Highly Efficient Staphylococcus carnosus Mutant Selection SystemBased on Suicidal Bacteriocin Activation

Bernhard Krismer,a Mulugeta Nega,b Günther Thumm,b* Fritz Götz,b and Andreas Peschela

Interfaculty Institute of Microbiology and Infection Medicine, Cellular and Molecular Microbiology, Eberhard-Karls-Universität Tübingen, Tübingen, Germany,a andInterfaculty Institute of Microbiology and Infection Medicine, Microbial Genetics, Eberhard-Karls-Universität Tübingen, Tübingen, Germanyb

Strains from various staphylococcal species produce bacteriocin peptides, which are thought to play important roles in bacterialcompetition and offer interesting biotechnological avenues. Many bacteriocins are secreted as inactive prepeptides with subse-quent activation by specific proteolytic cleavage. By deletion of the protease gene gdmP in Staphylococcus gallinarum Tü3928,which produces the highly active lanthionine-containing bacteriocin gallidermin (lantibiotic), a strain was created producinginactive pregallidermin. On this basis, a new suicidal mutant selection system in the food-grade bacterium Staphylococcus car-nosus was developed. Whereas pregallidermin was inactive against S. carnosus, it exerted potent bactericidal activity towardGdmP-secreting S. carnosus strains. To take advantage of this effect, gdmP was cloned in plasmid vectors used for random trans-poson mutagenesis or targeted allelic replacement of chromosomal genes. Both mutagenesis strategies rely on rare recombina-tion events, and it has remained difficult and laborious to identify mutants among a vast majority of bacterial clones that stillcontain the delivery vectors. The gdmP-expressing plasmids pGS1 and pGS2 enabled very fast, easy, and reliable identification oftransposon and gene replacement mutants, respectively. Mutant selection in the presence of pregallidermin caused suicidal inac-tivation of all clones that had retained the plasmids and allowed growth of only plasmid-cured mutants. Efficiency of mutantidentification was several magnitudes higher than standard screening for the absence of plasmid-encoded antibiotic resistancemarkers and reached 100% specificity. Thus, the new pregallidermin-based mutant selection system represents a substantial im-provement of staphylococcal mutagenesis methodology.

The genus Staphylococcus belongs to the low-GC-contentGram-positive bacteria and includes important human patho-

gens, such as Staphylococcus aureus and Staphylococcus epidermi-dis, along with some apathogenic, food-grade coagulase-negative(CoNS) species, such as Staphylococcus xylosus and Staphylococcuscarnosus, which play important roles in food technology and bio-technology. The two latter species are used as starter cultures inraw sausage fermentation (13), and S. carnosus has never beenfound outside meat products (45). S. carnosus is also widely usedin molecular biology since a comprehensive set of methods hasbeen developed, enabling efficient transformation with DNA (2,20, 21), protein expression and secretion (14), and surface displayof recombinant proteins or epitopes (46, 50). Comparison of dif-ferent S. carnosus isolates by pulsed-field gel electrophoresis re-vealed that the S. carnosus strains form a homogeneous geneticgroup with only little variability between the strains (41). Therecently sequenced genome of S. carnosus TM300 (42, 43) de-picted the lack of mobile elements, thereby confirming the stabil-ity and usefulness of this strain for genetic engineering. The ab-sence of homologs of most of the S. aureus and S. epidermidisleukocidins, superantigens, binding proteins, and biofilm-relatedica operon underscores the lack of pathogenicity and the food-grade character of S. carnosus. Several staphylococcal species pro-duce bacteriocin peptides that kill closely related strains and en-dow the producers with fitness benefits. Bacteriocins bearingposttranslationally introduced lanthionine rings (lantibiotics)have been described in S. epidermidis (e.g., epidermin) and Staph-ylococcus gallinarum (gallidermin) (5, 25) and have been shown toact mainly as cell wall biosynthesis inhibitors and only marginallyas pore-forming peptides (6, 12). Gallidermin and many otherbacteriocins are secreted as inactive prepeptides that require pro-

cessing of an N-terminal leader peptide by a cognate protease foractivation (19).

A variety of plasmid vectors has been constructed by our andother groups, enabling cloning (3, 11, 28, 51) or constitutive (10)or xylose-inducible recombinant gene expression, optionally withcodon-optimized His tag fusions (16, 40, 52). Whereas plasmidmaintenance usually is desired for cloning or expression experi-ments, for certain mutagenesis approaches the loss of a plasmidsubsequent to the recombination event and the discriminationbetween plasmid-bearing and plasmid-free cells is required. Theseinclude (i) transposon mutagenesis and (ii) gene replacement byhomologous recombination for the construction of knockoutmutants. Because transposition and homologous recombinationare very rare events, both strategies often rely on plasmids withtemperature-sensitive replicons for efficient plasmid curing at el-evated temperatures and simultaneous selection for the presenceof antibiotic resistance mediated by the transposon or by an allelicreplacement cassette. However, even at nonpermissive tempera-tures, most of the bacterial cells retain the plasmid, and it remainsa very tedious and labor-intensive procedure to isolate thousandsof colonies and screen them to discriminate between true mutantsand plasmid-bearing cells.

