGATAGGTGGCACGGAGA-

ATTTTGGATTCTCAGGGATGGGTTCGATTCTCA-TAGTCCTAG 4329C4332TA4336G −4369.5T T4381C G4335AT4342C

T4343C G4345A G4350A A4363G A4370G A4371GA4384G A4386G T4388C G4392A G4393T G4394AT4395C C4339T+G4350A A4386G+T4395C

Glu14742GTTCTTGTAGTTGAAATACAACGATGG-

TTTTTCATATCATTGGTCGTGGTTGTAGTCC-GTGCGAGAATA 14674T14687C T14693C T14696C A14709G C14724T

C14739T A14674G G14682C T14692C T14718CA14727G G14730A

Pro16023CAGAGAATAGTTTAAATTAGAATCTTAGCT-

TTGGGTGCTAATGGTGGAGTTAAAGACTTTT-TCTCTGA 15956T15965C G15990A C15995T A15968G A15970G

A15972G T15974C G15978A A15983G C16000A

198 tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

C16000T A16017G G15978A+A16017G G15969T+A15970T+G15977A+A15984G

Ser TCN7514GAAAAAGTCATGGAGGCCATGGGGTTG-

GCTTGAAACCAGCTTTGGGGGGTTCGATTCCT-TCCTTTTTTG 7446−7471.5G A7480C C7497T C7506TA7510G A7511G

A7512G T7460C G7471A T7472C T7473C G7476AT7490C G7492A G7493A C7498T A7501G G7503−G7471A+C7498T

Tyr5891GGTAAAATGGCTGAGTGAAGCATTGG-

ACTGTAAATCTAAAGACAGGGGTTAGGCCT-CTTTTTACCA 5826T5843C A5874G G5877A −5884.5T A5826G

T5836C G5839A G5840A T5843C G5846A G5875A

References

1. Clayton, D. A. (1982). Replication of animal mitochon-dria. Cell, 28, 693–705.

2. Clayton, D. A. (2000). Transcription and replication ofmitochondrial DNA. Hum. Reprod. 15, 11–17.

3. Falkenberg, M., Larsson, N. G. & Gustafsson, C. M.(2007). DNA replication and transcription in mamma-lian mitochondria. Annu. Rev. Biochem. 76, 679–699.

4. Holt, I. J., Lorimer, H. E. & Jacobs, H. T. (2000).Coupled leading- and lagging-strand synthesis ofmammalian mitochondrial DNA. Cell, 105, 515–524.

5. Brown, T. A. & Clayton, D. A. (2006). Genesis andwanderings — Origins and migrations in asymme-trically replicating mitochondrial DNA. Cell Cycles, 5,917–921.

6. Clayton, D. A. & Brown, T. A. (2006). Replication ofmammalian mitochondrial DNA occurs by stranddisplacement with alternative light-strand origins.FASEB J. 20, A453.

7. Pohjoismäki, J. L., Wanrooij, S., Hyvärinen, A. K.,Goffart, S., Holt, I. J., Spelbrink, J. N. & Jacobs, H. T.(2006). Alterations to the expression level of mito-chondrial transcription factor A, TFAM, modify themode of mitochondrial DNA replication in culturedhuman cells. Nucleic Acids Res. 34, 5815–5828.

8. Seligmann, H., Krishnan, N. M. & Rao, B. J. (2006).Possible multiple origins of replication in primatemitochondria: Alternative role of tRNA sequences.J. Theor. Biol. 241, 321–332.

9. Seligmann, H., Krishnan, N. M. & Rao, B. J. (2006).Mitochondrial tRNA sequences as unusual replicationorigins: Pathogenic implications for Homo sapiens.J. Theor. Biol. 243, 375–385.

10. Seligmann, H. & Krishnan, N. M. (2006). Mitochon-drial replication origin stability and propensity of ad-jacent tRNA genes to form putative replication originsincrease developmental stability in lizards. J. Expt.Zool. B, 306, 433–439.

11. Tanaka, M. & Ozawa, T. (1994). Strand asymmetryin human mitochondrial mutations. Genomics, 22,327–335.

12. Frederico, A., Kunkel, T. A. & Shaw, B. R. (1990). Asensitive genetic assay for the detection of cytosinedeamination: determination of rate constants and theactivation energy. Biochemistry, 29, 2532–2537.

13. Ehrenberg, M., Kurland, C. G. & Blomberg, C. (1986).Kinetic costs of accuracy in translation. In Accuracy inMolecular Processes (Kirkwood, T. B. L., Rosenberger,R. F. & Galas, D. J., eds), pp. 329–379, Chapman andHall, New York.

14. Krishnan, N. M., Seligmann, H., Raina, S. Z. &Pollock, D. D. (2004). Detecting gradients of asym-metry in site-specific substitutions in mitochondrialgenomes. DNA Cell Biol. 23, 707–714.

