How does peripheral lipopolysaccharide induce gene expression in the brain of rats?

Toxicology 201 (2004) 197–207

How does peripheral lipopolysaccharide inducegene expression in the brain of rats?

A.K. Singh∗, Y. Jiang

Department of Veterinary Diagnostic Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN 55108, USA

Received 5 February 2004; received in revised form 16 April 2004; accepted 24 April 2004

Available online 28 May 2004

Abstract

Lipopolysaccharide (LPS), the principal cell-wall component of gram-negative bacteria, is responsible for alterations in thecentral and peripheral tissues associated with gram-negative infections. However, the mechanism by which peripheral LPS causecentral effects is not fully known. This study showed that peripheral LPS sequentially increased IL-1� and iNOS mRNA levels,NO2 level, and CRF mRNA level in the hypothalamic PVN, and corticosterone concentration in blood. Brain-endothelium, but nothypothalamic PVN samples, from LPS injected rats contained ions for LPS lipids, bound BODIPY-LPS (bLPS), and expressedTLR-4, TLP-2 and CD14 mRNAs. This suggests that (1) LPS does not cross the blood–brain barrier, and (2) brain-endothelialcells contain LPS binding sites, TLR-4, TLR-2 and CD14. Systemic LPS injection increased [14C]sucrose uptake, but did notaffect [14C]dextran uptake into the brain. Thus, when injected systemically, LPS binds to its receptor and enter the endothelialcells where it increase BBB permeation in a mass-selective manner and triggers a series of signaling events leading to thedevelopment of inflammatory response in the brain.© 2004 Published by Elsevier Ireland Ltd.

Keywords:Corticotropin-releasing factor; Corticosteroid; Lipopolysaccharide; Nitric oxide; Inducible nitric oxide synthase; NF�B; LPSbinding sites

Abbreviations: BBB, blood–brain barrier; CORT, corticos-terone; GC, glucocorticoid; GR, GC receptor; HPP, hypo-thalamic–pituitary–portal; I, inducible; IL-1�, interleukin-1 beta;INT, interferon-gamma; LBP, lipopolysaccharide (LPS) bindingprotein; MALDI-TOF, matrix assisted laser desorption/ionizationtime-of-flight; mCD14, membrane CD14; NOS, nitric oxide syn-thase; NF�B, nuclear factor�B; I�B, NF�B inhibitor; nGRE, anegative GR binding-site in CRF-gene; NO, nitric oxide; PVN,paraventricular nucleus; sCD14, soluble CD14; TLR, toll-like re-ceptor; TNF, tumor necrosis factor

∗ Corresponding author. Tel.:+1-612-625-6782.E-mail address:[email protected] (A.K. Singh).

Gram-negative bacterial infections are associatedwith inflammatory and immunological manifestationsincluding fever, injury and neurological dysfunction.LPS is the principal cell-wall component responsi-ble for tissue damage and other pathophysiologicalchanges associated with gram-negative infections(Holst et al., 1996; Morrison and Ryan, 1987; Olsonet al., 1995). LPS acts by inducing pro-inflammatorycytokines including IL-1�, TNF, INT, etc. (Cartmellet al., 1999; Gabellec et al., 1995; Hagan et al.,1993; Plata-Salaman, 1991; Szabo, 1996). Earlierstudies have shown that peripheral injection of LPS

0300-483X/$ – see front matter © 2004 Published by Elsevier Ireland Ltd.doi:10.1016/j.tox.2004.04.015

198 A.K. Singh, Y. Jiang / Toxicology 201 (2004) 197–207

activated NF�B that induced transcription of thepro-inflammatory, iNOS, and CRF genes in the brain(Baumann and Gauldie, 1994; Quan et al., 1998;Quan et al., 2002; Ramachandra et al., 1992; Schmahlet al., 1980; Turrin et al., 2002). Also, central, butnot peripheral, injection of IL-1 receptor antagonistsuppressed the pro-inflammatory effects of LPS inthe brain (Cartmell et al., 1999). This suggests thatthe elements mediating LPS’s central effects reside inthe brain. However, the mechanism(s) by which pe-ripheral LPS effects the brain is not fully understood.We propose that either LPS enters the brain and causea direct deleterious effects or it does not enter thebrain but binds to the TLR-4/TLR-2 receptors presenton the brain endothelial cell membrane that, throughreleasing IL-1� and/or NO, cause central effects. Itis well established that NO is a gaseous neurotrans-mitter that diffuses into the brain (Berdeaux, 1993),while IL-1� has been shown to cross the BBB andenter the brain (Banks et al., 1995).

1. Experimental design

1.1. Animal protocol

Groups of male Wistar rats (weighing around225–270 g) were housed with light–dark cycle suchthat their adrenocortical activity was highest between9 and 11 a.m. Prior to the start of the experiment,each rat was familiarized for 1 week with the exper-imental procedures to reduce stress-induced changesin the HPA axis. Then, the animals were injectedwith LPS (100�g/kg) or the vehicle alone (for con-trol) by i.p. injection (Bahrami et al., 1994). Atspecific time intervals after the injection, rats wereanesthetized individually by injecting i.p. 50 mg/kgchloral hydrate. Then, the rat was decapitated andthe systemic blood was drained into a heparinizedtest-tube. The skull was dropped directly into liquidnitrogen. The blood samples were centrifuged andplasma was collected. Plasma samples were storedat −70◦C. The skull was opened, the brain wasremoved and immersed in ice-cold artificial cere-brospinal fluid (ACSF) of the following composition(mM): 140 NaCl, 5 KCl, 1·6 CaCl2, 1 MgCl2, 10HEPES and 10 glucose; pH adjusted to 7.4 withNaOH.