Received 22 July 2011 Accepted 8 December 2011

Published ahead of print 16 December 2011

Address correspondence to Bernhard Krismer, bernhard.krismer@med.uni-tuebingen.de.

* Present address: SMP GmbH, Service für Medizinprodukte, Tübingen, Germany.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.06290-11

1148 aem.asm.org 0099-2240/12/$12.00 Applied and Environmental Microbiology p. 1148–1156

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Here, we report on the development of a suicidal mutant selec-tion system, based on the inactive precursor of the lantibiotic gal-lidermin, which enables only plasmid-free cells to grow and makeslaborious colony isolation dispensable. Pregallidermin is activatedby cleavage of the leader peptide by the secreted protease GdmP inStaphylococcus gallinarum Tü3928 (5). We show that insertion ofthe protease gene gdmP into transposon delivery or allelic replace-ment vectors leads to activation of pregallidermin and suicide ofGdmP-producing cells, thereby selecting growth of only thosebacteria that have lost the plasmid.

MATERIALS AND METHODSBacterial strains and growth conditions. Bacterial strains and plasmidsare listed in Table 1. Standard growth media were Luria-Bertani brothfor Escherichia coli (44) and basic medium (BM; 1% soy peptone, 0.5%yeast extract, 0.5% NaCl, 0.1% glucose, 0.1% K2HPO4, pH 7.2) forStaphylococcus strains. For high-level production of gallidermin andpregallidermin, the previously published production medium YE4 wasused (50 g/liter Ohly KAT yeast extract [Deutsche Hefewerke], 45g/liter CaCl2, and 5 g/liter maltose, pH 7.2) (30). When necessary,media were supplemented with ampicillin (100 �g/ml), tetracycline(12.5 �g/ml), chloramphenicol (10 �g/ml), or erythromycin (2.5 or 5�g/ml). Liquid cultures were grown in Erlenmeyer flasks with baffles at37°C and 160 rpm on a rotary shaker.

Transformation of staphylococcal strains with plasmid DNA. Stan-dard molecular techniques were performed as described elsewhere (44).Chemically competent E. coli DH5� cells were made and transformedafter a modified protocol of Hanahan as described in the QIAexpressionisthandbook (22). Plasmids were introduced into S. carnosus by protoplasttransformation (21) and into S. aureus RN4220 by electroporation (2). S.gallinarum Tü3928 was transformed by electroporation by an alternativemethod (23). While S. carnosus can be directly transformed with DNA

isolated from E. coli, S. gallinarum accepts only DNA of staphylococcalorigin. For this reason, the knockout plasmid pBT-HOM �gdmP wasconstructed in E. coli and subsequently transferred to S. aureus RN4220,from which the plasmid was reisolated and finally used to transform S.gallinarum Tü3928. Plasmid DNA was isolated using the QIAfilter plas-mid midikit (Qiagen GmbH, Hilden, Germany) for larger culture vol-umes and the peqGOLD plasmid miniprep kit I columns (peqlab Biotech-nologie GmbH, Erlangen, Germany) for culture volumes up to 10 ml asdescribed by the manufacturers. Plasmid isolation from staphylococcirequired an incubation step with lysostaphin (obtained from DR. PETRYgenmedics GmbH, Reutlingen, Germany) in the resuspension buffer (1 to1.5 U/ml original culture volume) at 37°C for 20 to 30 min until the cellsuspensions became viscous, indicating cell lysis.

DNA manipulation and sequencing. DNA was manipulated accord-ing to standard procedures. All restriction enzymes were obtained fromFermentas GmbH (now part of Fisher Scientific, St. Leon-Roth, Ger-many) or Roche (Basel, Switzerland). High-fidelity polymerase, also fromFermentas GmbH, was used for all PCRs. Primers used for PCR or DNAsequencing were obtained from Eurofins MWG Operon (Ebersberg, Ger-many) (Table 2). DNA sequencing of cloned fragments was done byGATC Biotech AG (Konstanz, Germany) or in-house on a LI-COR 4200DNA sequencer (Lincoln Corporation, Lincoln, NE), on which chromo-somal sequencing of transposon mutants was performed. For sequenceanalysis, the programs DNAsis (Hitachi, San Francisco, CA) and Laser-gene (DNAStar, Inc., Madison, WI) were used.

Construction of an S. gallinarum �gdmP::erm knockout mutant.Since the published sequence of the gallidermin gene cluster endsclose to the start codon of gdmP (23, 49) (GenBank accession no.DQ367437), it was necessary to determine its upstream sequence,which was achieved by direct chromosomal sequencing with the LI-COR 4200 system (with the first five primers listed in Table 2). Chro-mosomal DNA of S. gallinarum Tü3928 was used to sequence about 1kb upstream of gdmP. As the basis for the knockout vector pBT-HOM

TABLE 1 Bacterial strains and plasmids

Bacterial strain or plasmid Relevant strain characteristic(s)a

Reference and/or source

StrainsE. coli DH5� F� �80lacZ�M15 �(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rk

