Available online at www.sciencedirect.com

www.elsevier.com/locate/ijpara

International Journal for Parasitology 38 (2008) 725–730

Human fascioliasis and the presence of hybrid/introgressed formsof Fasciola hepatica and Fasciola gigantica in Vietnam

Thanh Hoa Le a, Nguyen Van De b, Takeshi Agatsuma c, Thanh Giang Thi Nguyen d,Quoc Doanh Nguyen d, Donald P. McManus e, David Blair f,*

a Department of Immunology, Institute of Biotechnology, Hanoi, Viet Namb Department of Parasitology, Hanoi Medical University, Viet Nam

c Department of Environmental Health Sciences, Kochi Medical School, Kochi, Japand National Institute of Veterinary Research, Hanoi, Viet Nam

e Queensland Institute of Medical Research, Brisbane, Qld 4006, Australiaf School of Marine and Tropical Biology, James Cook University, Townsville, Qld 4811, Australia

Received 19 June 2007; received in revised form 1 October 2007; accepted 2 October 2007

Abstract

The two species common of liver fluke, Fasciola hepatica and Fasciola gigantica, cause human fascioliasis. Hybrids between these spe-cies, and introgressed forms of Fasciola, are known from temperate and subtropical regions of eastern Asia. Here, we report the presenceof hybrid and/or introgressed liver flukes in Vietnam where it has recently been recognised that human fascioliasis is an important zoo-notic disease. Specimens examined came from domestic stock (cattle and buffalo) at slaughter and also from human patients. DNAsequences were obtained from the nuclear ribosomal second internal transcribed spacer (ITS-2) and from portions of two mitochondrialprotein-coding genes. Mitochondrial sequences in every case were similar to those of Fasciola gigantica. Nuclear ITS-2 sequencesbelonged to one or other of the Fasciola species, or, sequences from both were found in the same individual worm. This study extendsthe known range of hybrids or introgressed forms of Fasciola into tropical regions of Asia.� 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Fasciola gigantica; Fasciola hepatica; Hybridisation; Internal transcribed spacer region; Introgression; Vietnam

1. Introduction

The commonest and most widespread liver flukes of thegenus Fasciola are Fasciola hepatica Linnaeus, 1758 (mostlyin temperate regions) and Fasciola gigantica Cobbold, 1856(mostly tropical in distribution). Adults of both species occurin many domestic ruminants and in humans (Mas-Comaet al., 2005; Le et al., 2007) and can cause serious disease.The two liver fluke species appear to be sympatric in manysubtropical and warm temperate areas, especially in Africaand Asia (Le et al., 2007). They can generally be distin-guished on the basis of their morphology (e.g. Ashrafi

0020-7519/$34.00 � 2007 Australian Society for Parasitology Inc. Published b

doi:10.1016/j.ijpara.2007.10.003

* Corresponding author. Tel.: +61 7 4781 4322; fax: +61 7 4725 1570.E-mail address: david.blair@jcu.edu.au (D. Blair).

et al., 2006), but the existence of individuals with intermedi-ate morphological characteristics can cause confusion (e.g.Terasaki et al., 1982; Itagaki et al., 2005a) and has led tothe increasing use of molecular methods (e.g. Marcillaet al., 2002) or morphometric methods (e.g. Ashrafi et al.,2006) to distinguish between the species. It is desirable toknow which species is the agent of human or animal diseasein a given area. The two species differ in pathological and epi-demiological characteristics (Mas-Coma et al., 2005).

Difficulties in specific identification have been mostintensively studied in Japan and adjacent areas. Researchthere has revealed not only a confusing range of morpho-logical forms but also the presence of worms of differentploidies (diploid, triploid and ‘‘mixoploid’’), all of whichare parthenogenetic and do not produce normal sperm(Terasaki et al., 1982, 2000). Genetic studies on Japanese

y Elsevier Ltd. All rights reserved.

