Lettershttps://doi.org/10.1038/s41588-019-0425-8

1Department of Agronomy, Kansas State University, Manhattan, KS, USA. 2Institute of Cereal and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences, Shijiazhuang, China. 3Department of Plant Pathology, Kansas State University, Manhattan, KS, USA. 4Institute of Food Crops, Jiangsu Academy of Agricultural Science, Nanjing, China. 5Agriculture College, Yangzhou University, Yangzhou, China. 6USDA–ARS, Hard Winter Wheat Genetics Research Unit, Manhattan, KS, USA. 7Department of Agronomy, Iowa State University, Ames, IA, USA. 8Crop Instutute, Chinese Academy of Agricultural Science, Beijing, China. *e-mail: guihua.bai@usda.gov

Fusarium head blight (FHB), which is mainly caused by Fusarium graminearum, is a destructive wheat disease that threatens global wheat production. Fhb1, a quantitative trait locus discovered in Chinese germplasm, provides the most stable and the largest effect on FHB resistance in wheat. Here we show that TaHRC, a gene that encodes a putative histidine-rich calcium-binding protein, is the key determinant of Fhb1-mediated resistance to FHB. We demonstrate that TaHRC encodes a nuclear protein conferring FHB susceptibility and that a deletion spanning the start codon of this gene results in FHB resistance. Identical sequences of the TaHRC-R allele in diverse accessions indicate that Fhb1 had a single origin, and phylogenetic and haplotype analyses suggest that the TaHRC-R allele most likely originated from a line carrying the Dahongpao haplotype. This discovery opens a new avenue to improve FHB resistance in wheat, and possibly in other cereal crops, by manipulating TaHRC sequence through bioengineer-ing approaches.

FHB, which is mainly caused by F. graminearum Schwabe, is one of the most devastating diseases of wheat1–4. Unlike foliar dis-eases that affect grain yield indirectly, FHB occurs directly on wheat spikes, which can result in complete losses of grain yield during severe epidemics. Also, mycotoxins such as deoxynivalenol (DON) that are produced by the pathogen in infected grain are among the top safety concerns for human food and animal feed. Furthermore, DON-contaminated wheat grain can be substantially discounted or even rejected at sale5–7. More recently, changes in climate and crop-ping systems have made FHB epidemics more frequent and severe, even in regions where FHB had not been previously reported8–11. Growing FHB-resistant cultivars is the most effective strategy for minimizing losses caused by FHB1,2,4.

Although more than 50 unique quantitative trait loci (QTLs) for FHB resistance have been reported1, only Fhb1 (originally identified in Chinese cultivar Sumai3) consistently has a major effect on resistance to a broad spectrum of Fusarium species12–19. Sumai3 and its derivatives carrying Fhb1 have been considered the best sources of resistance worldwide for half a century12,16,17. Near-isogenic lines (NILs) harboring Fhb1 had a 20–50% reduction in the severity of FHB as compared to NILs without Fhb1 (refs. 19,20). As the pivotal wheat gene for FHB resistance, Fhb1 has been exten-sively studied and prioritized for map-based cloning to identify the causal gene12,21. Recently, a gene encoding a pore-forming toxin-like

protein (TaPFT) has been reported as Fhb1 (ref. 22). However, we have found that TaPFT is present in many highly susceptible acces-sions without Fhb1-mediated resistance, leading us to reconsider the identity of Fhb1 (ref. 23).

We conducted fine mapping that delimited Fhb1 to an approxi-mately 300-kb region on contig Ctg0954b of Chinese Spring24,25 (Fig. 1a–c, Supplementary Table 1 and Supplementary Fig. 1; also see Methods). Gene annotation of the Ctg0954b sequence pre-dicted 13 putative genes in the region24 (Supplementary Table 2). Recently, the Fhb1 region from a Sumai3 derivative, CM-82036, has been sequenced21. Three additional genes (Ubi-2 (encoding a ubiquitin 2-like protein), TaPFT (encoding a pore-forming toxin-like protein) and TaGDSL (encoding a GDSL lipase acylhydrolase)) that are absent in Chinese Spring were identified from this new sequence (Fig. 1d).

RNA-sequencing (RNA-seq) analysis of the Fhb1 NILs identi-fied 21 differentially expressed genes mapping to chromosome 3B (Supplementary Table 3). However, only TaHRC, which encodes reticulum histidine-rich calcium-binding protein (GenBank acces-sion CBH32655.1; annotated as His in ref. 22) and was more highly expressed in the susceptible NIL (NIL-S) than in the resistant NIL (NIL-R), was located in the Fhb1 region. This finding is in agree-ment with previous studies21,26,27. TaGDSL and TaPFT, which were previously reported as Fhb1 candidates21,22 and are absent in FHB-susceptible cultivars Chinese Spring and Clark, were also expressed in NIL-R. Therefore, TaHRC, TaGDSL and TaPFT were prioritized as Fhb1 candidates for initial analysis.

We selected TaHRC as the most likely candidate for Fhb1 after analyzing the FHB resistance of two F6 recombinant inbred line (RIL) populations developed from Chokwang × Clark and Ning7840 × Chokwang crosses. Clark carries the Fhb1 allele confer-ring susceptibility19. Sequence analysis to compare Chokwang and Ning7840 showed that the TaPFT22 and TaGDSL21 sequences were identical in the two lines but the TaHRC sequences differed. In the Chokwang × Clark population, the group of RILs that carried both TaPFT and TaGDSL had a similar mean FHB rating as the group of RILs that lacked TaPFT and TaGDSL (Fig. 2a), indicating that TaPFT and TaGDSL did not reduce FHB rating. Meanwhile, the lack of obvious phenotypic segregation between the two groups of RILs (Supplementary Fig. 2a) suggests that Chokwang does not carry an unlinked TaPFT suppressor as reported for Yr18 (ref. 28). In the Ning7840 × Chokwang population, however, the two RIL groups

A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheatZhenqi Su1,2, Amy Bernardo3, Bin Tian   3, Hui Chen1, Shan Wang1, Hongxiang Ma1,4, Shibin Cai1,4, Dongtao Liu1, Dadong Zhang1, Tao Li1,5, Harold Trick   3, Paul St. Amand6, Jianming Yu   7, Zengyan Zhang8 and Guihua Bai   1,6*

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics 1099

Letters NaTure GeNeTICs

Gwm533 Gwm493

a

b

c

d

e

NIL-R NIL-R NIL-SNIL-H NIL-S

Ctg0954 (~3.1 Mb)

3BS

STS142

RN

TaHRC -S Exon 1 Exon 2

Exon 1 Exon 2 Exon 3

GT GTAG

GT GTAG AG AG AG

AG

AG ATGATG TAA

Intron 1

Intron 1

Intron 2

Intron 2

Exon 3

Deletionmutation

ATG TAA786-bp ORF

Putative 825-bp ORF

TaHRC -R

Kasp-9 Sts138 Umn10 Cfb6126 Cfb6019Snp8

1571061 2164717 2193324 2467047 2637949 28384712138666 2173202 2462993 2511892 2741532 2945261 PSS (%)

0Phen.

S

S

R

R

R

R

R

R

S

S

S

2

4

1

3

2

1

2

1

3

2

1

HGA

Leu-

tRNA

Exo.