� mk�)

phoA supE44 thi-1 gyrA96 relA1 ��

22

Staphylococcus carnosus TM300 Wild-type isolate, deficient of �SK1 45Staphylococcus gallinarum Tü3928 Wild-type isolate 29Staphylococcus gallinarum �gdmP::erm mutant Deletion mutant in gdmP of S. gallinarum Tü3928 This studyStaphylococcus aureus RN4220 Intermediate strain for cloning derived from NCTC 8325, restriction deficient 31

PlasmidspEC2 Erythromycin resistance cassette vector; Ampr Ermr 9pBT-HOM �gdmP Staphylococcal knockout vector for the deletion of the gdmP gene in S.

gallinarum Tü3928; Ampr Cmr; temp sensitiveThis study

pT182-ST Derivative of pT181-mcs (3) in which the promoter and signal peptide of sceA(Sca_1598) and the transcriptional terminator of sceD (Sca_1599) from S.carnosus TM300 are cloned (secretion vector); Tetr

This study

pT182-gdmP The gdmP gene from S. gallinarum Tü3928 was amplified by PCR (primerpair gdmP1/gdmP2) and cloned in pT182-ST

This study

pBT2-srtA Staphylococcal knockout vector for the deletion of the sortase gene in S.carnosus TM300; Ampr Cmr; temp sensitive

33

pGS1 Staphylococcal knockout vector; derivative of pBT2; the EcoRI-PstI fragmentfrom pT182-gdmP encoding gdmP was cloned into pBT2 (Eco47III-AflIIIpartially digested)

This study

pGS1-�srtA The EcoRI-SacI fragment from pBT2-srtA was cloned into pGS1 This studypGS2 Staphylococcal transposon plasmid for the transposition of Tn917; temp

sensitive; the gdmP-containing EcoRI-EcoNI fragment from pGS1 wascloned into pTV1ts (53); Cmr

This study

a Ampr, ampicillin resistance; Cmr, chloramphenicol resistance; Ermr, erythromycin resistance; Tetr, tetracycline resistance.

Pregallidermin Selection System

February 2012 Volume 78 Number 4 aem.asm.org 1149

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

�gdmP, we used the temperature-sensitive shuttle vector pBT2 (9).The 1,754-bp flanking region FR1 downstream of gdmP (Fig. 1) wasamplified with primers Pri-gdm-EcoRI and Pri-gdm-BamHI and sub-sequently digested with EcoRI and BamHI. Upstream of gdmP, a1,135-bp fragment was amplified with the primer pair Pri-gdm-SmaIand Pri-gdm-PstI, with subsequent digestion with the indicated re-striction enzymes (Fig. 1). The amplicon of FR2 still contained theN-terminal 395 nucleotides of gdmP. The two restricted flanking re-gions FR1 and FR2 were ligated into EcoRI-SmaI-digested pBT2 to-gether with the 1,477-bp BamHI-PstI-digested erythromycin resis-tance cassette from pEC2 (9). The resulting plasmid pBT-HOM�gdmP was used to transform S. gallinarum Tü3928.

Construction of the vector pT182-gdmP for GdmP secretion in S.carnosus. pT182 is a derivative of pT181-mcs (3) of which two fragments(a 725-bp HindIII fragment and a 375-bp HhaI-AflIII fragment) wereconsecutively deleted. For the efficient expression and secretion of heter-ologous proteins, the promoter and the signal peptide of sceA (Sca_1598)and the transcriptional terminator of sceD (Sca_1599) from S. carnosusTM300 were amplified by PCR and cloned into pT182 to produce pT182-ST. Heterologous genes can be fused to the signal peptide sequence, andthe resulting fusion proteins should be secreted by S. carnosus after cleav-age by the signal peptidase I. gdmP was amplified from chromosomal S.gallinarum Tü3928 DNA with primers GdmP1 and GdmP2, resulting in a

1,331-bp fragment coding for amino acids 25 to 461 that was restrictedwith BamHI and subsequently ligated into the BamHI- and ScaI-digestedpT182-ST, resulting in pT182-gdmP.

Cloning of the recombination selection vectors pGS1 and pGS1-�srtA. pBT2, which has often been successfully used for the constructionof allelic replacement mutants in staphylococci (9, 16, 18, 33, 34), wasused as a basis for the construction of a pregallidermin selection-basedknockout vector. For this purpose, the gdmP-containing EcoRI-PstI frag-ment, including the promoter and terminator sequences described above,was isolated from pT182-gdmP and subsequently ligated into theEco47III-AflIII (partially)-digested pBT2, after Klenow enzyme treat-ment of both fragments. gdmP has a clockwise orientation in the finalconstruct pGS1, in contrast to the cat resistance gene. For the constructionof pGS1-�srtA, the EcoRI-SacI fragment of the previously describedpBT2-srtA (33) was isolated and ligated into the equally digested pGS1.The final construct was used to transform S. carnosus TM300 by proto-plast transformation.

Cloning of the transposon mutant selection vector pGS2. pTV1ts(53) is frequently used for generation of Tn917 transposon mutant librar-ies and was used as a basis for a gdmP-expressing Tn917 delivery vector.Since pBT2 (and therefore also pGS1) has been derived from pTV1ts (9),the two plasmids share a large portion of sequence identity. For cloning ofgdmP in pTV1ts, the EcoRI-EcoNI part of pTV1ts was replaced by thecorresponding fragment of pGS1. The resulting pGS2 is not a shuttlevector, for which reason the ligation product had to be transferred directlyinto S. carnosus TM300 by protoplast transformation.