726 T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

and Korean worm populations have detected individualsthat have both nuclear and mitochondrial sequences typi-cal of F. hepatica and others that appear on the samegrounds to be F. gigantica. Individuals also occur thatresemble one species in their nuclear DNA (usually assayedusing ribosomal RNA gene or spacer sequences) but have amitochondrial genotype typical of the other species (Agat-suma et al., 2000; Itagaki et al., 2005a,b). Individuals havealso been found that have, in their tandem array of nuclearribosomal genes, copies of genes apparently derived fromboth liver fluke species (Agatsuma et al., 2000 in Korea;Huang et al., 2004 in north eastern China; Itagaki et al.,2005a,b in Japan and Korea; Lin et al., 2007 in China).An obvious conclusion is that hybridisation and introgres-sion (definitions in Dowling and Secor, 1997) are commonin Fasciola populations in this part of Asia, processes thatcan lead to production of polyploid and parthenogeneticindividuals (Dowling and Secor, 1997). Such individualsare often aspermic. There have been no convincing demon-strations of hybrid/introgressed liver fluke populations out-side Asia, although aspermic triploid individuals of ‘‘pure’’F. hepatica are now known from Britain (Fletcher et al.,2004). Examples of triploid Fasciola sp. are also knownfrom Assam and Hawaii (reviewed in Terasaki et al.,2000) and Vietnam (Itagaki et al., 2005a). In addition toJapan and Korea, aspermic Fasciola spp. of unknownploidy are present (but generally uncommon) in the Philip-pines, Vietnam, Thailand, Taiwan, India, Nepal andHawaii (Terasaki et al., 1982).

In Vietnam, fascioliasis (caused by morphologicallyidentified F. gigantica) is very common in cattle and waterbuffaloes, with prevalences of more than 50% in the RedRiver and Mekong deltas, as well as in other coastalregions (Bui et al., 2003). In recent years, an extraordinarynumber of human cases of fascioliasis has been reported, tosuch an extent that this zoonotic infection has become amajor public health concern in Vietnam. More than 500human cases were recorded in the three years from 1997to 2000 based on serological tests (Tran et al., 2001). Priorto 1991, fascioliasis had been regarded as rare in Vietnam.For example, only two cases were reported in 1978 (Tranet al., 2001). Unusual cases of cutaneous fascioliasis havealso been described (e.g. Xuan et al., 2005; Le et al.,2007). Morphologically, the adult flukes found in animalsand human patients in Vietnam fall into two categories,one typical of F. gigantica and the other closely resemblingF. hepatica. Here we report data indicating that hybrid/int-rogressed populations of Fasciola occur in Vietnam andthat these are implicated in human infection.

2. Materials and methods

2.1. Sources of Fasciola specimens

Parasite material and nucleotide sequences of Fasciola

species, their host and geographical origin used in thisstudy are listed in Table 1.

Adult worms of Fasciola sp. of Vietnamese origin, col-lected during 2001–2005 from human patients and animals(cattle and buffaloes), were preserved in 70% ethanol andkept at �20 �C until used for extraction of DNA. Of 21Vietnamese samples, 12 were of human origin, of whichtwo (FspN-VN and FspQB-VN) were from the casesinvolving unusual cutaneous migration of worms reportedin Le et al. (2007). Specimens from eight human cases wereobtained surgically. In two further cases, eggs morpholog-ically identified as being of a Fasciola sp. were recoveredfrom faeces of human patients serologically positive forfascioliasis. These eggs were allowed to develop and hatchin water (1–2 weeks) and 10–20 miracidia from each patientwere collected for subsequent DNA extraction.

2.2. Genetic markers

Genetic markers including mitochondrial genes (cox1,

nad1) and the nuclear second internal ribosomal spacer(ITS-2) sequences were obtained. ITS-2 is a useful markerfor distinguishing between F. gigantica and F. hepatica. Itis rather conserved, especially in F. hepatica. There areseven sites at which the two species typically differ. Oneof these is a deletion in F. gigantica relative to F. hepatica

that appears to be a diagnostic difference between the spe-cies (e.g. Adlard et al., 1993; Semyenova et al., 2005). Thereis some variability, especially in F. gigantica, that can beconfusing (Le et al., 2007). Sequence data from mitochon-drial genes are more variable than is the case for ITS-2, butalso provide unambiguous recognition of the two species(Le et al., 2007).