1.2. Dissection of PVN cells

Coronal section of 300�m were cut from the frozenrat brain at−9◦C and thaw-mounted onto glass slide.Sections were then placed on a pre-cooled microdis-section plate. PVN area was identified at−1.5 and−1.8 relative to Bregma. PVN was removed from thesection using 500�m diameter neuro-punches. ThePVN samples were frozen and stored at−70◦C forfurther analysis.

1.3. Isolation of endothelial cells

The remaining brains were rinsed in a medium con-taining DMEM, 1% bovine serum albumin, 100 U/mlpenicillin, 100�g/ml amphotericin B, and 2 mmol/ll-glutamine (Irvine Scientific). After a rinse, the tis-sue was homogenized and serially passed throughnylon meshes of 149, 74, and 20�m. The tissue re-tained by the 74 and 20�m meshes was digested at37◦C overnight by 1 mg/ml collagenase (Sigma). Af-ter the overnight digestion, the tissue was incubatedwith trypsin-EDTA (2.5 and 0.2 mg/ml, respectively)for 30 min. The tissue was resuspended in mediumcontaining DMEM, 15% plasma-derived serum (Co-calico Biological), 100 U/ml penicillin, 100�g/mlstreptomycin, and 2 mmol/ll-glutamine and plated ondishes coated with 1% gelatin (Sigma). Twenty-fourhours after plating, adherent cells were washed andfed fresh medium. This step was followed by atrypsin-EDTA treatment for 2–3 min, resulting in se-lective release of endothelial cells. Endothelial cellswere stored frozen at−70◦C.

1.4. Possible entry and accumulation of LPSinto the brain

This was studied by (1) screening the PVN andendothelial cells by using MALDI-TOF mass spec-trometry for the presence of LPS-ions, (2) measuringTLR-2, TLR-4 and CD14 mRNA levels in the PVNand endothelial cells, and (3) measuring binding offluorescent BODYPI-LPS (bLPS) to brain endothelialcells in vitro.

1.5. Analysis of LPS lipids by MALDI-TOF

To screen the presence of LPS lipids, hypothala-mus and endothelial samples were thawed and mixed

A.K. Singh, Y. Jiang / Toxicology 201 (2004) 197–207 199

(1:3, w/v) with NH4OH (0.25 M). The mixtures werehomogenized. The homogenate was incubated for8 h at room temperature. Then, the samples werefreeze-dried and mixed (1:3) with a mixture con-taining chloroform and trifluoroethanol (4:1, v/v).The mixture was incubated at room temperature for15 min and centrifuged (750× g) for 10 min. A 1�l

TLR-4 3′ Primer TTGAAGACAAGGCATGGCATGG (Lahnardt et al., 2002)5′ Primer TCTCCCAAGATCAACCGATG

CD14 3′ primer GTGCTCCTGCCCAGTGAAAGA (Lahnardt et al., 2002)5′ primer GATCTGTCTGACAACCCTGAGT

TLR-2 3′ primer GGCTCTTCTGGATCTTGGGTGCC (Laflamme et al., 2001)5′ primer GGGCCACTCCAGGTAGGTCTTGG

CRF 3′ Primer GGCAACTTAAAGAACGTTGGCCTCGTC (Singh, 2001)5′ Primer CCGTTGAATTTCTTGCAACCGGAGCAG

iNOS 3′ Primer CTCCTTCAAAGAGGCAAAAATA (Pahan et al., 1999)5′ Primer CACTTCCTCCAGGATGTTGT

IL-1� 3′ Primer AAAAGCTTGGTGATGTCTGG-3′ (Lee et al., 2002)5′ Primer TTTCAACACGCAGGACAGG-3′

GR 3′ Primer CCTAGAAGCATTTGCGGTGCACGATG (Takahashi et al., 2002)5′ Primer ACACAGGCTTCAGGTATCTT�-Actin Probes were obtained from ATCC, Bethesda, MD.

aliquot of the extract was mixed with 1�l of the ma-trix solution consisting of 2,5-dihydroxybenzoic acidin acetonitrile–0.2% TFA (70:30, v/v). The mixturewas applied onto the MALDI sample disc, dried andanalyzed by using the MALDI-TOF mass spectrom-eter (Voyager, Applied Biosystem). Mass calibrationwas performed by using external standards. Positivecontrol was LPS spiked PVN samples obtained fromcontrol rats (Silipo et al., 2002).

