Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

1

How does salinity affect aerobic ammonia oxidizer abundance and diversity? Introduction

Microorganisms are capable of making a living in diverse ways. For instance, chemolithoautotrophic microbes utilize inorganic electron donors and acceptors to supply cellular energy. Perhaps the most environmentally ubiquitous chemolithoautotrophic metabolic pathway is ammonia oxidation to nitrite, coupled with nitrite oxidation to nitrate, together commonly referred to as nitrification (NH4

+ ⇒ NO2- ⇒ NO3

-). Ammonia oxidation to nitrite and nitrite oxidation to nitrate are separate steps performed by separate groups of organisms.

Ammonia oxidation (NH4+ + 1.5 O2 ⇒ NO2

= + H2O + 2H+) has been studied as an aerobic bacterial-mediated pathway for many years. Two monophyletic bacterial groups were thought to dominate this pathway: Nitrosomonas spp. (Betaproteobacteria: Nitrosomonadales: Nitrosomonadaceae) and Nitrosococcus spp. (Gammaproteobacteria: Chromatiales: Chromatiaceae). Recent insights have complicated this framework, as archaeal (Crenarchaeota, e.g. “Nitrosopumilis maritimus”, (Konneke et al., 2005)) microorganisms may perform a significant proportion of aerobic nitrification. A number of recent studies show a high abundance, diversity and activity of ammonia-oxidizing Crenarchaea in soils, marine waters and sediments (e.g. Francis et al. 2005, Leininger et al. 2006). There may also be a differential distribution of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) between habitats. Studies investigating AOA and AOB distribution along estuarine salinity gradients indicate that different functional assemblages are associated with different salinity levels and overall nitrification rates (Bernhard et al. 2007), with a stronger influence of salinity on AOB distribution than AOA (Sahan & Muyzer 2008, Santoro et al. 2008). While AOB display specialized metabolisms, Crenarchaea generally have more flexible metabolic capabilities, which may explain the higher sensitivity of AOB to changing salinity and the lower overall diversity of AOB in estuarine sediments. For my independent project, I attempted to measure the abundance and diversity of AOA and AOB along a natural gradient of salinity and in varying salinity lab enrichments from these environmental samples for ammonia oxidizing bacteria and archaea. Based upon the studies cited above, I expected AOA abundance and diversity to vary less with salinity, and that AOB would shift in dominance from β- to γ-Proteobacteria as salinity increased. Methods

To evaluate these hypotheses, I first identified a site with a strong salinity gradient also corresponding with a shift from a freshwater to marine water source. Salt Pond is a shallow, stratified coastal pond with a freshwater cap and saltwater hypolimnion maintained by subsurface seawater intrusion. Water samples were collected from eight locations: seven through the Salt Pond water column plus one low salinity sample from the pond outflow. Concurrent with water sampling, lake water physiochemical parameters (including salinity and dissolved oxygen concentration) were recorded using a CTD meter. Also, inorganic nitrogen concentrations (ammonium, nitrite and nitrate) were measured in the lab using spectrophotometric methods and an AutoAnalyzer (J. Saenz).

Environmental and lab enrichment AOA and AOB abundance and diversity were evaluated using three approaches. I enumerated cell abundances using mono-labelled and CARD-FISH oligonucleotide probes for the phylogenetic groups of interest, using protocols from the lab manual and published material (Table 1). 10-15 mL of water per sample were

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

2

filtered to provide a cell density appropriate for counting on the epifluorescent microscope. I attempted to amplify and construct clone libraries of the archaeal 16S rRNA gene and β-Proteobacterial, γ-Proteobacterial and Crenarchaeotal ammonia monoxygenase functional genes using protocols from the lab manual and published material (Table 2). Finally, the V6 regions of all 16S rRNA gene amplicons from the environmental samples were pyrosequenced using 454 technology (Josephine Paul Bay Center, MBL) to provide an exhaustive survey of bacterial diversity across the gradient (Sogin et al., 2006).