2.3. DNA extraction, PCR and sequencing

Total genomic DNA was extracted from adult wormsand miracidia using the commercial QIAamp DNA extrac-tion kit (QIAGEN Inc.) according to the manufacturer’sinstructions. In the case of adult worms, only a single spec-imen was used in each DNA extraction. Genomic DNAwas diluted to a working concentration of 50 ng/lL and2 lL of this was used as template in a PCR reaction of50 lL.

PCR was used to amplify the entire nuclear ITS-2 andtwo mitochondrial genetic markers (a portion of each ofcox1 and nad1). Primers 3SF (forward) (5 0GGTACCGGTGGATCACTCGGCTCGTG3 0) and BD2R (reverse)(5 0TATGCTTAAATTCAGCGGGT3 0) were used foramplification of ITS-2; JB3F (forward) (5 0TTTTTTGGGCATCCTGAGGTTTAT3 0) and JB4.5R (reverse)(5 0TAAAGAAAGAACATAATGAAAATG3 0) for cox1

as previously published (Bowles and McManus, 1993;Bowles et al., 1995). Primers FND1F (forward) (5 0TGGGGTCTGTTGCAGAGATTTGC3 0) and FND1R(reverse) (5 0ATCCAATGGAGTACGGTTACA3 0) fornad1 were designed for use in this study.

PCR amplification was carried out in a final volume of50 lL, including 100 ng template, 10 pmol of each primer

Table 1List of Fasciola specimens and sequences used in this study, their host and geographical origins

Species Country Code of samples DNA Extracted from Host Markers used Genbank no/Refs