Accomplishment of transposon mutagenesis and homologous re-combination. The transposition procedure was performed as describedearlier (15). In principle, the procedures for homologous recombinationand transposon mutagenesis are very similar. Briefly, a colony of the de-sired S. carnosus strain was used to inoculate 25 ml of BM and was grownovernight at the permissive temperature (30°C) with chloramphenicol (10�g/ml) and erythromycin (2.5 �g/ml) for the homologous recombinationprocedure or chloramphenicol (10 �g/ml) and erythromycin (5 �g/ml)for the transposition procedure. The enhanced erythromycin concentra-tion induces increased transposase expression and therefore transpositionof Tn917 (47). Fresh BM (100 ml prewarmed to 40°C) with an erythro-mycin concentration of 2.5 �g/ml was inoculated with 100 �l of the 30°Covernight culture and incubated at 40°C. This was repeated three times,and serial dilutions of each culture were finally plated on agar plates con-taining selective or nonselective conditions (see Results).

Purification of gallidermin and pregallidermin. The purification ofgallidermin was performed as described earlier via XAD-1180 with sub-sequent preparative high-performance liquid chromatography (HPLC)(29) and the same method turned out to be appropriate for purification of

TABLE 2 Primers used in this study

Primer name Primer sequence (5=¡3=)GdmP do AAATTTCTTCATATAGCACCCCTC700-gdm 12730 CTCTGGCATATAAGTCCGCTCGATAG800-gdm 12841 AGAATAGCATGTTATTCATGACGAAGG700-gdm13083 CATCTGAGTTTGTGATTGCC700-gdm13255 CCTGAACAATTCAGGCGACGdmP1 ATGATTATACTTTTGGATCCTCATATAATGAGGdmP2 ACTTCAATCTTTAAGTAATTTGTATACGPri-gdm-SmaI AAATTTCCCGGGTATTAATAAGGCAATCACA

AACTCAGATGCCPri-gdm-PstI AAATTTCTGCAGTTACCTTCATTAGTTACTT

TCCGCATATCCCACPri-gdm-BamHI AAAGGTATGGATCCAAAACATTATGGAAGA

GGAAAACTGGACGPri-gdm-EcoRI AAGTCTGAATTCAAACATAATGATGAGTGGT

TAGATCGCdelso1 neu TGAATTCGCCCCATCCAGAGAATACATCGdelsoB TTTGTCGACAGGATTGTGGGTACTGTGG

FIG 1 Construction of an S. gallinarum Tü3928 gdmP mutant. (A) Schematic representation of the biosynthetic and regulatory genes of the gallidermin operon.The genes responsible for transport and producer self-immunity, which are located upstream, are not shown. Flanking regions (FR1 and FR2) were amplified byPCR. (B) The majority of gdmP was replaced by an erythromycin resistance cassette (ermB) located in the same orientation as gdmP, while the ribosomal bindingsite of the neighboring gdmQ was not affected. The chromosomal integration was achieved by allelic replacement via FR1 and FR2 (indicated by dotted lines).

Krismer et al.

1150 aem.asm.org Applied and Environmental Microbiology

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

pregallidermin. Preparative HPLC was performed on a Prontosil 120, 5�m, 250- by 8-mm C18 column (Bischoff Chromatography, Leonberg,Germany) using a linear gradient of 0.1% trifluoroacetic acid (TFA) inwater to 60% acetonitrile containing 0.1% TFA for 25 min at a flow rate of2 ml/min and a detection wavelength of 210 nm.

Analysis of gallidermin and pregallidermin. Pregallidermin and gal-lidermin contents were determined by HPLC on an Agilent 1200 HPLCsystem equipped with a diode array detection system using an XBridgeC18, 5 �m, 150- by 4.6-mm (inner diameter) column (Waters) with alinear gradient of 0 to 100% acetonitrile in 0.1% H3PO4 for 15 min at aflow rate of 1.5 ml/min. Elution was monitored at 210, 230, 254, 260, 280,and 310 nm, with a simultaneous recording of UV/Vis spectra of eachpeak.

RESULTSInactivation of gdmP in S. gallinarum Tü3928 leads to produc-tion of inactive pregallidermin. S. gallinarum Tü3928 producesmature, antimicrobially active gallidermin by extracellular cleav-age of the N-terminal leader peptide from pregallidermin (5). Inorder to generate a strain that produces pregallidermin but is un-able to remove the leader peptide, the gene of the pregallidermin-processing protease GdmP was deleted in S. gallinarum. gdmP wasreplaced with an erythromycin resistance cassette in such a waythat expression of the gdmQ gene, which is located downstream ofgdmP in a putative operon, should not be affected (Fig. 1).