15. Krishnan, N. M., Seligmann, H., Raina, S. Z. &Pollock, D. D. (2004). Phylogenetic analyses detectsite-specific perturbations in asymmetric mutationgradients. Curr. Comput. Mol. Biol., 266–267.

16. Gibson, A. P. (2005). Comparative Analysis ofVertebrate Mitochondrial Genomes. PhD thesis, Uni-versity of Manchester, UK.

17. Akins, R. A., Kelley, R. L. & Lambowitz, A. M. (1989).Characterization of mutant mitochondrial plasmids ofNeurospora spp. that have incorporated tRNAs byreverse transcription. Mol. Cell. Biol. 9, 678–691.

18. Desjardins, P. & Morais, R. (1990). Sequence and geneorganization of the chicken mitochondrial genome —a novel gene order in higher vertebrates. J. Mol. Biol.212, 599–634.

19. Helm, M., Brulé, H., Degoul, F., Cepanec, C., Leroux,J. P., Giegé, R. & Florentz, C. (1998). The presence ofmodified nucleotides is required for cloverleaf foldingof a humanmitochondrial tRNA.Nucleic Acids Res. 26,1636–1643.

20. Zuker, M. (2003). Mfold web server for nucleic acidfolding and hybridization prediction. Nucleic AcidsRes. 31, 3406–3415.

21. Roth, J. S. (1968). RNA competition in RNA-DNAhybridization systems. Science, 162, 699.

22. Reiner, J. M. (1975). Theory of RNA-DNA hybridiza-tion. 1. stoichiometry at equilibrium. Bull. Math. Biol.37, 255–268.

23. Kirkpatrick, D. P., Rao, B. J. & Radding, C. M. (1995).RNA-DNA hybridization promoted by Escherichia coliReca protein. Nucleic Acids Res. 20, 4339–4346.

24. Sokol, D. L., Zhang, X. L., Lu, P. Z. & Gewitz, A. M.(1998). Real time detection of DNA RNA hybridizationin living cells. Proc. Natl Acad. Sci. USA, 95, 11538–11543.

25. Rich, A. (2006). Discovery of the hybrid helix andthe first DNA-RNA hybridization. J. Biol. Chem. 281,7693–7696.

26. Arbona, M., Cuenca, J. B. & Defrutos, R. (1995). Stressresponse in Drosophila pseudobscura — DNA-RNA hy-brids and transcriptional activity. Biol. Cell, 75, 187–195.

27. Asai, T. & Kogoma, T. (1994). D-loops and R-loops —alternative mechanisms for the initiation of chromo-some-replication in Escherichia coli. J. Bacteriol. 17,1807–1812.

28. Zenkin, N., Naryshkina, T., Kuznedelov, K. & Sever-inov, K. (2006). The mechanism of DNA replicationprimer synthesis by RNA polymerase. Nature, 439,617–620.

29. Lee, D. Y. & Clayton, D. A. (1997). RNase mitochon-drial RNA processing correctly cleaves a novel R loopat the mitochondrial DNA leading-strand origin ofreplication. Genes Dev. 11, 582–592.

30. Ohsato, T., Muta, T., Fukuoh, A., Shinagawa, H.,Hamasaki, N. & Kang, D. C. (1999). R-loop in thereplication origin of human mitochondrial DNA isresolved by RecG, a Holliday junction-specific heli-case. Biochem. Biophys. Res. Commun. 255, 1–5.

31. Huang, Z. F., Zhang, Y., Ma, R. L. & Liu, Y. N. (2003). Anovel R-loop in mouse mitochondrial DNA. Prog.Natu. Sci. 13, 517–521.

199tDNA-tRNA Hybrids Regulate Mitochondrial OL Function

32. Xu, B. J. & Clayton, D. A. (1996). RNA-DNA hybridformation at the human mitochondrial heavy-strandorigin ceases at replication start sites: An implicationfor RNA-DNA hybrids serving as primers. EMBO J.15, 3135–3143.

33. Shadel, G. S. & Clayton, D. A. (1997). MitochondrialDNA maintenance in vertebrates. Annu. Rev. Biochem.66, 409–435.

34. Lee, D. Y. & Clayton, D. A. (1996). Properties of aprimer RNA-DNA hybrid at the mouse mitochon-drial DNA leading-strand origin of replication. J. Biol.Chem. 271, 24262–24269.

35. Lee, D. Y. & Clayton, D. A. (1998). Initiation of mito-chondrial replication by transcription and R-Loopprocessing. J. Biol. Chem. 273, 30614–30621.

36. Yang, M. Y., Bowmaker, M., Reyes, A., Vergani, L.,Angeli, P., Gringeri, E. et al. (2002). Biased incorpora-tion of ribonucleotides on the mitochondrial L-strandaccounts for apparent strand-asymmetric DNA repli-cation. Cell, 111, 495–505.