cox1 nad1 ITS-2

F. sp G Vietnam FspBD-VN Adult Humanp p p

EU260063F. sp G Vietnam FspPY-VN Adult Cattle

p p pEU260074

F. spa H Vietnam FspH1-VN Adult Humanp p p

EU260068F. spa H Vietnam FspH2-VN Adult Human

p p pEU260069

F. spa H Vietnam FspCB1-VN Adult Cattlep p p

EU260064F. spa H Vietnam FspFG1-VN Adult Human

p p pEU260066

F. spa H Vietnam FspFG2-VN Adult Humanp p p

EU260067F. spa H Vietnam FspNA-VN Adult Cattle

p p pEU260071

F. sp G Vietnam FspTH-VN Adult Cattlep p p

EU260076F. spb H Vietnam Fsp1-VN Adult Human

p p pEU260059

F. spb H Vietnam Fsp2-VN Adult Humanp p p

EU260060F. sp G Vietnam FspB3-VN Adult Cattle

p p pEU260061

F. sp G Vietnam FspBDB-VN Adult Cattlep p p

EU260057F. sp ? Vietnam FspM-VN miracidia Human

p p pEU260070

F. sp G Vietnam FspNB-VN Adult Cattlep p p

EU260072F. sp G Vietnam FspT4-VN Adult Buffalo

p p pEU260075

F. sp ? Vietnam FspX-VN miracidia Humanp p p

EU260077F. spa H Vietnam FspBD1-VN Adult Human

p p pEU260062

F. spa H Vietnam FspCB2-VN Adult Buffalop p p

EU260065F. spa H Vietnam FspN-VN Adult Humand p p p

EU260073F. sp H Vietnam FspQB-VN Adult Humand p p p

EU260078F. hepatica Australia Fh-AU Adult Cattle

p p pEU260058

F. hepatica Uruguay Fh-UR Adult N/Ap p p

AB010974F. hepatica Spain FhCa-SP N/A Cattle

pAJ272053

F. hepatica France Fh-FR Adult Cattlep

AJ557567F. hepatica China Fh(Si)-CN Adult N/A

pAJ557568

F. hepatica Ireland Fh-IR Adult N/Ap

AB207148F. hepatica C. Asia FhSemyenovaH1 Adult N/A

pSemyenova et al., 2005

F. hepatica Armenia FhSemyenovaH2 Adult N/Ap

Semyenova et al., 2005F. hepatica Austria Fh_AT N/A N/A

pDQ683546

F. gigantica C. Asia FgSemyenovaG5, G6, G7, G8 Adult N/Ap

Semyenova et al., 2005F. gigantica Indonesia Fg(IndoA)-ID Adult N/A

p p p c

F. gigantica Indonesia Fg-ID Adult N/Ap p p

EU260080F. gigantica China Fg(GxB10)-CN Adult Buffalo

p p pEU260079

F. gigantica China Fg(Gx)-CN Adult Buffalop

AJ557569F. gigantica Indonesia Fg(IndoT)-ID Adult Cattle

pAB010977

F. gigantica Thailand Fg-TL Adult Cattlep

AB207149F. gigantica Burkina Faso Fg(Bobo)-BF Adult Cattle

pAJ853848

F. gigantica Zambia FgZamI-ZA Adult N/Ap

AB010975F. gigantica Zambia FgZamII-ZA Adult N/A

pAB010976

F. sp China Fsp(He1)-CN Adult Sheepp

AJ557570F. sp China Fsp(He2)-CN Adult Sheep

pAJ557571

F. sp Japan FspI-JP Adult N/Ap

AB010978F. sp Japan FspII-JP Adult N/A

pAB010979

F. sp Japan FspKochi1-JP Adult Cattlep

AB207152F. sp Japan FspSaita-JP Adult Cattle

pAB207151

F. spa Japan FspHokai-JP Adult Cattlep

AB207150F. spa Korea Fsp(Kor2)-KR Adult N/A

p p p c

F. sp Korea Fsp(Kor4)-KR Adult N/Ap p p c

F. sp Korea Fsp(Kor5)-KR Adult N/Ap p p c

F. sp Japan FspKochi2-JP Adult N/Ap p p c

N/A: not available.a Indicates apparent hybrid/ introgressed specimens (see text).b Indicates two worms known to have ITS-2 sequences of both Fasciola hepatica and Fasciola gigantica type. For Vietnamese worms, G = F. gigantica –

like and H = F. hepatica - like.c Indicates data from Agatsuma et al. (2000).d Indicates specimens that had undertaken cutaneous migration in humans as reported in Le et al. (2007).

T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730 727

and a mix of the remaining PCR components (PCR MasterMix from Promega). The PCR reactions were carried outin a MJ Thermal Cycler PTC-100 (MJ Research, USA)

for cox1 with initiation at 94 �C for 5 min, then 35 cyclesincluding denaturation at 94 �C for 1 min, annealing at37 �C for 1 min, extension at 72 �C for 2 min. For ITS-2

728 T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

and nad1 the above conditions were used, except thatannealing was at 50 �C for 1 min. Finally, all reactions wereheld for 10 min at 72 �C to complete the amplification.

The PCR products were purified using QIAquick Purifi-cation kit (QIAGEN). PCR products were initially sub-jected to direct sequencing using the PCR primers assequencing primers. However, when traces with ambigui-ties were obtained (ITS-2), PCR products were clonedusing a TA cloning kit (Invitrogen, USA) and recombinantplasmid DNAs subjected to sequencing using Big Dye Ter-minator Cycle Sequencing technology on an automatedsequencer (ABI 3100 Avant Genetic Analyzer) using M13forward and reverse primers.

2.4. Data analysis and phylogenetic construction

The sequences were edited in SeqEd v 1.03, alignedusing AssemblyLIGN v 1.9c and analysed using the Mac-Vector 8.2 package (Accelrys) in a Macintosh computersystem. Specific identification was confirmed by compari-son with known sequences of the corresponding speciesin GenBank or by reference to our previous published dataLe et al., 2001; Le and Nguyen, 2002.