CHPPA

PTRM

PGPOND

TPSUbi-

2HRC

HCP-1PFT

HCP-2

GDSL

Ala-tR

NA

20 40 60 80 100

Kasp-Cg1 Cfb6058 Cfb6067 Cfb6060 Sts163

3BLFhb1

Fig. 1 | Fine mapping and cloning of Fhb1. a, Left, infected spikes of NILs corresponding to an Fhb1-containing resistant homozygote (NIL-R), a susceptible homozygote (NIL-S) and a heterozygote (NIL-H). Right, damaged wheat kernels harvested from NIL-R and NIL-S after Fusarium infection. Similar results were obtained when at least 30 independent spikes per line were inoculated with F. graminearum. b, Wheat chromosome 3B showing the Fhb1 region and flanking markers used for backcrossing on the short arm of chromosome 3B (3BS). The crossover in the dashed line indicates that the map in c is in the reverse orientation to the map in b. c, Top, the Fhb1 region was mapped with markers developed on the basis of sequences from Ctg0954 of Chinese Spring. The number under each marker is the sequence position of the forward primer on Ctg0954b. Fine mapping delimited the Fhb1 region to a ~300-kb region (yellow bar) on the basis of recombinants identified in the region (bottom left) and their FHB severity (bottom right). Bars indicate chromosomal segments from Ning7840 (filled) and Clark (open). For box plots, boxes indicate the 25th–75th percentile of PSS for each recombinant, whiskers indicate the full data range, center lines indicate the median and crosses indicate the mean. PSS, percentage of symptomatic spikelets; RN, recombinant-line number; Phen., phenotype classified as FHB resistant (R; PSS < 50%) or susceptible (S; PSS > 50%) with n = 30. d, Genes annotated in the Fhb1 region using the Chinese Spring Ctg0954b reference (red triangles) and the CM-82036 reference (purple triangles). e, Diagram of the gene structures and transcripts from TaHRC-R and TaHRC-S. Orange boxes, exons; solid gray lines, introns; dashed line, sequence deletion; gray box, the retained intron region in the mature mRNA; ATG, start codon; TAA, stop codon; GT and AG, conserved splicing donor and acceptor sites; yellow letters AG, alternative splicing acceptor sites.

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics1100

LettersNaTure GeNeTICs

carrying contrasting TaHRC alleles had a significantly different per-centage of symptomatic spikelets (PSS) per spike (P < 0.001) even though they carried the same TaPFT and TaGDSL alleles (Fig. 2a). Obvious phenotypic segregation between the two RIL groups (Supplementary Fig. 2b) indicated that TaHRC was significantly associated with FHB resistance. In addition, TaPFT gene expres-sion was significantly decreased after FHB inoculation in both Chokwang and Ning7840, and these lines had similarly low expres-sion levels at different time points after inoculation (Supplementary Fig. 3). These results exclude TaPFT and TaGDSL as likely candi-dates for Fhb1, and thus TaHRC was selected for further analysis.

We cloned TaHRC-S as a 2,650-bp sequence from NIL-S (GenBank accession MK450309) and TaHRC-R as a 2,041-bp sequence from NIL-R (GenBank accession MK450312). Sequencing the full-length cDNA of TaHRC-S isolated from the inoculated spikes of NIL-S identified three exons and two introns with a 786-bp ORF in the third exon (Fig. 1e). In comparison to TaHRC-S, TaHRC-R had a large deletion in the corresponding second intron and the beginning of the third exon that removed the conserved splicing acceptor site (AG), the translation start codon (ATG) and a 22-bp additional downstream sequence in the ORF. Sequencing the cDNAs of TaHRC-R identified four isoforms of different length

100.0

a

b

c

P = 0.018 P = 1.29 × 10–8

P = 2.81 × 10–8

P = 1.02 × 10–11P = 7.31 × 10–9

P = 8.67 × 10–5

P = 0.0001

90

76

91

24

32

2628

1438 24

2430

91112 112

88 108

76

7690

90

P = 1.38 × 10–5P = 0.730

P = 0.430

P = 0.00012

Non TaPFT TaHRC -R TaHRC -S

80.0

60.0

PS

S (

%)

PS

S (

%)

PS

S (

%)

40.0

20.0

0

100.0

80.0

60.0

PS

S (

%)

40.0

20.0

0

100.0

80.0

60.0Bobwhite

Bobwhite CK

Bobwhite-CK

Bobwhite 9427-Mut 17149-Mut

CRISPR-CK

CRISPR-Mut

4798R4830R

5428F

40.0

20.0

0

100.0

80.0

60.0

40.0

20.0

0

2004 summer

CK TaHRC RNAi 5428F RNAi

17149-CK17149-Mut

2006 fall 2007 fall 2006 summer 2006 fall 2007 fall

TaPFT

Fig. 2 | Determination of TaHRC as a candidate for Fhb1. a, Two groups of RILs with contrasting alleles of TaPFT in the Chokwang × Clark population (left) and of TaHRC in the Ning7840 × Chokwang population (right). The year and season in which FHB was evaluated are shown on the x axis. For box plots, boxes indicate the 25th–75th percentile, whiskers indicate the full data range, center lines indicate the median, crosses indicate the mean (n = 10) and the numbers inside boxes indicate the number of RILs. P values are from an unpaired two-sided Student’s t test. b, Left, comparison of mean PSS between three transgenic lines with knockdown of TaHRC expression by RNAi and the Bobwhite control. Right, inoculated wheat spikes from a TaHRC RNAi transgenic plant (5428F) and a non-transgenic Bobwhite plant. CK, control knockdown. c, Left, comparison of mean PSS between the mutant lines 9427-Mut and 17149-Mut in which TaHRC expression was knocked out by CRISPR–Cas9 gene editing and the non-transgenic Bobwhite or non-mutant transgenic control (9427-CK and 17149-CK). Right, inoculated spikes from a gene-edited plant (17149-Mut) and a non-edited plant (17149-CK). For box plots in b and c, boxes indicate the 25th–75th percentile, whiskers indicate the full data range, center lines indicate medians, crosses indicate means and the numbers inside boxes indicate sample size (n). P values are from two-sided unpaired Student’s t tests of the mean of transgenic lines versus the mean of controls, which were either Bobwhite (b) or transgenic non-edited (c) lines.

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics 1101

Letters NaTure GeNeTICs

that carried either the complete second intron or part of the second intron, indicating that the deletion results in partial or complete retention of the intron sequence in TaHRC-R after transcription (Supplementary Fig. 4).

Sequence alignment showed that all four cDNAs from TaHRC-R had the same 825-bp putative ORF (Fig. 1e and Supplementary Fig. 4b). To evaluate whether an alternatively spliced mRNA gained a new function conferring FHB resistance, we transformed the 825-bp cDNA (Supplementary Fig. 5a) into the wheat cultivar Bobwhite that is highly susceptible to FHB and identified ten events carrying the target construct. Three of them (4985, 5039 and 4927) showed sig-nificantly higher levels of TaHRC expression, but similar severity of FHB, as compared to their non-transgenic controls (Supplementary Fig. 6), suggesting that an alternatively spliced product of TaHRC-R did not gain a new function conferring FHB resistance.