Enrichments for AOA and AOB at three different salinity levels (25%, 50% and 75% salt water base) were assembled using a basic ammonia oxider selective medium (Watson, 1965; Koops and Moller, 1981) with several modifications. I added an antibiotic mixture to a final concentration of 50 ug/mL to one replicate of enrichments to encourage dominance of archaeal growth. I also made a batch of 75% Saltwater Base enrichments anaerobically with sodium sulfide (to maintain reducing conditions) and sodium nitrate as a potential electron acceptor for ammonia oxidation. All recipes are listed in Table 3. All batch tubes were burned at 300°C for 2 h in a muffle furnace before inoculation to remove all organic material. The inoculation volume was 1 mL Salt Pond water into 10 mL liquid medium. Oxic enrichments were incubated on a shaker table at 30°C. I assessed cell growth in enrichments after one and two weeks using the light microscope. After two weeks, I selected the ten enrichments with the most dense cell growth to filter for CARD-FISH scans for Nitrosomonas spp., Nitrosococcus spp. and Crenarchaeota (a EUB I-III and NON probe were hybridized also as positive and negative controls). Results Lake water column conditions at the time of sampling are shown in Tables 1 and 2. Salinity ranged from 15 ppt in the upper water column to 25 ppt in the lower water column, and the transition between the two salinity conditions was sharp and closely corresponded with the oxycline. Salinity in the outflow water sample was approximately 5 ppt. Inorganic nitrogen species distribution also varied along the same spatial scale, with both oxidized and reduced nitrogen concentrations relatively high in the epilimnion, low through the chemocline, and ammonium concentrations increasing again to a high of 100 µM in the anoxic hypolimnion. Archaeal 16S rRNA and bacterial and archaeal ammonia monoxygenase genes could only be amplified from a subset of Salt Pond water column samples (Table 4). Cloning of the three strong amplifications of archaeal 16S rRNA was unsuccessful. Amplification of γ-Proteobacterial amoA was unsuccessful. Though a ~450 bp PCR product (the correct length) could be easily amplified from four of the water samples, cloning and sequencing of these products revealed the product to resemble a glycosyl transferase family protein from the Prosthecochloris vibrioformis DSM 265 complete genome (BLASTx). This organism is a member of the Chlorobi phylum, a taxonomic group that proved to be dominant in the 454 bacterial survey of lower water column samples. Though the archaeal amoA gene amplified in two of the lower water column samples, insufficient time was available to optimize the PCR reaction and attempt clone library construction for that gene. A number of enrichments for ammonia oxidizing bacteria and archaea at differing salinity levels displayed significant cell growth over the two week project period (Table 5, Figure 3). CARD-FISH screens for Nitrosomonas spp., Nitrosococcus spp., and Crenarchaeota from filters of these enrichments, however, revealed that only one enrichment was dominated by archaea (oxic high salinity inoculum in 75% SWB medium with antibiotics). The other enrichments

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

3

were comprised of bacterial cells that did not hybridize with oligonucleotide probes for the ammonia-oxidizing phyla. Overall cell counts through the Salt Pond water column ranged from 4.5 x 106 in surface waters to a high 1.97 x 107 at depth (Figure 4). CARD-FISH counts of Bacteria ranged from 88 – 100% of total cells; of Archaea from 1.1 – 9.3% of total cells; of β-Proteobacteria from 3.4 – 53% of total cells; and of γ-Proteobacteria from 1.6 – 11% of total cells (Figure 5). Archaea and β-Proteobacteria were most abundant in lower depths (> 3 m), with β-Proteobacteria comprising a large (53% of total cells) population within the 3.4 m sample. Cells from the Nitrosomonas and Nitrosococcus genera were undetectable. Time constraints prevented the full count of Crenarchaeota.

Surveys of the bacterial 16S rRNA V6 region showed a shift in dominant Phyla from upper to lower depths in the water column (Figure 5). At shallow depths Proteobacteria, Actinobacteria and Cyanobacteria were dominant while at deeper depths, Chlorobi were dominant and Proteobacteria were also common. The distribution of V6 sequnces of Proteobacterial subphyla showed a decrease in γ-Proteobacteria with depth, with a similar magnitude of relative abundance as was tabulated from CARD-FISH counts (1.7 – 8.7% of total sequences). β-Proteobacteria were an extremely minor portion of the V6 survey, however, comprising <0.1% of total sequences and showing no depth distribution patterns. Seven sequences from the Nitrosomonas genus were detected in the entire 454 library (> 20,000 sequences): two at 1.8 m depth, four at 2.2 m depth and one at 3.1 m depth. Discussion

Environmental conditions were appropriate to support the activity of ammonia oxidizing microorganisms in the oxygenated, ammonium rich eplilmnion. The lower concentrations of ammonium in deeper depths may limit the activity of these organisms but does not preclude their presence. Nevertheless, the accumulation of evidence from the multiple approaches taken to catalogue AOA and AOB in Salt Pond shows that ammonia oxidizers were not a significant portion of the microbial community at the time of sampling. The results of the project, however, provide information that may help explain this phenomenon.