1.6. TLR-2, TLR-4, CD14, iNOS, IL-1β, CRF andGR mRNA levels by RT-PCR

A 10 mg portion of hypothalamic samples were ho-mogenized in 0.8 ml of RNA STAT-60 (Tel-Test “B”)and incubated at room temperature for 5 min. Thenthe homogenate was mixed with 0.2 ml of chloroformand shaken for 15 s. The homogenate was incubatedat 4◦C for 30 min and then centrifuged (12,000× g

at 4◦C) for 15 min. The aqueous phase was mixedwith isopropanol (0.5 ml), stored for 5 min at room

temperature and then centrifuged as above. The RNAprecipitate was washed with 75% ethanol and subse-quent centrifugation at 7500× g for 5 min. The RNApellets were dried, dissolved in RNase free water andstored at−70◦C for further analysis. The sampleswere subjected to RT-PCR by using the followingprobes:

For RT-PCR, the probes were mixed with the nu-cleotide mix containing [32P]ATP, reverse transcrip-tase,Tfl-polymerase and the sample RNA. The sam-ples were incubated at 48◦C for 45 min then at 94◦Cfor 2 min, 40 cycles of 94◦C for 30 s, 60◦C for 1 minand 68◦C for 2 min, and then a final extension at68◦C for 7 min. The RT-PCR product was subjectedto gel-electrophoresis. The CRF mRNA and�-actinbands were identified under UV light. Individual bandswere cutout and solubilized in 20 ml of scintillationvial. The radioactivity was determined in each band.In some experiments, the gel products were blottedonto a nitrocellulose membrane. The membranes weresubjected to autoradiography.

1.7. Binding to fluorescent-labeled LPS to brainendothelial cells and hypothalamic PVN

Partially desegregated BODIPY-LPS (bLPS)(Molecular Probes, L23350) was prepared by dilutingbLPS to a concentration of 10�g/ml in HNEB buffer


(20 mM HEPES (pH 7.4), 150 mM NaCl, 0.1 mMEDTA, and 0.3 mg/ml BSA) and then dispersing ag-gregated LPS with a probe sonicator for 1 to 2 s. Thedesegregated bLPS solution was mixed with 300�g(final concentration) of sCD14 (Merk) and incubatedovernight at 37◦C. The endothelial cells were sus-pended in SFM buffer (Cellgro Complete serum-freemedium containing 20 mM HEPES buffer, pH 7.4,0.3 mg/ml BSA) at 4× 106 cells/ml. The suspensionwas mixed with bLPS-sCD14 (300�g/ml) and recom-binant LPS-binding protein, rLBP (0.1�g protein/�gLPS). Then, the endothelial cells were incubatedfor another 30 min at 37◦C. The cells were pelletedby centrifugation (750× g got 5 min at 0 to 4◦C)and washed with ice-cold SFM medium followed byice-cold PBS. The cells were resuspended in 0.1 mlof PBS and split into two equal fractions. One frac-tion was analyzed for bLPS in each cell by a flowcytometer (FACScan, Becton Dickinsol). The otherfraction was treated with 1 ml of 0.02% proteinaseK in PBS to remove the surface-bound bLPS. Cellswere harvested and analyzed as above.

Fig. 1. Effects of systemic LPS injection on NO2 accumulationand iNOS, CRF, GR, IL-1� and�-actin mRNA levels in hypotha-lamic PVN samples, and plasma CORT concentrations in rats.IL-1� and iNOS mRNA contents increased 30 min after, CRF in-creased 2 h after, and GR increased 4 h after LPS injection. NOmetabolite accumulated concomitantly with iNOS increase, whileplasma CORT increase paralleled CRF mRNA increase. Signifi-cant (∗P < 0.05) when compared with control values. Values aremean± S.D., n = 5.

1.8. Hormone immunoassay

The plasma samples were thawed to room temper-ature and analyzed for CORT concentrations by usingthe RIA kits from Diagnostic products Corporation(DCP).

1.9. NO release

NO2− accumulation was used as an indicator of

NO production in the hypothalamus. The hypotha-lamus samples, collected after LPS exposure, weremixed with Griess reagent (1% sulfanilamide, 0.1%N-(1-naphthyl)-ethylenediamine dihydrochloride, and

Fig. 2. MALDI-TOF mass spectrometric analysis of brain PVNsamples and endothelial cells for LPS lipids: (A) LPS standard,(B) hypothalamus from LPS injected rats, (C) LPS spiked samples,and (D) endothelium from LPS exposed rats. The samples werecollected at 30 min after LPS injection. Them/z value for eachion is also shown.


Fig. 3. Fragmentation pattern for LPS lipid A.

2.5% phosphoric acid) (Green et al., 1982) and ho-mogenized. The homogenate was incubated at roomtemperature for 10 min. The samples were centrifugedand the supernatant was collected. Nitrite productionwas measured by absorption reading at 550 nm. Usinga standard curve generated by analyzing the differentconcentration of NaNO2 quantified nitrite levels.

1.10. Blood–brain barrier permeability measurement

Control or LPS-injected rats were anesthetized and[14C]sucrose (342 Da) or [14C]dextran (50–90 kDa)(DuPont-NEN, Boston, MA) were injected intofemoral vein. At 1 min after injection, blood sam-ples were collected and the brain was dissected out.Brains were dissected and PVN samples were col-lected. The blood and brain samples were solubilized(500�l Protosol, DuPont-NEN) overnight at 50◦C.Then, the samples were mixed with 5 ml of Aqua-sol and radioactivity was determined by scintillationcounting. Permeability was determined by measuringblood (CPM/min ml)-to-brain (CPM/min mg) ratio ofthe [14C]sucrose and [14C]dextran.

