How cells use DNA, part 2:TRANSLATION

An overview:Most commonly, what comes to mind is the process by which we take ideas expressed in one language, & make them intelligible in another language.

Often this means a change of script, from one we don’t understand to another we can read.

In the process of translation in a cell, the transcribed message of mRNA is translated to a totally different ‘language’, that of protein.

DNA & RNA are ‘written’ in very similar chemicals, but protein is ‘written’ in an entirely different ‘script’: amino acids.

For Translation we need:

• An ‘edited’ or ‘mature’ mRNA• Ribosomes• An unusual molecule, transfer or tRNA• Lots of available Amino Acids

The overall goal:

• Use the DNA message that was copied out into mRNA to produce a polypeptide or protein.

• This is the second part of the CENTRAL DOGMA

• It relies on the GENETIC CODE.

The tRNA:• Acts as a ‘taxi’ for

Amino Acids• Single stranded, but

folded upon itself into a clover-like shape.

• Able to bind to Amino Acids at one end, and to mRNA at the other.

• The mRNA binding end has an ANTICODON.

• Each Anticodon codes for a different Amino Acid.

The tRNA:

• Amino acids bind at the 3’ end of tRNA.

• This requires some ATP energy!

• The Anticodon binds to a complementary codon sequence on the mRNA.

• i.e. AUG codon = UAC anticodon

The Ribosome:

• Site of translation• Can be free in the

cytoplasm, or associated with the R.E.R., Golgi Body, or Nucleolus.

• Two Subunits Lg/Sm• Able to bind mRNA• Binds tRNA at one of

three sites: E (Exit), P (Peptidyl Aminoacyl) or A (Acetyl Aminoacyl)

The Ribosome:• The mRNA binds in the

groove between the large & small subunits.

• The first tRNA binds to the P Site.

• A second tRNA binds to the A Site.

• This brings the amino acids on each tRNA close enough to form a peptide bond.

• As the ribosome shifts down the mRNA, the first tRNA is bumped into the E site & is released.

The Amino Acids:• 20 different Amino Acids• All have the same basic

structure: central Carbon bound to a Hydrogen, an Amino Group (NH2) and Carboxyl Group (COOH)

• The fourth bond Carbon makes is to a variable group, abbreviated ‘R’

• Each Amino Acid has a unique ‘R’

• Some are nonpolar & hydrophobic (orange), rest are polar/HPhilic

• 2 are acidic, 3 are basic.

The Amino Acids:• During translation, the

Amino Acids ‘meet’ at the ribosome

• When they are brought close together (on the ribosome), the Amino Group of one reacts with the other’s Carboxyl Group.

• In a dehydration synthesis reaction, a peptide bond forms.

Initiating Translation:

• mRNA binds to the Ribosome

• tRNA’s carrying amino acids arrive, binding anticodon to codon

• Peptide bond forms between Amino Acids

Continuing the chain:

• The ribosome now shifts 1 codon, moving the first tRNA into the E Site, the second into the P site, and opening the A site for a new tRNA to bind.

Continuing the chain:

• Many ribosomes can bind to the same mRNA & translate it simultaneously, amplifying the amount of protein made.

Reading the mRNA:• Codons in the mRNA are

‘read’ in threes• Each three-base

combination represents a specific amino acid, & matches a tRNA anticodon

• Some amino acids have only one code; others have several

• Thus, the code is redundant.

Different forms of the Code:

Different forms of the Code:

Different forms of the Code:

How the code works:The DNA Sequence:

TAC AAA GCC TAG GAT ACA ATT

Is translated to the mRNA sequence:

AUG UUU CGG AUC CUA UGU UAA

Which in turn encodes the following sequence of amino acids in a polypeptide:

MET—PHE—ARG—ILE—LEU—CYS—(stop)

Wrapping things up:• There are three mRNA

codons that signal the end of a protein

• They are called STOP CODONS: UAA, UAG, UGA

• *in DNA, these are ATT, ATC, & ACT.

• When it reaches a stop codon, the ribosome releases the mRNA, & translation ends.

Try your hand at this:

mRNA Sequence:AUGCCUCGCAAAGGUUGCCACGUAUA

A

Amino Acid Sequence:

MET PRO ARG LYS GLY CYS HIS VAL Stop