The amplification of Chlorobi functional genes rather than β-Proteobacterial ammonia monoxygenase genes shows the limitations of PCR based methods and is a reflection of microbial community composition in Salt Pond waters during the sampling period. If a gene of interest is rare, primers may bind to other genes present in the sample. In this case, β-Proteobacterial ammonia monooxygenase genes were rare but Chlorobi genomes were abundant, and the β-amoA primers amplified a Chlorobi-like glycosyl transferase protein coding sequence from the genomic DNA pool. This false positive PCR amplification is more likely to be encountered during the study of functional genes than the highly conserved 16S rRNA gene.

Two explanations exist for the unsuccessful enrichments for ammonia oxidizing bacteria and archaea. First, low cell abundances of target populations in the inocula decrease the probability of survival of cultivable populations through the sample collection and inoculation steps. Second, any trace amounts of organic material in the medium may support the growth of heterotrophic organisms. During this experiment, all carbon was oxidized from the batch tubes but the medium may not have been completely carbon-free. Low inoculum target cell abundances make outcomepetition by heterotrophs more likely. In addition, though antibiotics inhibit function and/or reproduction of most bacterial cells, there are some bacteria that can

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

4

subsist on these complex organic compounds as a sole carbon source (Dantas et al., 2008), making heterotrophic contamination a more likely problem in the archaeal enrichments.

DAPI cell counts were on the high end of the usual range for planktonic communities. Cell abundances in Salt Pond can vary quite a bit between months (Simmons et al., 2004), and these samples were taken at the height of summer, when overall production is probably highest. The abundance of ammonia oxidizing bacteria and archaea was so low as to be undetectable by CARD-FISH probing. However, this approach revealed patterns in taxonomic composition of the microbial community with depth. Total cells, Archaea and β-Proteobacteria were more abundant at lower depths, while γ-Proteobacteria decreased in abundance with depth. Archaea and the dominant members of the β-Proteobacteria may be more tolerant of higher salinity, lower oxygen and high sulfide concentrations than the dominant members of the γ-Proteobacteria in the Salt Pond water column.

The 454 sequencing of bacterial V6 16S rRNA could provide more information on taxonomic breadth of all groups including β- and γ-Proteobacteria. The relative abundance of γ-Proteobacterial V6 sequences was similar to that found using CARD-FISH, between 1.7 and 8.7%, and also decreased with depth. Further interpretation of this pattern is difficult as the γ-Proteobacteria were dominated by types unidentifiable using the SILVA and RDP databases. Notably, there were very few β-Proteobacterial sequences identified in this survey, which is in strong contradiction to the dominance of β-Proteobacteria in FISH counts (<0.1% relative sequence abundance versus up to 50% relative cell abundance). Instead, the lower water column depths are to be dominated by Chlorobi sequences in the 454 survey. It is qualitatively apparent from microscopic examination of Salt Pond water that cells with autoflourescent bacteriochlorophyll-a are much more abundant in the lower depths than the upper depths; however these cell densities did not appear to exceed 50% as was indicated by the 454 survey (Figure 8).

Methodological biases of both approaches may explain this discrepancy. CARD-FISH is a sensitive technique; oligonucleotide probes can bind to cells of other phylogenetic groups if hybridization conditions are not tightly controlled. SILVA Probe Check shows that if the specificity of the Beta42a probe is decreased, it is likely to hybridize to γ-Proteobacteria, some alpha-Proteobacteria and Cyanobacteria, but not the environmentally dominant Chlorobi. Similarly, genomic DNA extraction, PCR primer bias and sequencing primer bias can exclude certain microbial groups from molecular surveys such as 454. A scan of the specificity of the V6 primers used for 454 analysis against the SILVA database showed that these primers should indeed read the vast majority of β-Proteobacterial 16S rRNA genes in that database. In addition to further evaluation of the CARD-FISH and 454 methods used here, additional approaches should be used to establish the true relative abundance of β-Proteobacteria and Chlorobi in the Salt Pond water column. These could include counting autofluorescent cells with the epifluorescent microscope, quantitative PCR and culturing approaches to look for β-Proteobacteria that existing primers may have missed.