Gene expression studies showed that the expression levels of TaHRC-S in NIL-S were four times higher than those of TaHRC-R in NIL-R before Fusarium inoculation; moreover, the contrast in expression levels between the two NILs was significantly larger after inoculation, in particular at 48 h after inoculation (Supplementary Fig. 7), which suggested that high expression of TaHRC-S is associ-ated with FHB susceptibility. To validate this assumption, we used RNA interference (RNAi) to knock down expression of TaHRC-S in the susceptible cultivar Bobwhite. Among ten independent trans-genic events, three (4798R, 4830R and 5428F) had the target con-struct (Supplementary Fig. 5b), and their T1 and T2 lines showed significantly lower TaHRC expression and FHB severity than their non-transgenic control after inoculation (Fig. 2b).

We also generated mutations in TaHRC of Bobwhite using CRISPR–Cas9-mediated gene editing. Among 19 positive T0 trans-genic lines, only lines 9427-Mut and 17149-Mut carried different 1-bp insertions in the target region (Supplementary Fig. 5c). The insertions generated a frame shift and a stop codon (TGA) at posi-tion 264 from the beginning of the start codon. T1 homozygous plants from both mutants had significantly lower FHB severity than their wild-type control (Fig. 2c). Significantly enhanced FHB resis-tance after knockdown or knockout of TaHRC expression suggests that TaHRC-S conditions FHB susceptibility and that loss of func-tion of TaHRC-S confers Fhb1 resistance.

We sequenced TaHRC in 142 wheat accessions from several countries to explore natural variants of TaHRC. Sequence analy-sis of both coding and upstream regions of TaHRC identified six sequence polymorphisms in the ORF region that represented all sequence variations in the gene and separated the 142 accessions into seven haplotypes (Fig. 3a). The accessions with haplotype Ning7840 (Hap_Ning) contained a TaHRC sequence with the large deletion identical to the sequence in Ning7840 (TaHRC-R) (Fig. 1e), whereas the accessions with the other six haplotypes had the complete ORF of TaHRC (TaHRC-S), although several SNPs and indels were iden-tified among the haplotypes (Supplementary Fig. 8). The anno-tated putative proteins showed more than 95.0% sequence identity among the six sequence variants. Evaluation of FHB resistance in the natural population revealed a significantly lower PSS (19.7%, P < 0.001) in the accessions with Hap_Ning than in the accessions with the six other haplotypes (PSS = 58.3–65.8%) (Fig. 3b and Supplementary Table 4) even though haplotype Hap_DHP, which includes Chokwang, had TaPFT and TaGDSL sequences identical to those in Hap_Ning. Fhb1 has been mapped in several Chinese and Japanese accessions carrying Hap_Ning1,15–17,21,29, whereas several other accessions from the other haplotypes have been validated to harbor the Fhb1 allele conferring susceptibility17,23,29.

We further expanded the haplotype analysis to a worldwide collec-tion by screening an additional 1,632 wheat landraces and cultivars from 73 countries for the large deletion in TaHRC (Supplementary Table 5). We found 85 accessions with the TaHRC-R haplotype that were exclusively from China and Japan, and when grown

normally in a greenhouse 76 of these accessions showed signifi-cantly lower PSS than 100 randomly selected TaHRC-S accessions, which included 66 accessions of Hap_DHP that were not related to Chokwang in their pedigrees and 34 accessions of Hap_ND (Fig. 3b and Supplementary Table 6). To date, Fhb1 has been reported exclu-sively in germplasm from East Asia, mainly southern China and Japan; therefore, the exclusive distribution of the TaHRC-R allele in these two countries matches the origin of Fhb1.

We conducted association analysis of candidate genes using the PSS values obtained from the natural population of 142 accessions to assess whether the large deletion in TaHRC is the causal variation for Fhb1 resistance. Among the markers analyzed, including the six representative sequence variants from TaHRC and 13 other markers across the Fhb1 region, the large deletion in TaHRC was the variant most significantly associated with FHB resistance (P = 1.0 × 10−19; Fig. 3c). This result strongly supports the large deletion in TaHRC as the causal mutation for Fhb1.

In the natural population, all accessions with the Hap_Ning haplotype contained an identical TaHRC sequence, indicating that the large deletion in TaHRC was monophyletic and occurred more recently. Phylogenetic analysis showed that the accessions with Hap_DHP were the least divergent from those with Hap_Ning (Supplementary Fig. 9). Sequence comparison of TaHRC between Hap_Ning and Hap_DHP (GenBank accession MK450307) showed that the TaHRC-R allele in Hap_Ning had a 752-bp deletion, includ-ing 727 bp in the upstream region and 25 bp in the ORF, as com-pared to TaHRC-S in Hap_DHP (Supplementary Fig. 8). Haplotype analysis of the natural population using 14 markers across the Fhb1 region obtained the same seven haplotypes as those derived from analysis of sequence variants in TaHRC. All tested markers were monomorphic between the accessions with Hap_DHP and Hap_Ning except for the marker developed on the basis of the large dele-tion in TaHRC (Supplementary Fig. 10), suggesting that Hap_DHP was likely the immediate ancestor of Hap_Ning.

TaHRC is a conserved gene in the genomes of grass species (Supplementary Fig. 11). The orthologs of TaHRC in Oryza sativa, Brachypodium distachyon and Zea mays were predicted to encode a functional protein, but in Arabidopsis thaliana the ortholog was annotated as a hypothetical protein. In wheat, TaHRC homeologs from the A and D genomes had more than 94.0% and 93.0% DNA and protein sequence identity with TaHRC from the B genome, respectively. A high level of TaHRC-S expression was observed from the B genome of the susceptible NIL, but not from the A and D genomes of the same NIL (Fig. 4a), suggesting that TaHRC-S in the B genome has a more critical role in FHB susceptibility in hexa-ploid wheat. TaHRC-S encodes a protein that contains 261 amino acids with a molecular weight of 31.2 kDa and an isoelectric point of 10.2 in wheat. Functional prediction of TaHRC did not find any known conserved domains related to disease-resistance genes in plants. A motif scan of the putative protein encoded by TaHRC-S identified several motifs, including a histidine-rich region and a nuclear localization signal, but no obvious calcium-binding EF-hand motif30 (Fig. 4b). Subcellular localization of TaHRC-S fused to green fluorescent protein (GFP) located the fusion pro-tein in the nucleus of wheat leaf protoplasts (Fig. 4c), indicating that TaHRC is a nuclear protein. The detailed biological functions and mechanisms by which TaHRC confers FHB resistance in wheat remain to be further characterized.