HPLC analysis of culture filtrates demonstrated that the gallider-min peak was absent in the S. gallinarum Tü3928 �gdmP::erm mu-tant. Instead, the mutant produced a new peak which eluted slightlyearlier (6.11 � 0.02 min for the mutant versus 6.46 � 0.02 min for the

wild type) and showed an absorption spectrum very similar to that ofgallidermin (Fig. 2A and C). The running behavior of the new peakcorresponded to the previously described peak of pregallidermin(49), and it exhibited the characteristic absorption at 270 nm result-ing from posttranslational oxidative decarboxylation of the pregalli-dermin C terminus (32). Preparative amounts of the putative pregal-lidermin were isolated from S. gallinarum Tü3928 �gdmP::ermmutant cultures grown in YE4 medium, which had proven useful forhigh-level gallidermin production (30). Subsequent adsorption chro-matography with XAD-1180 resin followed by preparative HPLC re-sulted in a highly pure peptide preparation, as demonstrated byHPLC (Fig. 2D), and lacked any antimicrobial activity. For compar-ative studies, gallidermin was purified essentially in the same wayfrom the S. gallinarum Tü3928 wild type.

GdmP-expressing S. carnosus TM300 is able to activate pre-gallidermin. In order to evaluate if recombinant gdmP expressionmay lead to suicidal activation of pregallidermin by S. carnosus, agdmP-expressing S. carnosus strain was created. In order to obtaina high level of secretory GdmP production, gdmP was cloned inplasmid pT182-ST and expressed by a strong, constitutive S. car-nosus promoter. The mature protein part, including its predictedpropeptide (gdmP�1-24), was fused with the signal peptide of astrongly secreted S. carnosus protein. Both the promoter and thesignal peptide were derived from the S. carnosus sceA gene of un-known function (Sca_1598) which had been identified in a screen-ing program for strong, constitutive S. carnosus expression andsecretion signals (B. Krismer, unpublished results).

FIG 2 Identification of pregallidermin in the culture supernatant of the S. gallinarum Tü3928 �gdmP::erm mutant and in vitro conversion into active galliderminby culture filtrate of S. carnosus TM300 pT182-gdmP. (A) After cultivation of the S. gallinarum Tü3928 �gdmP::erm mutant in gallidermin production mediumYE4, a peak can be detected after 6.1 min of retention. (B) One hour of incubation of the filter-sterilized culture supernatant from panel A with supernatant ofthe GdmP-producing S. carnosus TM300 pT182-gdmP in the ratio 1:1 at 37°C results in the reduction of the pregallidermin peak at 6.1 min and the appearanceof a peak at 6.46 min corresponding to active gallidermin. (C) UV/Vis absorption spectra of the HPLC peak eluting at 6.1 min and of purified gallidermin,showing overall spectrum similarity and the characteristic absorption at 270 nm, supporting the assumption that the newly appearing peak is pregallidermin. (D)HPLC chromatogram showing the different retention times of purified gallidermin and pregallidermin (1 mg/ml gallidermin; 0.5 mg/ml pregallidermin). Thedetection wavelength in Fig. 2A, B, and D was 210 nm.

Pregallidermin Selection System

February 2012 Volume 78 Number 4 aem.asm.org 1151

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

S. carnosus containing the resulting plasmid pT182-gdmP wassusceptible to inhibition by the pregallidermin producer (Fig. 3),while S. carnosus containing the empty control plasmid pT182 wasresistant, indicating that GdmP was produced in an active formand in sufficient amounts to permit the formation of active galli-dermin. Coincubation of equal amounts of culture filtrates fromthe S. gallinarum Tü3928 �gdmP::erm mutant and S. carnosuspT182-gdmP led to a decrease of the putative pregallidermin peakin HPLC with simultaneous appearance of the gallidermin peak(Fig. 2B). These findings confirm that the inactive peptide pro-duced by the S. gallinarum Tü3928 �gdmP::erm mutant repre-sents in fact pregallidermin and that GdmP was expressed in S.carnosus as an active protein that is able to process pregallidermininto active gallidermin.

Low pregallidermin concentrations are sufficient to inhibitgdmP-expressing S. carnosus. The MIC of gallidermin in liquidculture for S. carnosus TM300 has been found to be ca. 0.02 �g/ml(24). In order to define the pregallidermin concentration requiredto inhibit growth of gdmP-expressing S. carnosus on solid me-dium, we tested the colony-forming ability of S. carnosus pT182-gdmP on agar plates containing increasing amounts of pregalli-dermin (Fig. 4A). The lowest concentration of 0.01 �g/ml did notaffect growth of the test strain. A total of 0.05 �g/ml led to a visiblereduction in colony size but not to a reduction in total CFU num-bers. When plating the strain on 0.1 �g/ml pregallidermin, onlyabout 3 to 5% of the cells were able to grow to small colonies, butat a concentration of 0.5 �g/ml, sufficient amounts of pregallider-min were converted into active gallidermin, leading to completegrowth inhibition of S. carnosus TM300 pT182-gdmP.

Since pregallidermin was found to be very useful to discrimi-nate between S. carnosus strains with or without a plasmid ex-pressing GdmP, it was obvious to take advantage of this selectivepower for the selection of gene replacement or transposon mu-tants. Because a requirement for purified pregallidermin could bean obstacle for routine experiments, we evaluated if the additionof culture filtrates from the S. gallinarum Tü3928 �gdmP::erm

mutant to agar plates may lead to results similar to those obtainedwhen using purified pregallidermin. In fact, the addition of as littleas 0.2 to 0.4% of pregallidermin-containing culture filtrate to agarplates was sufficient to inhibit growth of the gdmP-expressing S.carnosus strain (Fig. 4B). This finding is in accordance with therecently described productivity of a gdmP mutant at nonopti-mized culture conditions (49).