Ammonia oxidizing bacteria and archaea were very low in abundance in Salt Pond during the project time period (July 2008). The presence of Nitrosomonas 16S rRNA V6 sequences in the 454 survey and potential amplification of the archaeal amoA gene from Salt Pond water samples, however, shows that these organisms cannot be considered absent from this environment. As these organisms were low in abundance during the sampling period, it is clear that salinity did not affect the abundance or diversity of ammonia oxidizing bacteria or archaea. During times of lower dominance by photoautotrophs, ammonia oxidizing chemolithoautotrophs

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

5

may become more prevalent in the active microbial community of the Salt Pond water column. In other words, gradients of physiochemical variables other than salinity (e.g. light, oxygen) appear to structure Salt Pond microbial communities during the summer months. The methodological approach taken during this project, a combination of direct cell counts, molecular surveys and enrichment for isolation of ammonia oxidizers, provides a thorough way to assess the distribution of these microorganisms under different environmental conditions. Acknowledgements

I offer many warm thanks to a number of people for their input and support during the undertaking of this project. Dagmar Woebken taught the FISH methodology thoroughly and clearly and was a supportive mentor for the project as a whole. Steven Hallam and James Saenz are great collaborators and the overall investigation of Salt Pond microbial diversity will prove fruitful. Dave Walsh and Clegg Waldron helped collect the water samples for the enrichment portion of the project. The MBL Josephine Bay Paul Center produced and organized the informative 454 sequence data. My participation in the project was partially funded by the Planetary Biology Internship Scholarship. The students and teaching assistants of this course were a wonderful group with great camaraderie. Finally, Bill Metcalf and Tom Schmidt were excellent teachers, course directors and role models. (Stahl and Amann, 1981; Amann et al., 1992; DeLong, 1992; Manz et al., 1992; Mobarry et al., 1996; Rotthauwe et al., 1997; Daims et al., 1999; Jurgens et al., 2000; Purkhold et al., 2000; Francis et al., 2005; Leininger et al., 2006; Bernhard et al., 2007; Lam et al., 2007; Woebken et al., 2007; Sahan and Muyzer, 2008; Santoro et al., 2008) References Cited Amann, R.I., Zarda, B., Stahl, D.A., and Schleifer, K.H. (1992) Identification of Individual

Prokaryotic Cells by Using Enzyme-Labeled, Ribosomal-Rna-Targeted Oligonucleotide Probes. Applied and Environmental Microbiology 58: 3007-3011.

Bernhard, A.E., Tucker, J., Giblin, A.E., and Stahl, D.A. (2007) Functionally distinct communities of ammonia-oxidizing bacteria along an estuarine salinity gradient. Environmental Microbiology 9: 1439-1447.

Daims, H., Bruhl, A., Amann, R., Schleifer, K.H., and Wagner, M. (1999) The domain-specific probe EUB338 is insufficient for the detection of all Bacteria: Development and evaluation of a more comprehensive probe set. Systematic and Applied Microbiology 22: 434-444.

Dantas, G., Sommer, M.O.A., Oluwasegun, R.D., and Church, G.M. (2008) Bacteria subsisting on antibiotics. Science 320: 100-103.

DeLong, E.F. (1992) Archaea in coastal marine environments. Proceedings of the National Academy of Sciences of the United States of America 89: 5685-5689.

Francis, C.A., Roberts, K.J., Beman, J.M., Santoro, A.E., and Oakley, B.B. (2005) Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proceedings of the National Academy of Sciences of the United States of America 102: 14683-14688.

Jurgens, G., Glockner, F.O., Amann, R., Saano, A., Montonen, L., Likolammi, M., and Munster, U. (2000) Identification of novel Archaea in bacterioplankton of a boreal forest lake by phylogenetic analysis and fluorescent in situ hybridization. Fems Microbiology Ecology 34: 45-56.

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

6

Konneke, M., Bernhard, A.E., de la Torre, J.R., Walker, C.B., Waterbury, J.B., and Stahl, D.A. (2005) Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 437: 543-546.

Koops, H.-P., and Moller, U.C. (1981) The lithotrophic ammonia-oxidizing bacteria. In The Prokaryotes. Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., and Stackebrandt, E. (eds). New York, NY: Springer.

Lam, P., Jensen, M.M., Lavik, G., McGinnis, D.F., Muller, B., Schubert, C.J. et al. (2007) Linking crenarchaeal and bacterial nitrification to anammox in the Black Sea. Proceedings of the National Academy of Sciences of the United States of America 104: 7104-7109.