The multiple alignment of sequences was performedusing GeneDoc v2.5 (Nicholas and Nicholas, 1997. Gene-Doc: A tool for editing and annotating multiple sequencealignment. Distributed by author) and/or ClustalW incor-porated into the MacVector 8.2 package. Modeltest v3.7(Posada and Crandall, 1998) was used to find the best sub-stitution model. This model (HKY+G) was then specifiedfor likelihood analyses in PAUP* v4.0b10 (Swofford, D.L. 2000. PAUP*. Phylogenetic Analysis Using Parsimony(*and Other Methods). Version 4. Sinauer Associates, Sun-derland, Massachusetts). PaupUP graphical interface (Cal-endini, F., Martin J.-F. 2005. PaupUP v1.0.3.1 A freegraphical frontend for PAUP* Dos software. Availablefrom http://www.agro-montpellier.fr/sppe/Recherche/JFM/PaupUp/main.htm) was used to facilitate workingwith PAUP*. The dataset was resampled 100 times usingthe bootstrap method. Phylogenetic analyses are presentedonly for the nuclear ITS-2 sequences. Outgroups(sequences from Fascioloides magna DQ683545 and Fasci-

olopsis buski DQ341852) were used in some analyses toconfirm monophyly of each Fasciola species.

As far as possible, all available published ITS-2, cox1

and nad1 sequences have been included. Some sequenceshave been omitted – this is especially so for ITS-2 in whichthere are relatively few variable sites. Sequences withambiguous sites or incomplete sequences can bias the treedramatically. Available ITS-2 sequences not used were:AB207153 (Hiroshima and Kagoshima, Japan), whichincludes several ambiguous sites reflecting the fact thatITS-2 sequences of both Fasciola species are present (Itag-aki et al., 2005a); AB259058 (Kyoto, Japan), which isincomplete; L07844, one of the earliest reported sequencesof F. hepatica, which has possible sequencing errors at the3 0 end, and DQ383512 from Egyptian F. gigantica and

which has many probable errors near the 5 0 end. Sequencesreported by Adlard et al. (1993) (F. gigantica from Indone-sia and Malaysia; F. hepatica from Australia, New Zea-land, Hungary and Mexico; Fasciola sp. from Japan) areshorter than those presented here and have not beenincluded. Their inclusion would not have altered the con-clusions reached. All ITS-2 sequences reported by Huanget al. (2004; AJ557567- AJ557571) include a pair of sitesnear the 3 0 end that are inverted relative to all other avail-able sequences. However, Prof. Zhu Xing-Quan (personalcommunication), one of the authors of that paper, has con-firmed that this inversion is a sequencing error: theirsequences have been corrected as used in this paper (notethat Alasaad et al. (2007), have used the uncorrectedsequences). Sequences for some haplotypes from Turkmen-istan and adjacent regions of West and Central Asiareported by Semyenova et al. (2005) have been recon-structed from information in that paper: none was avail-able from any database. Immediately prior to submissionof this paper, a further sequence of F. gigantica, fromMeghalaya, India, appeared in the public databases. Thisis EF027103, identical in sequence to the Indonesian refer-ence sequence of F. gigantica mentioned below. Sequencesof F. hepatica from Bolivia (Mas-Coma et al., 2001) areidentical to those from Spain.

For reference, F. gigantica from Indonesia (Fg_ID) andF. hepatica from Australia and Europe (Fh_AU) areregarded as representing genetically pure forms of eachspecies that have not experienced introgression or hybrid-isation (Agatsuma et al., 2000) (indicated by arrows onFig. 1).

3. Results

Excluding flanking regions in the 5.8S and 28S genes,the length of the ITS-2 alignment was 362 bp. For the mito-chondrial markers, partial sequences were obtained fromcox1 (423 bp) and nad1 (435 bp).

The main purpose of the phylogenetic analyses was tocompare species-of-origin of nuclear and mitochondrialsequences in a number of individual worms from Vietnamand elsewhere. This is easily done by presenting a treebased on one marker on which can be indicated, for eachindividual, species-of-origin of the other marker(s). Herewe present only the tree of the ITS-2 sequences (Fig. 1).Given the small number of differences between the speciesin the ITS-2 region, and the slight variation within eachspecies, it is not surprising that bootstrap values are ratherlow. However, the two species are clearly distinguished(and remain so in analyses using other fasciolids as out-groups). It is immediately apparent that the Vietnameseworms fall readily into the F. gigantica or the F. hepatica

cluster based on ITS-2 data. However, all Vietnameseworms had mitochondrial sequences (both cox1 andnad1) typical of F. gigantica only. Mitochondrial genomesin animals are maternally inherited. Our data thus demon-strate that hybridisation or introgression has occurred