Global climate change has made weather conditions much more conducive to wheat FHB epidemics, as evidenced by the recent widespread and severe FHB outbreaks in China and the United States that caused a billion dollars in losses of wheat production8,11. Growing resistant cultivars has proven to be the most effective strat-egy to minimize FHB damage. The high level of TaHRC expression induced by F. graminearum in lines with susceptible genotypes and the loss-of-function mutation of TaHRC-S conferring FHB

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics1102

LettersNaTure GeNeTICs

Haplotype

a

b

c

0–24 350 504 566–568 725–727 745

ATG–AGA

ATG–AGA

ATG–AGA

ATG–AGA

ATG–AGA

ATG–AGA

TCA TC

C

C – – –Hap_CS

Hap_DBP

Hap_Funo

Hap_Clark

Hap_ND

Hap_DHP

Hap_Ning

100.0 100.0

80.0

60.0

40.0

20.0

0

80.0

1

2

475

17

10

60 76

67

3460.0

40.0

PS

S (

%)

−lo

g 10

(P v

alue

)

PS

S (

%)

20.0

0

20

15

10

5

0

13.1 Mb

GDSL-STS

2495

608

2467

047

2463

669

2462

993

2449

350

2447

136

2360

329

2338

851

2300

203

E3Ubi-

STS

PFT-STS

SNP319

umm

10

IFA-F

MG3

cfb60

59

cfb60

580–

24 350

504

566–

568

725–

727

745

TPS-STS

cfb60

57

cfb60

56

cfb60

55

STS256

CS DBP FUNO Clark

Haplotype Haplotype

ND DHP Ning Ning DHP ND

Positions and sequence variants in the ORF of TaHRC

TCA CC –

–

– –

C TCA CC TCA – –

C TCA CT TCA – –

C – CC TCA + +

C – CC

P < 0.001P < 0.001

TCA + +

T – CC TCA – +

TaGDSL

TaHRC :2460534–2461361

TaPFT

Fig. 3 | Haplotype and association analyses in natural populations identify the deletion in TaHRC as the likely causal mutation for Fhb1. a, TaPFT, TaGDSL and six representative polymorphic markers developed on the basis of variations in TaHRC sequence separated 142 accessions into seven haplotypes. The presence or absence of TaPFT and TaGDSL is indicated by ‘+’ and ‘−’, respectively. Numbers are positions of SNPs or indels counting from the start codon of TaHRC. b, Accessions with Hap_Ning showed significantly lower mean PSS than accesions with other haplotypes in the 142 accessions (left; Supplementary Table 4) and a selected set of lines from the worldwide collection (right; Supplementary Table 6). For box plots, boxes indicate 25th–75th percentile, whiskers indicate the full data range, center lines indicate the median, crosses indicate the mean and the numbers inside boxes indicate the number of accessions. P values are from two-sided Fisher’s least significant difference tests for comparisons of the means for Hap_Ning and other haplotypes (Methods). c, Association analysis of candidate genes using the six markers representing sequence variants (from positions ‘0–24’ to ‘745’) of TaHRC, four gene markers for TaPFT, TaGDSL, E3Ubi and TP (terpene synthase), and nine other markers across the Fhb1 region confirms the large deletion (red dot) in the ORF of TaHRC (SNP0–24) as the likely causal mutation for Fhb1. Marker names and their corresponding physical positions in the Chinese Spring reference are labeled below the x axis. The population size was 142. The orange dashed line is the threshold for claiming significant marker and trait associations at P < 0.001 (Methods).

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics 1103

Letters NaTure GeNeTICs

8.0a

b

c

7.0

6.0

5.0

4.0

Rel

ativ

e ex

pres

sion

leve

l

3.0

2.0

1.0

00 6 24

TaHRC -B

10 20 30

150

40 50 60

70 80NLS

100 110 120

130 140 160 170 180

210190 200

250

DAPI

35S::GFP–TaHRC

35S::GFP

GFP Bright field Merged

260

220 230 240

TaHRC -AD TaHRC -AD

48 72 0 6 24 48 72 0 6 24 48 72 0 6 24 48 72 (h)

NIL-R TaHRC -B NIL-S NIL-SNIL-R

Fig. 4 | Characterization of TaHRC. a, Expression of homeologs of TaHRC (TaHRC-B from chromosome B and TaHRC-AD from chromosomes A and D) in the Fhb1-containing resistant NIL (NIR-R) and the susceptible NIL (NIL-S). Time points (in hours) after inoculation with F. graminearum are indicated on the x axis. The expression data for TaHRC-A and TaHRC-D were combined owing to the high sequence identity of the homeologs. The actin gene was used as the internal control. All relative expression data were calculated using the −ΔΔ2 Ct method and normalized on the basis of the expression level of TaHRC-B in NIL-R at 0 h after mock inoculation. Dots indicate relative expression levels of homeologs of TaHRC evaluated in the three experiments as labeled by three colors, and red lines indicate the mean from independent experiments (n = 3). b, Predicted TaHRC-S protein motifs in Clark, including a serine-rich region (underlined in purple), an arginine-rich region (highlighted in yellow), a histidine-rich region (red font) and a bipartite nuclear localization signal (NLS, green font in red box). c, Subcellular localization of TaHRC showing exclusive expression of the 35S::GFP–TaHRC fusion protein in the nucleus (top) and expression of the 35S::GFP control protein in both the cytoplasm and nucleus (bottom). Similar results were obtained from five independent experiments. Scale bars, 10 µm.

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics1104

LettersNaTure GeNeTICs

resistance indicate that TaHRC is most likely a susceptibility gene that regulates the spread of FHB symptoms within a wheat spike. In cereal crops, several cases of loss of function of susceptibility genes conferring disease resistance have been reported31–34. Fhb1 encodes a putative nuclear histidine-rich calcium-binding protein and is a new type of gene regulating resistance that is distinct from typical R genes35. TaHRC is a conserved gene in cereal crops, and knocking out TaHRC-S expression significantly increased FHB resistance, which opens a new avenue to improve FHB resistance in wheat and possibly other cereal crops by manipulating the sequence of TaHRC-S using biotechnology. However, FHB resis-tance is controlled by multiple genes, and Fhb1 provides only par-tial resistance. Other minor resistance QTLs from locally adapted cultivars should be used in combination with Fhb1 to achieve higher levels of FHB resistance8,36,37.

Online contentAny methods, additional references, Nature Research reporting summaries, source data, statements of code and data availability and associated accession codes are available at https://doi.org/10.1038/s41588-019-0425-8.

Received: 4 May 2017; Accepted: 23 April 2019; Published online: 10 June 2019

references 1. Buerstmayr, H., Ban, T. & Anderson, J. A. QTL mapping and marker‐assisted

selection for Fusarium head blight resistance in wheat: a review. Plant Breed. 128, 1–26 (2009).

2. Bai, G. & Shaner, G. Management and resistance in wheat and barley to Fusarium head blight. Annu. Rev. Phytopathol. 42, 135–161 (2004).

3. Xu, X. & Nicholson, P. Community ecology of fungal pathogens causing wheat head blight. Annu. Rev. Phytopathol. 47, 83–103 (2009).

4. Dean, R. et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 13, 414–430 (2012).

5. Pestka, J. J. & Smolinski, A. T. Deoxynivalenol: toxicology and potential effects on humans. J. Toxicol. Environ. Health B Crit. Rev. 8, 39–69 (2005).

6. van Egmond, H. P., Schothorst, R. C. & Jonker, M. A. Regulations relating to mycotoxins in food. Anal. Bioanal. Chem. 389, 147–157 (2007).

7. Pestka, J. J. Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Arch. Toxicol. 84, 663–679 (2010).

8. McMullen, M. et al. A unified effort to fight an enemy of wheat and barley: Fusarium head blight. Plant Dis. 96, 1712–1728 (2012).

9. Chakraborty, S. & Newton, A. C. Climate change, plant diseases and food security: an overview. Plant Pathol. 60, 2–14 (2011).