Leininger, S., Urich, T., Schloter, M., Schwark, L., Qi, J., Nicol, G.W. et al. (2006) Archaea predominate among ammonia-oxidizing prokaryotes in soils. Nature 442: 806-809.

Manz, W., Amann, R., Ludwig, W., Wagner, M., and Schleifer, K.H. (1992) Phylogenetic Oligodeoxynucleotide Probes for the Major Subclasses of Proteobacteria - Problems and Solutions. Systematic and Applied Microbiology 15: 593-600.

Mobarry, B.K., Wagner, M., Urbain, V., Rittmann, B.E., and Stahl, D.A. (1996) Phylogenetic probes for analyzing abundance and spatial organization of nitrifying bacteria. Applied and Environmental Microbiology 62: 2156-2162.

Purkhold, U., Pommerening-Roser, A., Juretschko, S., Schmid, M.C., Koops, H.P., and Wagner, M. (2000) Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: Implications for molecular diversity surveys. Applied and Environmental Microbiology 66: 5368-5382.

Rotthauwe, J.-H., Witzel, K.-P., and Liesack, W. (1997) The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology 63: 4704-4712.

Sahan, E., and Muyzer, G. (2008) Diversity and spatio-temporal distribution of ammonia-oxidizing Archaea and Bacteria in sediments of the Westerschelde estuary. FEMS Microbiology Ecology 63: 175-186.

Santoro, A.E., Francis, C.A., de Sieyes, N.R., and Boehm, A.B. (2008) Shifts in the relative abundance of ammonia-oxidizing bacteria and archaea across physicochemical gradients in a subterranean estuary. Environmental Microbiology 10: 1068-1079.

Simmons, S.L., Sievert, S.M., Frankel, R.B., Bazylinski, D.A., and Edwards, K.J. (2004) Spatiotemporal distribution of marine magnetotactic bacteria in a seasonally stratified coastal salt pond. Applied and Environmental Microbiology 70: 6230-6239.

Sogin, M.L., Morrison, H.G., Huber, J.A., Welch, D.M., Huse, S.M., Neal, P.R. et al. (2006) Microbial diversity in the deep sea and the underexplored "rare biosphere". Proceedings of the National Academy of Science of the United States of America 103: 12115-12120.

Stahl, D.A., and Amann, R. (1981) Development and application of nucleic acid probes. In Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M. (eds). Chichester, England: John Wiley and Sons Ltd., pp. 205-248.

Watson, S.W. (1965) Characteristics of a marine nitrifying bacterium, Nitrosocystis oceanus sp. n. Limnology and Oceanography 10: R274-R289.

Woebken, D., Fuchs, B.A., Kuypers, M.A.A., and Amann, R. (2007) Potential interactions of particle-associated anammox bacteria with bacterial and archaeal partners in the Namibian upwelling system. Applied and Environmental Microbiology 73: 4648-4657.