Fig. 1. Tree inferred from ITS-2 sequences. Specimen codes are those usedin Table 1. GenBank accession numbers are included where available.Sequences from human cases are shown in bold-italic type. Arrows pointto reference sequences from ‘‘pure’’ Fasciola gigantica or Fasciola hepatica.With the few exceptions discussed in the text, sequences fall into twogroups corresponding to F. gigantica and F. hepatica. Sequences arelabeled according to the species name or code given to them in the relevantoriginal publications: Fg = F. gigantica, Fh = F. hepatica and Fsp forthose not assigned to a species. Specimens from Vietnam are indicated bythe letters ‘‘VN’’ after the specimen code. Other country codes: AR,Armenia; AT, Austria; AU, Australia; BF, Burkina Faso; BV, Bolivia;CA, Turkmenistan and adjacent regions of Central Asia; CN, China; FR,France; ID, Indonesia; IN, India; IR, Ireland; JP, Japan; Kr, Korea; RU,Russia, and neighbouring countries; SP, Spain; TL, Thailand; UR,Uruguay; ZA, Zambia. Specimens known to have F. gigantica-likemitochondrial sequences (this study or from the literature) are indicatedby *. Similarly, specimens with F. hepatica-like mitochondrial sequencesare indicated with # after the specimen code. Neither symbol appears ifmitochondrial data are not available for that individual. The twosequences marked with � came from the same worm specimen in northeastern China (Huang et al., 2004). The symbol � indicates worms fromVietnam for which direct-sequencing traces indicated the presence of bothF. hepatica and F. gigantica ITS-2 sequences. Clean sequence for only onetype of ITS-2 was subsequently obtained from cloned PCR products,which is why the worms are included in only one clade. Bootstrap values(as percentage support for each branch) are shown.

T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730 729

involving the two Fasciola species and that F. gigantica wasthe maternal parent in each case.

Direct sequencing of PCR products from some of theVietnamese worms yielded traces with ambiguities indicat-ing the presence of both F. hepatica and F. gigantica ITS-2sequences (data not shown). Clean sequence for only onetype of ITS-2 was subsequently obtained from clonedPCR products, which is why each of these worms isincluded in only one clade in Fig. 1.

All ITS-2 sequences (except one) from populations ofeither species that, because of their geographical origins,

had probably not experienced introgression/hybridisation,were placed where expected on the tree (Fig. 1). However,for many of these worms, ITS-2 only was available andnothing was known about their mitochondrial genome.The exceptional sequence was from a specimen of F. gigan-

tica from Zambia (AB010975). This sequence had the sin-gle-base deletion characteristic of F. gigantica, but atmost other variable sites it possessed the base typical ofF. hepatica. We are uncertain how to interpret this.

Individual worms from human patients were distributedin both clades of the tree (Fig. 1).

4. Discussion

It is clear that hybridisation and/or introgression hasoccurred in Vietnam involving both of the common speciesof Fasciola. In every case in that country, the mitochon-drial genome was typical of F. gigantica, whereas thenuclear genome could be from either species. Distinguish-ing between hybridisation and introgression requires moredata than we have available. We regard hybrids as the F1

offspring of a mating between the two species. In such acase, all offspring will carry the mitochondrial genome ofthe maternal parent. However, their nuclear ribosomalRNA cluster will contain copies from both parents.Back-crossing of hybrids and of subsequent generationswith one parent species (=introgression) should homoge-nise the ribosomal array so that sequences of the other spe-cies will eventually disappear. However, the non-recombining nature of the mitochondrial genome meansthat it will be passed on largely unchanged from generationto generation. If back-crossing of hybrids is with the pater-nal species, then the mitochondrial genome of the maternalspecies will introgress into the paternal species (reviewed inBlair, 2005). All this assumes that the organisms involvedreproduce sexually and undergo normal meiosis. For manyeastern Asian populations of Fasciola species, this assump-tion seems to be false. If hybrids are parthenogenetic, thenworms should carry ribosomal repeats from both parents,as well as the mitochondrial genome of the maternal par-ent, for as many generations as the clonal lineage persists.We do not yet know the ploidy of any of the Vietnameseworms, nor do we know if any are parthenogenetic. How-ever, in at least some cases, individual worms carried ribo-somal sequences from both parent species, suggestingeither that they were F1 hybrids, had undergone recentintrogression, or that these worms were from parthenoge-netic lineages of unknown age.