10. Del Ponte, E. M., Fernandes, J., Pavan, W. & Baethgen, W. E. A model‐based assessment of the impacts of climate variability on Fusarium head blight seasonal risk in southern Brazil. J. Phytopath. 157, 675–681 (2009).

11. Zhang, X. et al. Climate change increases risk of Fusarium ear blight on wheat in central China. Ann. Appl. Biol. 164, 384–395 (2014).

12. Cuthbert, P. A., Somers, D. J., Thomas, J., Cloutier, S. & Brulé-Babel, A. Fine mapping Fhb1, a major gene controlling Fusarium head blight resistance in bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 112, 1465–1472 (2006).

13. Yang, Z. P. et al. Marker assisted selection of Fusarium head blight resistance genes in two doubled haploid populations of wheat. Mol. Breed. 12, 309–317 (2003).

14. Zhou, W., Kolb, F. L., Bai, G., Shaner, G. & Domier, L. L. Genetic analysis of scab resistance QTL in wheat with microsatellite and AFLP markers. Genome 45, 719–727 (2002).

15. Anderson, J. A. et al. DNA markers for Fusarium head blight resistance QTLs in two wheat populations. Theor. Appl. Genet. 102, 1164–1168 (2001).

16. Waldron, B., Moreno-Sevilla, B., Anderson, J., Stack, R. & Frohberg, R. RFLP mapping of QTL for Fusarium head blight resistance in wheat. Crop Sci. 39, 805–811 (1999).

17. Bai, G., Kolb, F. L., Shaner, G. & Domier, L. L. Amplified fragment length polymorphism markers linked to a major quantitative trait locus controlling scab resistance in wheat. Phytopathology 89, 343–348 (1999).

18. Pumphrey, M. O., Bernardo, R. & Anderson, J. A. Validating the QTL for Fusarium head blight resistance in near-isogenic wheat lines developed from breeding populations. Crop Sci. 47, 200–206 (2007).

19. Bernardo, A. N., Ma, H., Zhang, D. & Bai, G. Single nucleotide polymorphism in wheat chromosome region harboring Fhb1 for Fusarium head blight resistance. Mol. Breed. 29, 477–488 (2012).

20. Jin, F. et al. Fusarium head blight resistance in US winter wheat cultivars and elite breeding lines. Crop Sci. 53, 2006–2013 (2013).

21. Schweiger, W. et al. Suppressed recombination and unique candidate genes in the divergent haplotype encoding Fhb1, a major Fusarium head blight resistance locus in wheat. Theor. Appl. Genet. 129, 1607–1623 (2016).

22. Rawat, N. et al. Wheat Fhb1 encodes a chimeric lectin with agglutinin domains and a pore-forming toxin-like domain conferring resistance to Fusarium head blight. Nat. Genet. 48, 1576–1580 (2016).

23. Yang, J., Bai, G. & Shaner, G. E. Novel quantitative trait loci (QTL) for Fusarium head blight resistance in wheat cultivar Chokwang. Theor. Appl. Genet. 111, 1571–1579 (2005).

24. Paux, E. et al. A physical map of the 1-gigabase bread wheat chromosome 3B. Science 322, 101–104 (2008).

25. Choulet, F. et al. Megabase level sequencing reveals contrasted organization and evolution patterns of the wheat gene and transposable element spaces. Plant Cell 22, 1686–1701 (2010).

26. Hofstad, A. N. et al. Examining the transcriptional response in wheat near-isogenic lines to infection and deoxynivalenol treatment. Plant Genome 9, 1 (2016).

27. Jia, H., Cho, S. & Muehlbauer, G. J. Transcriptome analysis of a wheat near-isogenic line pair carrying Fusarium head blight-resistant and -susceptible alleles. Mol. Plant-Microbe Inter. 22, 1366–1378 (2009).

28. Wu, L. et al. Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces. Plant Breed. 134, 634–640 (2015).

29. Lin, F. et al. Mapping QTL associated with resistance to Fusarium head blight in the Nanda2419 × Wangshuibai population. I: Type II resistance. Theor. Appl. Genet. 109, 1504–1511 (2004).

30. White, P. J. & Broadley, M. R. Calcium in plants. Annu. Bot. 92, 487–511 (2003).

31. Wang, Y. et al. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 32, 947–951 (2014).

32. Fukuoka, S. et al. Loss of function of a proline-containing protein confers durable disease resistance in rice. Science 325, 998–1001 (2009).

33. Faris, J. D. et al. A unique wheat disease resistance-like gene governs effector-triggered susceptibility to necrotrophic pathogens. Proc. Natl Acad. Sci. USA 107, 13544–13549 (2010).

34. Shi, G. et al. The hijacking of a receptor kinase-driven pathway by a wheat fungal pathogen leads to disease. Sci. Adv. 2, e1600822 (2016).

35. van Schie, C. C. & Takken, F. L. Susceptibility genes 101: how to be a good host. Annu. Rev. Phytopathol. 52, 551–581 (2014).

36. Kugler, K. G. et al. Quantitative trait loci-dependent analysis of a gene co-expression network associated with Fusarium head blight resistance in bread wheat (Triticum aestivum L.). BMC Genomics 14, 1 (2013).

37. Kang, J. et al. Exotic scab resistance quantitative trait loci effects on soft red winter wheat. Crop Sci. 51, 924–933 (2011).

AcknowledgementsThis project was supported by US Department of Agriculture US Wheat and Barley Scab Initiative and National Research Initiative competitive grants 2017-67007-25939 and 2017-67007-25929 from the USDA National Institute of Food and Agriculture. We thank W. Wang for excellent technical support. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture. USDA is an equal opportunity provider and employer. This is contribution number 16-129-J from the Kansas Agricultural Experiment Station.

Author contributionsG.B. designed the research. Z.S., A.B., B.T., H.M., H.C., S.C., D.Z. and T.L. performed the research with support from G.B., H.T. and P.S.A. D.L., J.Y., Z.Z. and S.W. analyzed data. G.B. and H.T. contributed new reagents and analytic tools. G.B. and Z.S. wrote the paper. All authors contributed to revision of the manuscript.

Competing interestsThe authors declare no competing interests.

Additional informationSupplementary information is available for this paper at https://doi.org/10.1038/s41588-019-0425-8.

Reprints and permissions information is available at www.nature.com/reprints.

Correspondence and requests for materials should be addressed to G.B.

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

© The Author(s), under exclusive licence to Springer Nature America, Inc. 2019

NATure GeNeTiCS | VOL 51 | JULY 2019 | 1099–1105 | www.nature.com/naturegenetics 1105

Letters NaTure GeNeTICs

MethodsPlant materials. An F8-derived RIL population was developed from a cross of Clark × Ning7840. Ning7840 is a highly resistant Chinese line that carries Fhb1 and Clark is a US FHB-susceptible cultivar released from Indiana. The parents and RIL population were evaluated for FHB resistance in several greenhouse experiments17. One resistant RIL (RIL24) was selected as the Fhb1 donor and Clark was chosen as the recurrent parent for backcrossing. Starting from BC2F1, hybrid plants from each backcross generation were genotyped using the flanking markers Gwm533 and Gwm493 to select heterozygous Fhb1-containing plants for further backcrossing19. In the final step, selected BC7F1 Fhb1-containing plants were self-pollinated to generate enough BC7F2 seeds for fine mapping. In addition, we also developed F6 RILs from Chokwang × Clark (203 RILs) and Ning7840 × Chokwang (166 RILs) populations using single-seed descent to determine whether Chokwang carries Fhb1.