1.11. Statistical analysis

ANOVA followed by Student–Newman–Keuls testwere conducted to determine significance of differencebetween the control and the treatment groups.

Fig. 4. Effects of systemic LPS injection on TLR-4, CD14, TLR-2and�-actin mRNA levels in brain endothelium in rats. TLR-4 andCD14 mRNA increased 30 min after LPS injection, while TLR-2mRNA increased 1 h after systemic LPS injection. HypothalamicPVN samples poorly expressed these proteins (data not shown).


2. Results

2.1. CRF, iNOS, IL-1β and GR mRNA expression,and NO levels in the hypothalamus

Fig. 1 shows the RT-PCR analysis of iNOS, CRF,GR, IL-1� and�-actin mRNA. The IL-1� mRNA was

Fig. 5. Binding of fluorescent BODIPY-LPS (bLPS) to the brain endothelial cells obtained from control and LPS-injected rats and exposedto bLPS in vitro. (A) Total cell count.Top: samples from control rats.Bottom: samples from 0.5 h after LPS injection. (B) Fluorescent level(broken line peaks are fluorescence after proteinase K treatment). Control rats exhibited poor fluorescence. Fluorescence level increased at0.5 h after and peaked 2 h after LPS injection, then declined gradually. Proteinase K completely abolished bLPS fluorescence in samplesobtained at 0.5 h after, but only partially abolished the fluorescence in samples obtained after 2–4 h after LPS injection. The proteinase Kresistant bLPS represents its internalized component.

detectable at 0.5 h after and peaked at 4 h after LPSinjection. The iNOS mRNA appeared at 0.5 h afterand peaked at 2 h after LPS injection. CRF mRNA ap-peared at 2 h after and peaked at 4 h after LPS injec-tion. GR mRNA appeared at 3 h after and peaked at6 h after LPS injection. iNOS mRNA values returnedto the basal level within 3 to 4 h after LPS exposure.


CRF mRNAs returned to the basal level within 6 h af-ter LPS exposure and GR mRNA levels returned tothe basal level within 9 h after LPS injection. How-ever, GR expression began to increase as the iNOSexpression returned to the basal level. NO2 levels inthe brain increased gradually and peaked at 3 h afterLPS injection (Fig. 1).

2.2. Plasma CORT concentrations

Plasma CORT began to rise at 2 h after LPS injec-tion and peaked at 5–6 h after LPS injection (Fig. 1).Then, CORT concentration declined gradually.

2.3. MALDI-TOF analysis of LPS lipids in thehypothalamus

MALDI spectra of lipids obtained from LPS stan-dard and LPS-spiked PVN samples is shown inFig. 2Aand C, respectively. The PVN samples from LPS in-jected rats tested negative (Fig. 2B), while endothelialcells from the same rats tested positive for LPS lipidions (Fig. 2D). Fig. 3 shows the lipid structure ofE.coli LPS. Loss of different fatty acid chains yield theions generated by MALDI-TOF (Fig. 2).

Fig. 6. The time-course of change in fluorescence values in en-dothelial cells exposed to bLPS. Values are mean± S.D., n = 4.

2.4. TLR-4, TLR-2 and CD14 mRNA expression

TLR-4 and CD14 mRNA levels were at anon-detectable level in endothelial cells from con-trol rats or hypothalamic PVN from control orLPS-exposed rats (data not shown). The endothelialmRNA values increased at 0.5 h after and the valuespeaked at 3 h after LPS injection (Fig. 4). Then thevalues decreased gradually but remained detectablefor up to 9 h after LPS injection. TLR-4 mRNA ex-pression at 9 h was lower than the expression at 0.5 hafter LPS injection. TLR-2 mRNA became detectableat 1 h after LPS injection and remained detectable forup to 12 h (Fig. 4).

2.5. LPS binding to brain endothelial cells in vitro(Figs. 5 and 6)

Control endothelial cells exhibited poor LPS bind-ing (Fig. 5, control). When endothelial cells fromLPS-injected rats were exposed to bLPS-CD14 com-plex, a time dependent increase in binding occurred.

Fig. 7. Brain permeability to [14C]sucrose (340 Da) and[14C]dextran in control and LPS-injected rats. (A) [14C]Sucroseuptake was significantly elevated 0.5 h after and peaked 3 h afterLPS injection. (B) [14C]Dextran uptake was not affected by LPSinjection.


Binding increased significantly at 0.5 h after andpeaked at 3 h after LPS injection (Figs. 5 and 6). Thenthe binding decreased gradually (Fig. 4). However,unlike the TLR-4 mRNA values, the 9 h values weresignificantly greater than the 0.5 h values. ProteinaseK removed 80–95% of the fluorescence indicatingthat LPS bound specifically to the surface receptor.