Not all human infections are due to hybrid/introgressedworms. Some were apparently due to ‘‘pure’’ F. gigantica

infection. In addition, worms from human patients werescattered in both clades in the tree (Fig. 1), suggesting thatmultiple genotypes of Fasciola in Vietnam are capable ofinfecting humans. We have no information on whetherthe mixing of genetic material of the two Fasciola speciesin Vietnam is a recent phenomenon. Nor do we know if‘‘pure’’ F. hepatica is present in the country.

730 T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

In conclusion, we have demonstrated the presence inVietnam of hybrid and/or introgressed populations of liverflukes bearing genetic material from both F. hepatica andF. gigantica. Some of these worms were from humanpatients. This appears to be the first demonstration froma tropical country of the presence of liver flukes containinggenetic material from both common species of Fasciola.

Acknowledgments

This investigation received financial support from IC-GEB (Project No. CRP/VIE05-02 awarded to ThanhHoa Le) and the Wellcome Trust (Grant No. 068762awarded to Le, McManus and Blair). We thank our collab-orators for their kind provision of materials used in thisstudy and staff in Dr Le’s Laboratory (Institute of Biotech-nology, Hanoi, Vietnam) for their laboratory work.

References

Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison ofthe second internal transcribed spacer (Ribosomal DNA) frompopulations and species of Fasciolidae (Digenea). Int. J. Parasitol.23, 423–425.

Agatsuma, T., Arakawa, Y., Iwagami, M., Honzako, Y., Cahyaningsih,U., Kang, S.Y., Hong, S.J., 2000. Molecular evidence of naturalhybridization between Fasciola hepatica and F. gigantica. Parasitol.Int. 49, 231–238.

Alasaad, S., Huang, C.Q., Li, Q.Y., Granados, J.E., Garcıa-Romero, C.,Perez, J.M., Zhu, X.Q., 2007. Characterization of Fasciola samplesfrom different host species and geographical localities in Spain bysequences of internal transcribed spacers of rDNA. Parasitol. Res. 101,1245–1250.

Ashrafi, K., Valero, M.A., Panova, M., Periago, M.V., Massoud, J., Mas-Coma, S., 2006. Phenotypic analysis of adults of Fasciola hepatica,Fasciola gigantica and intermediate forms from the endemic region ofGilan, Iran. Parasitol. Int. 55, 249–260.

Blair, D., 2005. Ribosomal DNA variation in parasitic flatworms. In:Maule, A.G., Marks, N.J. (Eds.), Parasitic Flatworms: MolecularBiology, Biochemistry, Immunology and Control. CABI, Wallingford,Oxfordshire, pp. 96–123.

Bowles, J., Blair, D., McManus, D.P., 1995. A molecular phylogeny of thehuman schistosomes. Mol. Phylogenet. Evol. 4, 103–109.

Bowles, J., McManus, D.P., 1993. Rapid discrimination of Echinococcus

species and strains using a PCR-based RFLP method. Mol. Biochem.Parasitol. 57, 231–239.

Bui, K.L., Do, T.T., Le, N.M., Osamu, S., Shinobu, Y., 2003. Applicationof agar gel diffusion test to the diagnosis of fasciolosis in cattle andbuffaloes in the Red River delta in Vietnam. Jpn. Ag. Res. Quart. 37,201–205.

Dowling, T.E., Secor, C.L., 1997. The role of hybridization andintrogression in the diversification of animals. Ann. Rev. Ecol. Syst.28, 593–620.

Fletcher, H.L., Hoey, E.M., Orr, N., Trudgett, A., Fairweather, I.,Robinson, M.W., 2004. The occurrence and significance of triploidy inthe liver fluke, Fasciola hepatica. Parasitology 128, 69–72.