37. Lowe, T. M. & Eddy, S. R. (1997). tRNAscan-SE: Aprogram for improved detection of transfer RNA genesin genomic sequence. NucleicAcids Res. 25, 955–964.

38. Wu, P., Nakano, S. & Sugimoto, N. (2002). Tempera-ture dependence of thermodynamic properties forDNA/DNA and RNA/DNA duplex formation. Eur. J.Biochem. 269, 2821–2830.

39. Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A.,Nakamuta, H., Ohmichi, T. et al. (1995). Thermody-namic parameters to predict stability of RNA/DNAhybrid duplexes. Biochemistry, 34, 11211–11216.

40. Markham, N. R. & Zuker, M. (2005). DINAMelt webserver for nucleic acid melting prediction. NucleicAcids Res. 33, W577–W581.

41. Amzallag, G. N. (2001). Data analysis in plant phy-siology: are wemissing the reality? Plant Cell Environm,24, 881–890.

42. Eddy, S. R. & Durbin, R. (1994). RNA sequence ana-lysis using covariance-models. Nucleic Acids Res. 22,2079–2088.

43. Ruiz-Pesini, E., Lott, M. T., Procaccio, V., Poole, J.,Brandon, M. C., Mishmar, D. et al. (2007). Anenhanced MITOMAP wwith a global mtDNA muta-tional phylogeny. Nucleic Acids Res. 35, D823–D828.

44. Florentz, C., Sohm, B., Tryoen-Toth, P., Putz, J. &Sissler, M. (2003). Human mitochondrial tRNAs inhealth and disease. Cell Mol. Life Sci. 60, 1356–1375.

45. Kern, A. D. & Kondrashov, F. A. (2004). Mechanismsand convergence of compensatory evolution inmammalian mitochondrial tRNAs. Nature Genet. 36,1207–1212.

46. Kondrashov, F. A. (2005). Prediction of pathogenicmutations in mitochondrially encoded human tRNAs.Hum. Mol. Genet. 14, 2415–2419.

47. Sissler, M., Helm, M., Frugier, M., Giege, R. &Florentz, C. (2004). Aminoacylation properties ofpathology-related human mitochondrial tRNA(Lys)variants. RNA, 10, 841–853.

48. Levinger, L., Morl, M. & Florentz, C. (2004). Reducedefficiency of 3′ end cleavage and CCA addition withmutant humanmitochondrial tRNAs could contributeto pathogenesis. Biochim. Biophys. Acta-Bioenerg. 1657,53.

49. Albrecht-Buehler, G. (2006). Asymptotically increas-ing compliance of genomes with Chargaff's secondparity rules through inversions and inverted transpo-sitions. Proc. Natl Acad. Sci. USA, 103, 17828–17833.

50. Samuels, D. C. (2004). Mitochondrial DNA repeatsconstrain the life span of mammals. TRIGS, 20, 226–229.

51. Samuels, D. C., Schon, E. A. & Chinnery, P. F. (2004).Two direct repeats cause most human mtDNA dele-tions. Trends Genet. 20, 393–398.

52. Samuels, D. C. (2005). Life span is related to the freeenergy of mitochondrial DNA. Mech. Ageing Dev. 126,1123–1129.

53. Khaidakov, M., Siegel, E. R. & Reis, R. J. S. (2006).Direct repeats in mitochondrial DNA andmammalianlifespan. Mech. Ageing Dev. 127, 808–812.

54. Moller, A. P. (1997). Developmental stability andfitness: a review. Am. Nat. 149, 916–932.

55. Moller, A. P. (1999). Developmental stability is relatedto fitness. Am. Nat. 153, 556–560.

56. Krishnan, N. M., Seligmann, H. & Rao, B. J. (2005).Natural selection on cloverleaf forming capacity fine-tunes the population frequency of human mitochon-drial tRNA variants. In 21st International tRNA Work-shop, Bangalore, India December 2005 (Chatterji, D., Das,S., Nagaraja, V., Durga Rao, C. & Vijayraghavan, U.,eds), p. 22.

57. Ojala, D., Montoya, J. & Attardi, G. (1981). tRNApunctuation model of RNA processing in humanmitochondria. Nature, 290, 470–474.

58. Sasuga, J., Yokobori, S., Kaifu, M., Ueda, T., Nishi-kawa, K. & Watanabe, K. (1999). Gene contents andorganization of a mitochondrial DNA segment of thesquid, Loligo bleekeri. J. Mol. Evol. 48, 692–702.

59. Brown, T. A., Cecconi, C., Tkachuk, A. N.,Bustamante, C. & Clayton, D. A. (2005). Replica-tion of mitochondrial DNA occurs by stranddisplacement with alternative light-strand origins,not via a strand-coupled mechanism. Genes Dev. 19,2466–2476.