2.6. LPS modulation of BBB permeability

LPS caused significant increase in [14C]sucrose up-take into the brain 30 min that peaked at 2 h after theinjection (Fig. 7). [14C]sucrose uptake returns to thecontrol level 6 h after LPS injection (Fig. 7). LPS didnot affect [14C]dextran uptake throughout the experi-mental period.

3. Discussion

Peripheral LPS has been shown to activate a cas-cade of pro-inflammatory genes including IL-1� andiNOS genes that induce inflammatory reaction in thebrain (Chao et al., 1992; Van Dam et al., 1998; Raberet al., 1995; Karanth et al., 1993; Lee et al., 1999;Uribe et al., 1999), although possible mechanism(s)for the central effects of peripheral LPS is not fullyunderstood. In this study, we have hypothesized thateither LPS crossed the BBB and directly inducedpro-inflammatory cytokine and iNOS genes or itdid not cross the BBB but bound to the endothelialcells and released NO and/or IL-1� that mediatedLPS’s central effects. Published results support bothhypotheses.

LPS, when injected systemically, forms a com-plex with soluble CD14 (sCD14) and LBP in blood(Wright et al., 1990). When LPS–sCD14–LPB com-plex comes to the contact of cells whose membraneexpresses CD14 (mCD14), LPS is transferred formsCD14 to mCD14 and the monomeric LPS binds tothe cell membrane. Then a conformational changein mCD14 translocates LPS into the cell (Hailmanet al., 1996; Vasselon et al., 1999). This suggests thatLPS may enter the cells that contain LPS receptorsand are in direct contact with systemic blood. In thebrain, systemic LPS has been shown to induce TLR-4and CD14 mRNA expression only in the circum-ventricular regions that contain rich vascular plexus

(Laflamme et al., 2001). Since the endothelial cellsof the blood–brain barrier also contain LPS recep-tors (Quan et al., 2002), it is possible that LPS maybind to and enter these cells. Recent observationsthat LPS damaged the BBB and made it relativelyporous (Gaillard et al., 2001, 2003; Xaio et al., 2001)indicate the possibility that LPS may cross the barrierand enter the brain. However, if LPS entered the brainthen we would expect the hypothalamic samples tocontain LPS lipid ions.

It is well established that LPS consists of hy-drophilic core oligosaccharide, covalently linked to alipophilic Lipid-A moiety that includes six fatty acidchains as shown inFig. 3 (Zahringer et al., 1994).LPS lipid-A, upon mild NH4OH hydrolysis, producedkey ions atm/z 1571, 1361, 1135 and 1055 (Silipoet al., 2002). The ionm/z1571 represents (M-N′C14:03OH)− ion, ion atm/z 1135 represents loss of C14:0and O′C14:0 3OH from ion atm/z 1571. The presentstudy showed that LPS standard or LPS-spiked brainsamples exhibited ions at ion atm/z 1798 (25%),1600 (15%), 1135 (100%), and 1090 (10%) whereion at ion atm/z 1798 may be the quasimolecularion peak (M − H)−. These ions, therefore, representdifferent lipid moieties originating from LPS. A keyobservation of this study was that the brain endothe-lial cells, but not the hypothalamic PVN samples,from LPS injected rats exhibited the LPS’s lipid-Aions. Thus, LPS may enter the endothelial cells butdid not cross into the brain and accumulate into thebrain. The MALDI-TOF results are supported by theobservations that TLR-4, TLR-2 and CD14 mRNAswere present in the brain endothelial cells but not inthe hypothalamic PVN samples. As discussed earlier,TLR-4, TLR-2 and mCD14 are key LPS binding sitesonto the cell membranes (Ulevitch and Tobias, 1995).A unique property of LPS-binding sites is that LPS,upon binding to these sites, induces their expressionthat further increases LPS binding (Hailman et al.,1996; Lahnardt et al., 2002). Therefore, this studyshowed that the brain endothelial cells, and not thehypothalamic PVN, contain the inducible form ofLPS binding sites. As shown by a recent study, LPSinduces IL-1� expression and release and that IL-1�activates the hypothalamic PVN (Glue et al., 2002).

This study also showed that fluorescent bLPS boundto the brain endothelial cells but not to the hypotha-lamic PVN in vitro. Binding of bLPS to the brain en-


dothelium and hypothalamic PVN was studied in vitroto determine binding and internalization of LPS. ThePVN samples that did not express the LPS binding pro-teins, did not exhibit bLPS binding. The brain endothe-lium expressed the LPS binding proteins and exhibitedbLPS binding. In endothelium samples, the bLPS flu-orescence peaked at 3 h after LPS injection and thendeclined quickly reaching to the basal level within 6 hafter LPS injection. TLR-4 and TLR-2 mRNA levelsremained at the peak level at 6 h after LPS injection.Thus, bLPS fluorescence returned to the basal level ata time when the LPS binding sites were at their peaklevel. This rapid decrease in fluorescence may be dueto the internalization of bLPS. Internalization of LPSinto the brain endothelial cells is further demonstratedby the presence of LPS-lipid ions in endothelial sam-ples obtained from LPS-injected rats. These observa-tions provided strong evidence that LPS, when injectedsystemically, does not enter the brain but binds to thebrain endothelial cell membrane.