Interestingly, purified pregallidermin showed no inhibitoryactivity on S. carnosus pT182, when no GdmP was produced asexpected, whereas culture supernatant of the pregallidermin pro-ducer exhibited some inhibitory activity in the 1:100 dilution andtotal inhibition in the 1:50 dilution (Fig. 4B). It supports the rea-sonable suspicion that the culture supernatant of the S. gallinarum�gdmP::erm mutant contains some mature gallidermin, presum-ably generated by unspecific proteolytic cleavage. This smallamount was not detectable by HPLC but clearly showed activitydue to the high sensitivity of S. carnosus to gallidermin.

Highly efficient gene replacement with the gdmP-encodingplasmid pGS1. Strategies for targeted gene deletion in staphylo-cocci rely largely on temperature-sensitive plasmid replicons,such as that of pE194ts, and selection for plasmid-encoding resis-tance genes which should replace chromosomal genes by homol-ogous recombination (17). However, homologous recombinationis a very rare event in staphylococci, and pE194ts-derived plas-mids are lost only slowly, even at nonpermissive temperatures.Thus, it has remained quite laborious to identify clones that havein fact lost the plasmid and retained a resistance marker uponallelic replacement. In order to utilize the suicidal growth inhibi-

FIG 3 Suicidal conversion of inactive pregallidermin into active galliderminby a GdmP-secreting S. carnosus TM300 strain. The gallidermin producer S.gallinarum Tü3928 (A) produces active gallidermin, thereby inhibiting S. car-nosus pT182 (upper plate) and pT182-gdmP (lower plate). The S. gallinarum�gdmP::erm mutant (B) produces pregallidermin, which has no effect on S.carnosus pT182 (upper plate) but is converted into active gallidermin by S.carnosus pT182-gdmP (lower plate), leading to suicidal growth inhibition ofthe protease producer.

FIG 4 Determination of the selective pregallidermin (PG) concentration onthe GdmP-expressing S. carnosus TM300 (pT182-gdmP). The pictures showagar plates with increasing concentrations of pregallidermin (A) or filter-sterilized culture supernatant of the S. gallinarum �gdmP::erm mutant (B). (A)Whereas 0.01 �g/ml pregallidermin has no significant influence on CFU num-bers and colony morphology, 0.05 �g/ml pregallidermin led to a slight de-crease in colony size but not in CFU numbers. A total of 0.1 �g/ml pregalli-dermin results in colony formation of about 3 to 5% of plated cells, whereas 0.5�g/ml pregallidermin results in complete inhibition of GdmP-expressing S.carnosus cells. The control S. carnosus pT182 is not affected by 0.5 �g/mlpregallidermin. (B) Filter-sterilized culture supernatant of the S. gallinarum�gdmP::erm mutant has only little growth inhibitory impact on S. carnosuspT182 at a dilution rate of 1:100 and an inhibitory effect at a 1:50 dilution. Incontrast, the 1:1,000 dilution has already a strong growth inhibitory effect on S.carnosus pT182-gdmP.

Krismer et al.

1152 aem.asm.org Applied and Environmental Microbiology

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

tion of gdmP-expressing S. carnosus for the enrichment of cloneswhich had lost the plasmid, the gdmP fragment along with theupstream promoter from pT182-gdmP was cloned in the regu-larly used gene replacement vector pBT2 (9). The resulting plas-mid, pGS1 (Fig. 5), retained a multiple cloning site for the cloningof homologous DNA flanking the gene to be deleted and a portionof the E. coli plasmid pBR322 to permit easy cloning in E. coli.pGS1 was reasonably stable and could easily be used to transformS. carnosus TM300.

The usefulness of pGS1 for targeted gene replacement was eval-uated by deleting the sortase A gene, srtA, which has recently beenshown to be dispensable for viability of S. carnosus TM300 (33).The erythromycin resistance gene flanked by DNA fragments ad-jacent to the S. carnosus srtA from pBT2-srtA was cloned in pGS1.S. carnosus with the resulting plasmid pGS1-�srtA was unable togrow on pregallidermin-containing agar plates, even at the per-missive temperature of 30°C. The strain was then repeatedly cul-tivated in the presence of erythromycin at a nonpermissive tem-perature (40°C) to allow for allelic replacement and plasmidcuring. Aliquots of each culture were plated on agar containingerythromycin and pregallidermin. Already after the first culture at40°C, several clones could be identified that were resistant toerythromycin and pregallidermin. By plating the identical sampleson agar lacking pregallidermin, it could be estimated that only0.13% of all erythromycin-resistant clones at the same time werepregallidermin resistant, indicating the expected recombinationevent with subsequent plasmid loss. This percentage increased to8.89% after a second culture and remained at this low level evenafter a third culture (Table 3). After each 40°C culture, 16 colonies(48 colonies in total) growing on erythromycin and pregallider-min were analyzed for the presence of srtA by PCR (with primerpair delso1 neu/delsoB) and all were found to be correct srtA de-letion mutants. Thus, selection for mutants generated with thegdmP-encoding pGS1 on pregallidermin-containing agar plates isa highly discriminatory, efficient, and fast procedure yielding al-most exclusively the desired deletion mutants after the first 40°Csubculture.