Huang, W.Y., He, B., Wang, C.R., Zhu, X.Q., 2004. Characterisation ofFasciola species from mainland China by ITS-2 ribosomal DNAsequence. Vet. Parasitol. 120, 75–83.

Itagaki, T., Kikawa, M., Sakaguchi, K., Shimo, J., Terasaki, K.,Shibahara, T., Fukuda, K., 2005a. Genetic characterization ofparthenogenetic Fasciola sp. in Japan on the basis of the sequencesof ribosomal and mitochondrial DNA. Parasitology 131, 679–685.

Itagaki, T., Kikawa, M., Terasaki, K., Shibahara, T., Fukuda, K., 2005b.Molecular characterization of parthenogenic Fasciola sp. in Korea onthe basis of DNA sequences of ribosomal ITS1 and mitochondrialNDI gene. J. Vet. Med. Sci. 67, 1115–1118.

Le, T.H., Blair, D., McManus, D.P., 2001. Complete DNA sequence andgene organization of the mitochondrial genome of the liverfluke,Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology 123,609–621.

Le, T.H., De, N.V., Agatsuma, T., Blair, D., Vercruysse, J., Dorny, P.,Nguyen, T.G.T., McManus, D.P., 2007. Molecular confirmation thatFasciola gigantica can undertake aberrant migrations in human hosts.J. Clin. Microbiol. 45, 648–650.

Le, T.H., Nguyen, V.D., 2002. Molecular-based identification of Fasciola

gigantica in Vietnam using mitochondrial-encoded nad1 sequence asgenetic markers. J. Malaria Parasit. Dis. Control 3, 41–48.

Lin, R.Q., Dong, S.J., Nie, K., Wang, C.R., Song, H.Q., Li, A.X., Huang,W.Y., Zhu, X.Q., 2007. Sequence analysis of the first internaltranscribed spacer of rDNA supports the existence of the intermediateFasciola between F. hepatica and F. gigantica in mainland China.Parasitol. Res. 101, 813–818.

Marcilla, A., Bargues, M.D., Mas-Coma, S., 2002. A PCR-RFLP assayfor the distinction between Fasciola hepatica and Fasciola gigantica.Mol. Cell. Probes 16, 327–333.

Mas-Coma, S., Bargues, M.D., Valero, M.A., 2005. Fascioliasis and otherplant-borne trematode zoonoses. Int. J. Parasitol. 35, 1255–1278.

Mas-Coma, S., Funatsu, I.R., Bargues, M.D., 2001. Fasciola hepatica andlymnaeid snails occurring at very high altitude in South America.Parasitology 123, 115–127.

Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model ofDNA substitution. Bioinformatics 14, 817–818.

Semyenova, S.K., Morozova, E.V., Vasilyev, V.A., Gorokhov, V.V.,Moskvin, A.S., Movsessyan, S.O., Ryskov, A.P., 2005. Polymorphismof internal transcribed spacer 2 (ITS-2) sequences and geneticrelationships between Fasciola hepatica and F. gigantica. Acta Paras-itol. 50, 240–243.

Terasaki, K., Akahane, H., Habe, S., Moriyama, N., 1982. Thegeographical distribution of common liver flukes (the genus Fasciola)with normal and abnormal spermatogenesis. Jpn. J. Vet. Sci. 44, 223–231.

Terasaki, K., Noda, Y., Shibahara, T., Itagaki, T., 2000. Morphologicalcomparisons and hypotheses on the origin of polyploids in partheno-genetic Fasciola sp. J. Parasitol. 86, 724–729.

Tran, V.H., Tran, T.K., Nguyen, H.C., Pham, H.D., Pham, T.H., 2001.Fascioliasis in Vietnam. SE. Asian J. Trop. Med. Pub. Health 32(Suppl 2), 48–50.

Xuan, L.T., Hung, N.T., Waikagul, J., 2005. Cutaneous fascioliasis: a casereport in Vietnam. Am. J. Trop. Med. Hyg. 72, 508–509.