Whether or not systemic LPS opens the BBB isa debatable issue. Some studies have shown thatsystemic LPS did (Bickel et al., 1998; Kang et al.,2002), while others have shown that it increased theBBB in vivo or in vitro (Banks et al., 1999; Bourrieet al., 1999; Iwase et al., 2000; Minami et al., 1998;Veszelka et al., 2003; Osburg et al., 2002; Bohatscheket al., 2001; Jaworowicz et al., 1998; Mayhan, 1998;Xaio et al., 2001; Zimmermann et al., 2001). LPS in-creased the BBB permeation of both [14C]sucrose and[14C]dextran, although increase in [14C[sucrose per-meation was several folds greater than that in dextran.This study showed that peripheral LPS caused severalfolds increase in the brain uptake of [14C]sucrose butdid not affect the uptake of [14C]dextran. Thus, LPStransiently opens the BBB for small molecular weightcompounds. Earlier studies have shown that clearanceof different sized molecules was dependent on molec-ular size when capillary permeability was osmoticallyincreased (Mayhan and Heistad, 1985; Armatronget al., 1987). Thus, BBB permeability change by LPSmay be the possible cause for selective reuptake of[14C]sucrose into the brain.

In conclusion, peripheral LPS did not cross theBBB but accumulated into the brain endothelial cells.Binding of LPS to its receptor may trigger a seriesof signaling events leading to the release of NO andIL-1� in the endothelial cells. IL-1� and/or NO may

play an important role in transfer of information fromblood–brain barrier to the hypothalamus in vivo.

Acknowledgements

This project was partially funded by grants from theGraduate School, College of Veterinary Medicine, andCenter for Food Safety of the University of Minnesota.

References

Armatrong, B.K., Robinson, P.J., Rapoport, S.I., 1987.Six-dependent blood–brain barrier opening demonstrated with[14C]sucrose and 200,000-Da [14C]dextran. Exp. Neurol. 176,255–259.

Bahrami, S., Redl, H., Leichtfried, G., Yu, Y., Schlag, G.,1994. Similar cytokine but different coagulation responseto lipopolysaccharide injection ind-galactosamine-sensitizedversus nonsensitized rats. Infect. Immun. 62, 99–105.

Banks, W.A., Kastin, A.J., Brennan, J.M., Vallance, K.L., 1999.Adsorptive endocytosis of HIV-1gp120 by blood–brain barrieris enhanced by lipopolysaccharide. Exp. Neurol. 156, 165–171.

Banks, W.A., Kastin, A.J., Broadwell, A.J., 1995. Passage ofcytokines across the blood–brain barrier. Neuroimmunomo-dulation 2, 241–248.

Baumann, H., Gauldie, J., 1994. The acute phase responses.Immunol. Today 15, 74–80.

Berdeaux, A., 1993. Nitric oxide: an ubiquitous messenger.Fundam. Clin. Pharmacol. 7, 401–411.

Bickel, U., Grave, B., Kang, Y.S., delRey, A., Voigt, K., 1998.No increase in blood–brain barrier permeability after intraperi-toneal injection of endotoxin in the rat. J. Neuroimmunol. 85,131–136.

Bohatschek, M., Werner, A., Raivich, G., 2001. Systemic LPSinjection leads to granulocyte influx into normal and injuredbrain: effects of ICAM-1 deficiency. Exp. Neurol. 172, 137–152.

Bourrie, B., Bribes, E., Esclangon, M., Garcia, L., Marchand,J., Thomas, C., Maffrand, J.P., Casellas, P., 1999. Theneuroprotective agent SR 57746A abrogates experimentalautoimmune encephalomyelitis and impairs associated blood–brain barrier disruption: implications for multiple sclerosistreatment. Proc. Natl. Acad. Sci. U.S.A. 96, 12855–12891.

Cartmell, T., Luheshi, G.N., Rothwell, N.J., 1999. Brain sites ofaction of endogenous interleukin-1 in the febrile response tolocalized inflammation in rats. J. Physiol. (Lond.) 518, 585–594.

Chao, C.C., Hu, S., Molitor, T.W., Shaskan, E.G., Peterson, P.K.,1992. Activated microgleal mediated neuronal cell injury viaa nitric oxide mechanism. J. Immunol. 149, 2736–2741.

Gabellec, M.M., Griffais, R., Fillion, G., Haour, F., 1995.Expression of interleukin-1 alpha, interleukin 1 beta receptor


antagonist mRNA in mouse brain: regulation by bacteriallipopolysaccharide (LPS) treatment. Br. Res.: Mol. Br. Res.31, 122–130.

Gaillard, P.J., Woorwinden, L.H., Nielsen, J.L., Ivanov, A., Atsumi,R., Engman, H., Ringbom, C., de Boer, A.G., Breimer, D.D.,2001. Establishment and functional characterization of an invitro model of the blood brain barrier, comprising a co-cultureof brain capillary endothelial cells and estrocytes. Eur. J.Pharm. Sci. 12, 215–222.

Gaillard, P.J., de Boer, A.B., Breimer, D.D., 2003. Pharmacologicalinvestigation on lipopolysaccharide-induced permeabilitychanges in the blood–brain barrier in vitro. Microvasc. Res.65, 24–31.