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

7

Table 1. Oligonucleotide probe sequences and sources for tags, protocols and specificities. FISH probes (*mono-labelled FISH, all others HRP for CARD-FISH) Bacteria: Eub338I, II, III, 5’- GCT GCC TCC CGT AGG AGT -3’ Daims et al. 1999 β-Proteobacteria: Bet42a + comp position 1027-1043, probe 5'- GCC TTC CCA CTT CGT TT -3', competitor 5'- GCC TTC CCA CAT CGT TT -3' from Manz et al. 1992 γ-Proteobacteria: Gam42a + comp position 1027-1043, probe 5'- GCC TTC CCA CAT CGT TT -3', competitor 5'- GCC TTC CCA CTT CGT TT -3' from Manz et al. 1992 Ammonia-oxidizing β-Proteobacteria: Nso190 position 189-207, 5'- CGA TCC CCT GCT TTT CTC C -3' AND Nso1225 position 1224-1243, 5'- CGC CAT TGT ATT ACG TGT GA -3' from Mobarry et al. 1996 Ammonia-oxidizing γ-Proteobacteria*: Nscoc128 position 128-146, 5’- CCCCTCTAGAGGCCAGAT -3’ from Juretschko 2000 (dissertation), Woebken et al. 2007 Archaea: Arch915 position 915-934, 5'- GTG CTC CCC CGC CAA TTC CT -3' from Stahl and Amann 1991 Crenarchaea: Cren512 position 512-527, 5'- CGG CGG CTG ACA CCA G -3' from Jurgens et al. 2000 Table 2. Primer sequence sets for nucleic acid analyses including source references with PCR protocols. Archaeal 16S rRNA and ammonia monoxygenase (AmoA) gene primer sets Archaeal 16S: Arc21F: (5’- TTCCGGTTGATCCYGCCGGA -3’)/ Arc958R: (5’- YCCGGCGTTGAMTCCAATT -3’) from DeLong 1992 AMOA (amoA gene for Crenarchaeota): Arch-amoAF (5’- STAATGGTCTGGCTTAGACG -3’)/ Arch-amoAR (5’- GCGGCCATCCATCTGTATGT -3’) from Francis et al. 2005 AMOB (amoA gene for β and γ-Proteobacteria): For β-Proteobacteria - amoA-1F (5'- GGGGTTTCTACTGGTGGT -3')/ amoA-2R (5'- CCCCTCKGSAAAGCCTTCTTC -3') from Rotthauwe et al. 1997, Purkhold et al. 2000* For γ-Proteobacteria - amoA-3F (5’- GGT GAG TGG GYT AAC MG-3’)/ amoB-4R (5’ -GCT AGC CAC TTT CTG G -3’) from Purkhold et al. 2000*, Lam et al. 2007 *used Purkhold et al.’s PCR cycle reaction Table 3. Enrichment medium composition; based on Koops & Möller 1981, from Watson 1965 (marine strains). 25 mM NH4Cl 1 mM Na2SO4 1 mM Na2HPO4 1 mM essential nutrients 50 mM NaHCO3 Salinity treatments: 25% Seawater Base 50% Seawater Base 75% Seawater Base Archaeal enrichment: 50 µg/mL antibiotic spike (3:3:3:1 ampicillin:erythromycin:kanamycin:gentamycin) Anaerobic treatment (at 75% SWC): no O2 1 mM NaS2

25 mM NaNO3

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

8

Table 4. Matrix of nucleic acid amplification results for all samples and primer sets.

Gene ⇒ Sample ⇓ Archaeal 16S rRNA β-AmoA γ-AmoA Arch-AmoA

0.8 m - - - - 1.8 m Weak + - - - 2.2 m - - - - 2.9 m Weak + + (not amoA) - - 3.1 m + + (not amoA) - - 3.4 m + + (not amoA) - Weak + 3.7 m + + (not amoA) - Weak +

OUTLET - - - - Table 5. Matrix of enrichment success for all treatment types and inoculum sources.

Ammonia oxidizer selection Archaeal (Antibiotic) ammonia oxidizer selection

Medium ⇒ Inoculum ⇓

25% SWB

50% SWB

75% SWB

75% SWB, no O2

25% SWB

50% SWB

75% SWB

75% SWB, no O2

Oxic, low salinity -

+

+

++

-

-

-

-

Oxic, medium salinity

+

++

+

+

-

++

+

+

Oxic, high salinity

+

+

+

-

-

-

+

-

Anoxic, high salinity

+

-

-

-

+

-

-

-

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

9

Figure 1. Water column physiochemistry in Salt Pond, MA. Red stars indicate sampling points for molecular and cell abundance analyses. Dashed lines indicate samples utilized as enrichment inocula. Figure 2. Water column inorganic nitrogen concentrations in Salt Pond, MA in July 2008.

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

10

Figure 3. Light microscopic image of dividing cells in the oxic high salinity inoculum in 75% SWB medium with antibiotics enrichment. The coccus/rod morphology is typical of ammonia oxidizing bacteria as well as a large number of bacteria with other metabolic capabilities. Figure 4. DAPI cell counts from the water column of Salt Pond, MA, July 2008.

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

11

Figure 5. Relative abundance of bacterial (including the β- and γ-Proteobacterial subsets) and archaeal cells through the Salt Pond water column in July 2008. Cells from the Nitrosomonas and Nitrosococcus phyla were undetectable.

Figure 6. Relative abundance of bacterial 16S rRNA V6 region sequences through the Salt Pond, MA water column in July 2008.

Lydia H. Zeglin MBL Microbial Diversity Final Project Report 29 July 2008

12

Figure 7. Relative abundance of Proteobacterial 16S rRNA V6 region sequences through the Salt Pond, MA water column in July 2008.

Figure 8. DAPI stain images from epifluorescent visualization displaying cell abundance and morphological diversity at (a) 0.8 m depth and (b) 3.4 m depth in Salt Pond, MA, July 2008.

(a) 0.8 m

(b) 3.4 m