Fast and reliable construction of transposon mutant librar-ies with the gdmP-encoding plasmid pGS2. In staphylococci,transposon mutant libraries are usually constructed using a trans-poson delivery vector with the temperature-sensitive pE194ts rep-licon. However, transposition is a very rare event, and the selec-

tion for clones that have lost the plasmid and contain thetransposon integrated into the chromosome is equally difficultand laborious as the identification of correct gene replacementmutants. To test if the pregallidermin selection system is also suit-able for the construction of a transposon library in S. carnosusTM300, plasmid pGS2 was constructed by fusing the Tn917-encoding plasmid pTV1ts with the gdmP gene cassette describedabove (Fig. 5). The resulting plasmid pGS2 was used to transformS. carnosus, which was then serially cultivated at permissive andnonpermissive temperature. Samples were spotted on agar platescontaining erythromycin to select for the presence of Tn917 orplated on erythromycin plus pregallidermin to select for the pres-ence of Tn917 and loss of pGS2. Already after cultivation at 30°C,a few double-resistant clones were identified whose number in-creased steadily in subsequent cultures at 40°C. Further analysisshowed that the unexpectedly obtained colonies from the 30°Cculture were still chloramphenicol resistant and therefore plasmidcontaining, indicating a defect in gdmP expression, which mightbe explained by a transposon insertion in gdmP. In contrast, allanalyzed clones resulting from the 40°C cultures were found tohave lost the plasmid and to have the transposon integrated intothe chromosome. The percentage of cells growing on erythromy-cin and pregallidermin compared to that growing on erythromy-cin alone increased from 0.0015% in the 30°C culture to ca. 0.1%,

FIG 5 Schematic presentation of the newly constructed pregallidermin selection vectors pGS1 and pGS2. The shuttle vector pGS1 is a derivative of the allelicreplacement vector pBT2 (9), sharing the same multiple cloning site (MCS). For counterselection on pregallidermin, gdmP was inserted. In contrast, pGS2 is noshuttle vector and is replicating only in Gram-positive bacteria. It was generated by the insertion of gdmP into the transposon delivery vector pTV1ts (53). BothpGS1 and pGS2 share a large portion of identity. The location of the transposon Tn917 is indicated by the double arrow. bla, �-lactamase resistance gene; gdmP,gallidermin protease gene; cat, chloramphenicol resistance gene; repY, replication protein gene; erm, erythromycin resistance gene; tnpR, resolvase gene; tnpA,transposase gene.

TABLE 3 Percentage of gene replacement or transposon mutantsgenerated with pGS1-�srtA or pGS2, respectively, versus total numbersof bacteriaa

Culture% of �srtAmutants

% of transposonmutants

30°C culture 0 0.0015b

40°C culture no. 1 0.13 0.1540°C culture no. 2 8.89 20.540°C culture no. 3 7.37 4240°C culture no. 4 ND 99a Given is the mean value of CFU (in %) on agar plates containing erythromycin andpregallidermin compared to CFU on agar plates with only erythromycin from fourindependent experiments (�srtA mutant screening) or two independent experiments(transposon mutant screening). ND, not determined.b This percentage of cells, which is still chloramphenicol resistant, very likely reflects thenumber of cells with the transposon integrated in gdmP, enabling growth onpregallidermin-containing agar plates.

Pregallidermin Selection System

February 2012 Volume 78 Number 4 aem.asm.org 1153

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

20%, 40%, and 100% during the 4 subcultures at 40°C, respec-tively (see Table 3). Thus, pGS2 allows for the rapid and reliableidentification of transposon mutants without long cultivation atstressful growth conditions.

Transposon mutants generated in S. carnosus with pGS2 wereevaluated by screening for the loss of �-galactosidase (LacH) ac-tivity and acid production from mannitol. A total of 1,300 mutantclones were replica plated either on BM agar containing the col-orimetric LacH substrate X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside) or on Morse medium containing 1% man-nitol (37). Defects in �-galactosidase activity were detected by theformation of white or light-blue colonies instead of dark-blueones. Metabolism of mannitol leads to acidification of the me-dium surrounding the colonies, changing the red-orange color ofthe medium into intense yellow. For each of the two assays, threemutants with a changed phenotype could be identified. Chromo-somal sequencing of the mutant strains revealed the exact Tn917insertion sites, which are graphically shown in Fig. 6. The three�-galactosidase activity mutants had inserts in lacP, lacR, andodhA (Fig. 6A). LacP, the lactose permease, and LacR, the regula-tor of the tagatose-6-phosphate pathway, are directly involved inlactose utilization, while the hypothetical protein OdhA showshomology to the 2-oxoglutarate decarboxylase, an enzyme of thecitric acid cycle whose absence may affect lacH expression or ac-tivity in an indirect way. Surprisingly, all of the mannitol utiliza-tion mutants had Tn917 insertions at different positions of themtlA gene or its promoter (Fig. 6B). MtlA represents the IIBCcomponent of the mannitol-specific phosphotransferase system(PTS) involved in the import of mannitol. Thus, the mutants werenot able to conduct the sugar uptake, for which reason no acidproduction could be detected.