For association analysis of candidate genes, a natural population of 142 diverse wheat accessions was collected from East Asia and several other countries (Supplementary Table 4). The Chinese landraces and cultivars include those previously known to have FHB resistance and some randomly selected landraces from across the country with unknown FHB resistance. The Japanese accessions used in this study are the most resistant germplasm lines (provided by T. Ban, Yokohama City University). In addition, a population of 1,632 wheat accessions provided by the USDA National Small Grain Collection were genotyped using the three candidate gene markers. Those accessions include 331 Chinese landraces, 148 Japanese accessions and 1,153 accessions randomly selected from 71 other countries representing wheat accessions from major wheat-growing countries worldwide where Fhb1 is absent. After genotyping, all accessions with Hap_Ning and randomly selected accessions with Hap_DHP and Hap_ND (Supplementary Table 6) were phenotyped for FHB resistance in a greenhouse in spring 2017.

Fine mapping of Fhb1. We developed a BC7F2 population by marker-assisted backcrossing using Ning7840 as the Fhb1 donor and Clark as the susceptible recurrent female parent for fine mapping. Initially, 1,750 BC7F2 seedlings from the Clark × Ning7840 population were screened using the flanking markers Gwm533 and Gwm493 on the short arm of chromosome 3B (ref. 19). Genotypic and phenotypic analyses of the selected recombinants identified two new flanking markers, Sts3B-163 and Sts3B-142 (Fig. 1b,c), that delimited the Fhb1 interval19. Sequence alignment of the two markers with the chromosome 3B survey sequence of Chinese Spring physically located Fhb1 to contig Ctg0954b (GenBank accession FN564434.1)24,25. We screened an additional 13,000 BC7F2 plants from the population with the new markers and identified 22 recombinants (Fig. 1c). Analysis of ten selected markers across the Fhb1 region (Supplementary Table 1) and FHB severity of these homozygous recombinants narrowed Fhb1 to a ~300-kb region on Ctg0954b (Fig. 1c,d).

Developing near-isogenic lines and studying the inheritance pattern of Fhb1. The selected BC7F3 plants from the Clark × Ning7840 population were further genotyped using Umn10, a closer marker to Fhb1. One plant, NIL22, was found to be heterozygous at Umn10, and its BC7F4 seeds were individually planted and genotyped to separate homozygotes with contrasting alleles at Umn10 and heterozygotes. Selected plants were phenotyped for FHB resistance in a greenhouse using the single-floret inoculation method. Fhb1-heterozygous plants had a mean PSS value between those of the two contrasting NILs (Supplementary Fig. 1), suggesting partially dominant inheritance of Fhb1. The selected homozygotes at Umn10 (NILs) were advanced and evaluated for FHB resistance again. FHB severity data showed that NIL22i and NIL22w were FHB resistant and NIL22h and NIL22v were FHB susceptible in three consecutive greenhouse experiments with 30 plants per line tested. These four lines were selected as two sets of NILs for RNA-seq. NIL22i and NIL22h were used for expression and sequencing of candidate genes.

Evaluation of Fusarium head blight. In the greenhouse experiments, seeds were planted in plastic trays filled with Metro-mix 360 soil mix (Hummert International) and then moved to a cold room for vernalization. After 50 d at 6 °C in a cold room, the seedlings were transplanted into 12.7 × 12.7 cm Dura pots (Hummert International) filled with Metro-mix 360 soil mix. The pots were arranged in a randomized complete block design on greenhouse benches. The greenhouse was maintained at 17 ± 2 °C at night and 22 ± 5 °C during the day with 14 h of supplemental light.

A Kansas strain of F. graminearum (isolate GZ3639) was used as an inoculum to evaluate all wheat materials for FHB resistance. A conidial spore suspension was prepared as described17. At early anthesis, wheat spikes were inoculated by injecting 10 µl of the conidial spore suspension (~1,000 spores per spike) into a floret of a central spikelet in a spike by using a syringe (Hamilton). Five spikes per line were inoculated in each replicate and each experiment had at least two replicates. The inoculated spikes were either enclosed in a moist plastic chamber or individually bagged with a thin plastic sandwich bag to provide 100% relative humidity at 20–22 °C for 48 h to initiate fungal infection. The infected plants were then moved to the greenhouse benches for further FHB development. The spread of FHB symptoms within a spike (type II resistance) was evaluated by counting the

symptomatic spikelets and total spikelets in the inoculated spike 15 d after inoculation. FHB severity for each line was calculated using PSS in an inoculated spike.

For fine mapping, the mean PSS of each recombinant was calculated over two independent experiments. Each experiment had three replicates with five independent plants per replicate. Mean PSS for genetic analysis (Fig. 2a), haplotype analysis (Fig. 3b) and association mapping (Fig. 3c) was calculated from three experiments and each experiment had two replicates with five plants per replicate for each accession. For transgenic experiments, ~30 plants per line were phenotyped for FHB resistance. To study the inheritance pattern of Fhb1, 30 plants for each of the marker-selected homozygous and heterozygous BC7F4 families from Clark × Ning7840 were evaluated for PSS.

DNA extraction and genotyping. Collection of leaf tissues, isolation of genomic DNA and PCR were conducted as described19. Amplified PCR products were analyzed in an ABI PRISM 3730 DNA Analyzer (Applied Biosystems). Data were scored using GeneMarker v.1.75 (SoftGenetics). The sequences of all primers used in this study are listed in Supplementary Table 1. For development of gene-specific markers and gene cloning of TaHRC, TaPFT and TaGDSL, the 15-µl PCR mix contained 1× NH4 buffer (Bioline), 2.5 mM MgCl2, 200 μM of each dNTP, 100 nM of each primer, 1 U Taq polymerase and 60 ng genomic DNA. PCR amplification was conducted using a touchdown program that started at 95 °C for 5 min, followed by 10 cycles of 95 °C for 30 s, 63 °C for 30 s, with a decrease of 0.5 °C in each subsequent cycle, and 72 °C for 3 min. PCR then went through an additional 28 cycles of 95 °C for 30 s, 58 °C for 30 s and 72 °C for 3 min with a final extension at 72 °C for 10 min. The PCR products were analyzed in a 1.0% agarose gel.

Gene cloning and sequencing. To clone the full-length cDNAs of TaHRC, 5′ RACE (rapid amplification of cDNA ends was performed using Roche 5′/3′ RACE Kit second generation (Millipore Sigma) following the manufacturer’s instructions. Total RNA was extracted from the spikes of NILs 48 h after F. graminearum inoculation, and first-strand cDNA was synthesized using one gene-specific primer (RACE-SP1) and nested PCR was amplified using three gene-specific primers (RACE-SP1, RACE-SP2 and RACE-SP3) (Supplementary Table 1) paired with an outer 5′ RACE primer from the kit. The PCR products were cloned into the pGEM-T Easy vector for sequencing.