Glue, C., Hansen, J.B., Schjerling, P., Jinquan, T., Poulsen, L.K.,2002. LPS-induced cytokine production in the monocytic cellline THP-1 determined by multiple quantitative competitivePCR (QC-PCR). Scand. J. Clin. Lab. Invest. 62, 405–412.

Green, L.C., Wagner, D.A., Glogowski, J.M., Skipper, P.I.,Wishnock, J.S., Tannenbaum, S.R., 1982. Analysis of nitrate,nitrite, and [15N]-labelled nitrate in biological effects. Anal.Biol. Chem. 126, 131–138.

Hagan, P., Poole, S., Bristow, A.F., 1993. Endotoxin-stimulatedproduction of rat hypothalamic interleukin-1� in vivo and invitro, measured by specific immunoradiometric assay. J. Mol.Endocr. 11, 31–36.

Hailman, E., Vasselon, T., Kelley, M., Busse, L.A., Hu,M.C-T., Lishenstein, H.S., Detmers, P.A., Wright, S.D., 1996.Stimulation of macrophages and neutrophils by complexes oflipopolysaccharide and soluble CD14. J. Immunol. 156, 4384–4390.

Holst, O., Ulmer, A.J., Brade, H., Flad, H.-D., Rietschel, E.T.,1996. Biochemistry and cell biology of bacterial endotoxins.FEMS Immunol. Med. Microbiol. 16, 83–104.

Iwase, K., Miyanaka, K., Shimizu, A., Nagasaki, A., Gotoh,T., Mori, M., Takiguchi, M., 2000. Induction of endothelialnitric-oxide synthase in rat brain astrocytes by systemiclipopolysaccharide treatment. J. Biol. Chem. 275, 11929–11933.

Jaworowicz Jr., D.J., Korytko, P.J., Singh, L.S., Boje, K.M.,1998. Nitric oxide and prostaglandin E2 formation parallelsblood–brain barrier disruption in an experimental rat model ofbacterial meningitis. Br. Res. Bull. 46, 541–546.

Kang, Y.S., Ohtsuki, S., Takanaga, H., Tomi, M., Hosoya, K.,Terasaki, T., 2002. Regulation of taurine transport at theblood–brain barrier by tumor necrosis factor-alpha, taurine andhypertonicity. J. Neurochem. 83, 1188–1195.

Karanth, S., Lyson, K., McCann, S.M., 1993. Role of nitric oxidein interleukin-2-induced corticotropin-releasing factor releasefrom incubated hypothalami. Proc. Natl. Acad. Sci. U.S.A. 90,3383–3387.

Laflamme, N., Soucy, G., Rivest, S., 2001. Circulating cell wallcomponents derived from gram-negative, not gram-positive,bacteria cause a profound induction of the gene-encodingToll-like receptor 2 in the CNS. J. Neurochem. 79, 648–657.

Lahnardt, S., Lachance, C., Patrizi, S., Lefebvre, S., Follett,P.L., Jensen, F.E., Rosenberg, P.A., Volpe, J.J., Vartanian,T., 2002. The toll like receptor TLR-4 is necessary for

lipopolysaccharide-induced oligodendrocyte injury in the CNS.J. Neurosci. 22, 2478–2486.

Lee, S., Kim, K., Rivier, C., 1999. Nitric oxide stimulatesACTH secretion and the transcription of genes encoding forNGFI-B, corticotropin-releasing factor, corticotropin-releasingfactor receptor type 1, and vasopressin in the hypothalamus ofthe intact rat. J. Neurosci. 19, 7640–7647.

Lee, Y.B., Nagai, A., Kim, S.U., 2002. Cytokines, chemokinesand cytokine receptors in human microglia. J. Neurosci. Res.69, 94–103.

Mayhan, W.G., Heistad, D.D., 1985. Permeability of blood–brainbarrier to various sized molecules. Am. J. Physiol. 248 (HeartCirc. Physiol.), H712–H718.

Mayhan, W.G., 1998. Effect of lipopolysaccharide on thepermeability and reactivity of the cerebral microcirculation:role of inducible nitric oxide synthase. Br. Res. 792, 353–357.

Minami, T., Okazaki, J., Kawabata, A., Kuroda, R., Okazaki,Y., 1998. Penetration of cisplatin into mouse brain bylipopolysaccharide. Toxicology 130, 107–113.

Morrison, D.C., Ryan, J.L., 1987. Endotoxin and diseasemechanisms. Annu. Rev. Med. 38, 417–432.

Olson, N.C., Hellyer, P.W., Dodam, J.R., 1995. Mediators andvascular effects in response to endotoxin. Br. Vet. J. 51, 489–522.

Osburg, B., Peiser, C., Domling, D., Schomburg, L., Ko, Y.T.,Voigt, K,. Bickel, U., 2002. Effect of endotoxin on expressionof TNF receptors and transport of TNF-alpha at the blood–brainbarrier of the rat. Am. J. Physiol. 283 (Endocr. Metab.),E899–E908.

Plata-Salaman, C.R., 1991. Immunoregulators in the nervoussystem. Neurosci. Biobehav. Rev. 15, 185–215.