Genomic DNA of target genes was amplified by PCR using gene-specific primers (Supplementary Table 1). The PCR fragments were purified using the Zymolean Gel DNA Recovery kit (http://www.zymoresearch.com/) and then cloned into the pGEM-T Easy vector following the manufacturer’s instructions (Promega). PCR was performed using the gene-specific primers, and amplicons were treated with shrimp alkaline phosphatase and exonuclease I (USB, Affymetrix) before sequencing in an ABI3730 DNA sequencer (Thermo Fisher Scientific).

Sequence analysis, gene function prediction and statistical analysis. DNA sequences were assembled and aligned using DNAstar Lasergene (http://www.dnastar.com/) and Bioedit (http://www.mbio.ncsu.edu/bioedit/bioedit.html). FGENESH was used to predict genes in the monocot (maize, rice, wheat and barley) model (http://linux1.softberry.com/). A phylogenetic tree was constructed using the neighbor-joining method, and the bootstrap test was carried out with 1,000 replicates using Mega 5.0 (ref. 38). Prediction of biological function and conserved domains of the TaHRC protein was conducted using PROSITE (http://www.expasy.org/prosite/).

Analysis of variance (ANOVA) was conducted using SPSS v.16.0 for Windows (SPSS). A significant difference among groups or genotypes was claimed at P < 0.05 using Fisher’s least significant difference tests. The markers and gene sequence variants in the Fhb1 region delimited by fine mapping were used for association analysis with the generalized linear model in TASSEL 5.0 using default parameter settings (http://www.maizegenetics.net/tassel). Frequencies of all marker alleles used for calculation were higher than 10%. The threshold for claiming significance of marker and trait associations was set to P < 0.001.

RNA preparation and RNA sequencing. Four NILs (NILs 22h and 22v (both susceptible) and NILs 22i and 22w (both resistant)) derived from BC7F7 of the Clark × Ning7840 population were grown in a greenhouse for the RNA-seq experiment. Plants were inoculated with F. graminearum at anthesis using single-floret inoculation as described39; two florets each of six centrally located spikelets were inoculated per spike. Inoculated plants were enclosed in a plastic bag and incubated at 22–25 °C for 12 h of light and at 20–22 °C for 12 h of darkness. Whole spikes were collected 0, 6, 24, 48 and 72 h after inoculation, flash frozen in liquid nitrogen and stored at −80 °C for RNA extraction.

Total RNA was extracted from wheat spikes using the Trizol RNA Reagent (Thermo Fisher Scientific) and treated with TURBO DNase (Thermo Fisher Scientific) to remove contaminating DNA. mRNA was isolated from the total RNA using the MicroPoly(A) Purist kit (Thermo Fisher Scientific) following the manufacturer’s instructions. RNA quantity and quality were assessed using the Qubit RNA assay kit (Thermo Fisher Scientific) and BioAnalyzer 2100 (Agilent Technologies).

NATure GeNeTiCS | www.nature.com/naturegenetics

LettersNaTure GeNeTICs

For RNA-seq, cDNA libraries were constructed from the spike tissue collected 48 h after inoculation using the Ion Total RNA-Seq Kit V2 (Thermo Fisher Scientific) and the samples were barcoded with Ion Xpress RNA-seq barcodes. Equal molar amounts of the libraries from the four sister lines were pooled and run at least twice on an Ion Proton Sequencer with PI chips (Thermo Fisher Scientific). NIL22h and NIL22v are sister lines and were considered as biological replicates as were NILs 22i and 22w.

Two replicated sets of RNA-seq data were combined for analysis to increase the sequencing depth. The sequences of F. graminearum were removed from the raw sequencing reads using an in-house Perl script. The adaptors were removed from the reads using Cutadapt40. The low-quality sequences of reads were trimmed using Fastx-toolkit41. After trimming and quality control, GSNAP42 was used to align the reads to the draft sequence of Chinese Spring that was constructed from the chromosome-sorted survey sequence concatenated using poly(N) fragments43. Reads that mapped to multiple positions were filtered out using an in-house Perl script. The Cufflinks v.2.2.1 package44 was used to assemble transcripts and identify differentially expressed genes. The differentially expressed genes were BLAST searched against the Chinese Spring 3B reference sequence (http://plants.ensembl.org/Triticum_aestivum/Info/Index) and contig Ctg0954b to determine whether the genes were in the Fhb1 region.

Analysis of candidate gene expression. The RNA was treated with RNase-free DNase I (Invitrogen). The first-strand cDNA was synthesized using the Superscript II Reverse Transcriptase kit (Invitrogen). The primers used to amplify the first-strand cDNA of all Fhb1 candidate genes were designed on the basis of the contig Ctg0954b sequences of Chinese Spring and CM-82036 (ref. 21) (Supplementary Table 1). Quantitative real-time PCR was performed on an ABI7900HT instrument using SYBR Green (Thermo Fisher Scientific). The actin gene was used as an internal control. Gene expression level was analyzed using the ∆∆Ct cycle threshold method in RQ study software (Thermo Fisher Scientific).

Gene transformation. All constructs were simultaneously bombarded with the pAHC20 construct into the cultured immature embryo of the wheat cultivar Bobwhite as described45. The vector pAHC20 (ref. 46) contained the bar gene under the control of the ubiquitin promoter for selection. Wheat transformation was performed through biolistic particle delivery. Tissue culture medium and methods of selection and culture were as described47. Six bombardments were performed for each construct using 160 embryos per bombardment. In brief, embryos were excised from immature seeds 10–14 d after anthesis and placed on callus introduction medium CM4 for 4–7 d in the dark at room temperature. Somatic embryos selected for bombardment were placed in fresh medium and simultaneously bombarded with pAHC20 and the transgene constructs at a 1:1 ratio through a particle inflow gun. Wheat calli were placed on CM4 medium containing glufosinate for selection after 5 d. After three transfers to new CM4 medium containing glufosinate, the growing calli were transferred to a shoot-production medium (MSP) and then to an elongation and rooting medium (MSE) with selection by glufosinate at all times. Putative T0 transgenic plants were transferred to soil and tested for glufosinate resistance by brushing a 0.2% (vol/vol) Liberty (glufosinate) solution on leaves (AgroEvo USA). DNA was isolated from the putatively glufosinate-resistant plants that showed no necrosis after 5 d of Liberty application. Transgenic plants were analyzed by PCR for the presence of the target inserts using corresponding primers for different experiments (Supplementary Table 1). The transgenic plants (T1 and T2) with target fragments of TaHRC were selected for FHB phenotyping. About 30 spikes were inoculated, and mean PSS values in transgenic lines and controls were compared.

Overexpression and RNA interference of TaHRC-S. All primers used for transformation (Supplementary Table 1) were designed using Primer Premier 6.0 (Premier Biosoft International). For overexpression of TaHRC-R, a predicted 825-bp ORF that was common to all four transcript isoforms of TaHRC-R from NIL-R was cloned into pAHC17. A vector containing the 825-bp ORF with the maize ubiquitin (Ubi) promoter was constructed using the BamHI restriction site for transformation (Supplementary Fig. 5a). Sanger sequencing was used to determine the sequences and orientation of the insertions. The TaHRC-R overexpression vector (pAHC17-TaHRC-R) and pAHC20 carrying the bar gene as a selection marker were simultaneously transformed into FHB-susceptible wheat cultivar Bobwhite. After screening for glufosinate resistance, the positive transgenic events with the target construct were selected through PCR and sequencing analysis using DNA from T0 leaves. Gene expression was analyzed for the selected T1 plants using spikes infected for 48 h. The plants with significantly higher levels of TaHRC expression were selected for FHB phenotyping.

For RNAi constructs, nucleotides CACC were added to the 5′ end of both forward primers for directional cloning of the PCR fragments into the entry vector pENTER-D/TOPO (Invitrogen). Construct RNAi-F was made from a 428-bp fragment that corresponds to nucleotides 33–460 in the ORF of TaHRC and

construct RNAi-R contains a 407-bp fragment that corresponds to nucleotides 212–618 in the ORF (Supplementary Fig. 5b). Both fragments were independently cloned into the pANDA-mini vector48 by homologous recombination using LR Clonase (Invitrogen). In each final RNAi construct, two identical TaHRC fragments were inserted on both sides of the 920-bp GUS linker in antisense and sense orientation (Supplementary Fig. 5b). The plasmids containing the constructs were transformed into TOP10 competent Escherichia coli cells (Invitrogen) and purified using an E.Z.N.A. Plasmid Mini Kit (Omega Bio-Tek).

CRISPR–Cas9 gene editing. Plant-codon-optimized Streptococcus pyogenes Cas9 and single guide RNA (sgRNA) were synthesized by Genscript. The plasmid pAHC17 with the maize ubiquitin 1 promoter was used to construct the Cas9 expression vector by BamHI restriction site. The wheat U6 promoters with wheat sgRNA were cloned into pUC57 vectors (Genscript) to generate the AtU6sgRNA plasmid. A 20-bp target sequence (GCGACAGTGATCGGAAACAC) located 197–216 bp downstream of the start codon was selected as the target sequence for gene editing (Supplementary Fig. 5c). Biolistic transformation was performed by simultaneous bombardment of the cultured immature wheat embryo with pAHC17-Cas9, pAHC20 and corresponding AtU6sgRNA in a 1:1:1 molar ratio. Plant regeneration and selection processes are described above. The transgenic plants were then analyzed by PCR for the presence of Cas9 using primers Tacas921F and Tacas2570R. The sgRNAs were identified with TaU6F primers and corresponding sgRNA reverse primers, separately. Transgenic plants with both Cas9 and sgRNA were selected and the full-length TaHRC gene was amplified from plants for sequencing.

Subcellular localization of TaHRC. To determine the subcellular localization of TaHRC, 35S::GFP–TaHRC expression vector was constructed by fusing the coding sequence of TaHRC-S from Bobwhite to a GFP coding sequence. The resultant construct was introduced into wheat protoplasts of leaf and onion epidermal cells. The nuclei in transformed cells were stained with DAPI (5 mg ml−1 in PBS) and then examined using an LSM 510 META confocal microscope (Zeiss). Isolation and transfection of wheat leaf protoplasts were performed as described49.

Reporting Summary. Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availabilityRNA-seq data are available from the NCBI Sequence Read Archive under accession PRJNA515933. Additional data generated or analyzed during this study are included in this article and its supplementary information files.

references 38. Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using

maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739 (2011).

39. Bai, G. H., Shaner, G. & Ohm, H. Inheritance of resistance to Fusarium graminearum in wheat. Theor. Appl. Genet. 100, 1–8 (2000).

40. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17, 10–12 (2011).

41. Pearson, W. R., Wood, T., Zhang, Z. & Miller, W. Comparison of DNA sequences with protein sequences. Genomics 46, 24–36 (1997).

42. Wu, T. D. & Watanabe, C. K. GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 21, 1859–1875 (2005).

43. International Wheat Genome Sequencing Consortium (IWGSC). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 345, 1251788 (2014).

44. Trapnell, C. et al. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515 (2010).

45. Miki, D. & Shimamoto, K. Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol. 45, 490–495 (2004).

46. Cruz, L. F., Rupp, J. L. S., Trick, H. N. & Fellers, J. P. Stable resistance to wheat streak mosaic virus in wheat mediated by RNAi. In Vitro Cell. Dev. Biol. Plant 50, 665–672 (2014).

47. Christensen, A. H. & Quail, P. H. Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Trans. Res. 5, 213–218 (1996).

48. Anand, A., Trick, H. N., Gill, B. S. & Muthukrishnan, S. Stable transgene expression and random gene silencing in wheat. Plant Biotechnol. J. 1, 241–251 (2003).

49. Zhai, Z., Sooksa-nguan, T. & Vatamaniuk, O. K. Establishing RNA interference as a reverse-genetic approach for gene functional analysis in protoplasts. Plant Physiol. 149, 642–652 (2009).

NATure GeNeTiCS | www.nature.com/naturegenetics

1

nature research | reporting summ

aryO

ctober 2018

Corresponding author(s): Guihua Bai

Last updated by author(s): 01-07-2019

Reporting SummaryNature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Research policies, see Authors & Referees and the Editorial Policy Checklist.

StatisticsFor all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section.

n/a Confirmed

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement

A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly

The statistical test(s) used AND whether they are one- or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section.

A description of all covariates tested

A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons

A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted Give P values as exact values whenever suitable.

For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings

For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes

Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated

Our web collection on statistics for biologists contains articles on many of the points above.

Software and codePolicy information about availability of computer code

Data collection No software used for data collection

Data analysis No special software was used for data analysis in this study. All open sources software used in this study were described in the Methods.

For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

DataPolicy information about availability of data

All manuscripts must include a data availability statement. This statement should provide the following information, where applicable: - Accession codes, unique identifiers, or web links for publicly available datasets - A list of figures that have associated raw data - A description of any restrictions on data availability

A data availability statement is included in the manuscript: "RNA-seq data were available through NCBI under SRA accession PRJNA515933. Additional data generated or analyzed during this study are included in this article and its supplementary information files."

Field-specific reportingPlease select the one below that is the best fit for your research. If you are not sure, read the appropriate sections before making your selection.

Life sciences Behavioural & social sciences Ecological, evolutionary & environmental sciences

2

nature research | reporting summ

aryO

ctober 2018For a reference copy of the document with all sections, see nature.com/documents/nr-reporting-summary-flat.pdf

Life sciences study designAll studies must disclose on these points even when the disclosure is negative.

Sample size For recombinant screening, we screen more 13000 plant samples until we could not get any new recombinant after significant increase of samples. For FHB test, we tested at least 5 plants per replication using at least two replications (most time use three replications) in each experiment. The experiment was repeated twice. This is a standard sample size for FHB evaluation. For specific experiment, sample size is either described in Methods section or in Figure legend.

Data exclusions No data were excluded in this study

Replication All experiments were replicated and replication information for each experiment were included in methods or Figure captions

Randomization For FHB phenotyping experiments, all experiments were conducted using a randomized complete block design.

Blinding Blinding is not necessary for this type of experiments. However, when we conducted experiments, we usually labeled plants with numbers during experiments and identify their ID after data analysis done.

Reporting for specific materials, systems and methodsWe require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material, system or method listed is relevant to your study. If you are not sure if a list item applies to your research, read the appropriate section before selecting a response.

Materials & experimental systemsn/a Involved in the study

Antibodies

Eukaryotic cell lines

Palaeontology

Animals and other organisms

Human research participants

Clinical data

Methodsn/a Involved in the study

ChIP-seq

Flow cytometry

MRI-based neuroimaging