Quan, N., He, L., Lai, W., 2002. Endothelial activation is anintermediate step for peripheral lipopolysaccharide inducedactivation of paraventricular nucleus. Br. Res. Bull. 59, 447–452.

Quan, N., Whiteside, M., Herkenham, M., 1998. Time courseand localization patterns of interleukin-1beta messenger RNAexpression in brain and pituitary after peripheral administrationof lipopolysaccharide. Neuroscience 83, 281–293.

Raber, J., Koob, G.F., Bloom, F.E., 1995. Interleukin-2 inducescorticotropin-releasing factor release from the amygada andinvolved a nitric oxide mediated signaling: comparison withthe hypothalamic response. J. Pharmacol. Exp. Ther. 272, 815–824.

Ramachandra, R.N., Sehon, A.H., Berczi, I., 1992. Neuro-hormonal host defense in endotoxin shock. Brain Behav.Immun. 6, 157–169.

Schmahl, F.W., Betz, E., Heckers, H., Reinhard, U., Schlote,W., Urbaschek, B., 1980. Metabolic and morphologic brainreactions in shock induced by intracisternal injection ofendotoxin. Adv. Shock Res. 4, 113–117.

Silipo, A., Lanzetta, R., Amoresano, R., Parrilli, M., Molinaro, A.,2002. Ammonium hydroxide hydrolysis: a valuable support inthe MALDI-TOF mass spectrometry analysis of lipid A fattyacid distribution. J. Lipid Res. 43, 2188–2195.

Singh, A.K., 2001. Acute effects of acephate, methamidophos andinterleukin-1 on corticotropin-releasing factor (CRF) synthesis


in and release from the hypothalamus in vitro. Comp. Biochem.Physiol. C 132, 9–24.

Szabo, C., 1996. Physiological and pathophysiological roles ofnitric oxide in the central nervous system. Brain Res. Bull. 41,131–141.

Takahashi, E., Onda, K., Hirano, T., Oka, K., Maruoka, N.,Tsuyuguchi, M., Matsumura, Y., Niitsuma, T., Hayashi, T.,2002. Expression ofc-fos, rather thanc-jun or glucocorticoid-receptor mRNA, correlates with decreased glucocorticoidresponse of peripheral blood mononuclear cells in asthma. Int.Immunopharmacol. 2, 1419–1427.

Turrin, N.P., Gayle, D., Ilyin, S.E., Flynn, M.C., Langhans, W.,Schwartz, G.J., Plata-Salaman, C.R., 2002. Pro-inflammatoryand anti-inflammatory cytokine mRNA induction in theperiphery and brain following intraperitoneal administration ofbacterial lipopolysaccharide. Br. Res. Bull. 54, 443–453.

Ulevitch, R.J., Tobias, P.S., 1995. Receptor dependent mechanismsof cell stimulation by bacterial endotoxin. Ann. Rev. Immunol.13, 437.

Uribe, R.M., Lee, S., Rivier, C., 1999. Endotoxin stimulatesnitric oxide production in the paraventricular nucleus of thehypothalamus through nitric oxide synthase I: correlation withhypothalamic–pituitary–adrenal axis activation. Endocrinology140, 5971–5981.

Van Dam, A.M., Poole, S., Schultzberg, M., Zavala, F., Tilders,F.J., 1998. Effects of peripheral administration of LPS on the

expression of immunoreactive interleukin-1 alpha, beta, andreceptor antagonist in rat brain. Ann. N.Y. Acad. Sci. 840,128–138.

Vasselon, T., Hailman, E., Thieringer, R., Detmers, P.A., 1999.Internalization of monomeric lipopolysacchatide occurs aftertransfer out of cell surface CD14. J. Exp. Med. 190, 509–521.

Veszelka, S., Urbanyi, Z., Pazmany, T., Nemeth, L., Obal, I.,Dung, N.T., Abraham, C.S., Szabo, G., Deli, M.A., 2003.Human serum amyloid P component attenuates the bacteriallipopolysaccharide-induced increase in blood–brain barrierpermeability in mice. Neurosci. Lett. 352, 57–60.

Wright, S.D., Ramos, R.A., Tobias, P.S., Ulevitch, R.J.,Mathison, J.C., 1990. CD14, a receptor for complexes oflipopolysaccharide (LPS) and LPS binding protein. Science249, 1431–1433.

Xaio, H., Banks, W.A., Niehoff, M.L., Morley, J.E., 2001. Effectsof LPS on the permeability of the blood–brain barrier to insulin.Brain Res. 896, 36–42.

Zahringer, U., Lindner, B., Rietschel, E.T., 1994. Molecularstructure of lipid A, the endotoxic center of bacteriallipopolysaccharide. Adv. Carbohydr. Chem. Biochem. 50, 211–276.

Zimmermann, C., Ginis, I., Furuya, K., Klimanis, D., Ruetzler, C.,Spatz, M., Hallenbeck, J.M., 2001. Lipopolysaccharide-inducedischemic tolerance is associated with increased levels ofceramide in brain and in plasma. Br. Res. 895, 59–65.

Documents

How does peripheral lipopolysaccharide induce gene expression in the brain of rats?