DISCUSSION

S. carnosus has become a well-studied organism over the last 2decades, with possible applications in food technology, biotech-nology, or molecular biology. A substantial number of S. carnosus

genes have been investigated by mutant analyses, and some newprotein functions have been elucidated (27, 38). Such studies usu-ally involve large transposon mutant screening programs and theconstruction of defined knockout mutants, which have remainedassociated with labor-intensive procedures to find the desired mu-tants among thousands of isolated colonies. Since the release ofthe genome sequence of S. carnosus TM300, the straightforwarddesign of defined mutants has been facilitated, while the availablemethodology for mutant construction has hardly improved. Bothrandom and targeted mutagenesis strategies are based on rare re-combination events, and it has remained difficult and laborious toidentify mutants among a vast majority of bacterial clones that stillcontain the delivery vectors. Our study demonstrates that mu-tagenesis vectors modified to express the S. gallinarum GdmP pro-tease represent very efficient and reliable tools for the generationof transposon mutant libraries or targeted gene replacement mu-tants. Of note, it was possible to isolate hundreds of S. carnosuscolonies per agar plate, although in the plated aliquots thousandsof GdmP-producing cells were still present. This could be ex-plained by very early GdmP expression and secretion (mediatedby the sceA promoter in front of gdmP) and subsequent immediatekilling of the producers. The concentration of converted activegallidermin in the agar plate seems not to be high enough to in-hibit neighboring plasmid-free cells. All the clones that grew onpregallidermin-containing agar were shown to be correct mu-tants, while the standard selection procedure yielded mutants onlyat ca. 0.1% to 0.2% of the bacterial clones at early stages of themutagenesis procedure. As mutagenesis is carried out at ratherstressful conditions at temperatures above 40°C, which may selectfor compensatory second-site mutations, it is of major interest toshorten such phases as much as possible. We cannot rule out thatspontaneous mutations in gdmP may occur that render bacteriaresistant to pregallidermin even if the plasmid is not yet lost. How-ever, we did not find such spontaneous mutants in our experi-ments, indicating that the rapid bactericidal property of gallider-min precludes the formation of significant numbers of gdmP

FIG 6 Schematic presentation of the sequencing of Tn917 mutants with impaired �-galactosidase activity (A) or absent acid production from mannitol (B). Atotal of 1,300 Tn917 mutants obtained on erythromycin- and pregallidermin-containing agar plates were screened by replica plating on X-Gal agar plates fordefects in �-galactosidase activity and mannitol-containing Morse agar plates for defects in mannitol utilization, respectively. Three independent mutants wereobtained for each screening. (A) Chromosomal sequencing showed the Tn917 insertions in the genes for the lactose transporter lacP, the lactose operon regulatorlacR, or the odhA gene encoding a hypothetical protein with homology to the 2-oxoglutarate-decarboxylase sucA. (B) The three mutants in mannitol utilizationall had the Tn917 insertion in different positions of the mtlA transcript, encoding the (EII) component of the mannitol-specific PTS system.

Krismer et al.

1154 aem.asm.org Applied and Environmental Microbiology

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

mutants. The selection procedure did not even require purifiedgallidermin, as small amounts of culture filtrates of gdmP-deficient S. gallinarum gave the same results. Thus, the pGS1- andpGS2-based mutant selection system represents a straightforwardand cheap technique for generating mutants in S. carnosus.

A number of other plasmid vectors have been described forstaphylococci that help to reduce the screening efforts and im-prove the yields of correct mutants. The integration vectorpMUTIN, originally developed for Bacillus subtilis (48), has beensuccessfully used in S. aureus. This vector enables the site-specificintegration of alleles into the chromosome, thereby generating,e.g., fluorescent fusion proteins (39). Since pMUTIN is a nonrep-licative vector, it allows only a one-step gene inactivation directlyafter transformation. Since double crossovers, required for suchgene replacement strategies, are rare events, a very high transfor-mation rate is required with a nonreplicative vector to obtain mu-tants after transformation. Although different transformationmethods have been described for S. carnosus (2, 36), none of themleads to transformation rates sufficient for the usage of nonrepli-cative delivery vectors. Previously, the shuttle vector pMAD, en-coding a �-galactosidase gene, was described, which allows allelicrecombination with subsequent colorimetric blue-white discrim-ination of bacteria. Clones which have lost the plasmid are visibleas white colonies on X-Gal plates, significantly facilitating mutantidentification after allelic exchange and plasmid loss (1). This sys-tem works well for S. aureus, which carries an endogenousphospho-�-galactosidase gene that does not cleave X-Gal (7, 8). Incontrast, the S. carnosus genome carries the �-galactosidase genelacH, which makes blue-white selection impossible. The only realcounterselection plasmid system for staphylococci has been de-scribed by Bae and Schneewind. It relies on the inducible expres-sion of secY antisense RNA by the pKOR1 vector for allelic replace-ment strategies (4). Since secY is an essential gene in staphylococci(26), growth of plasmid-bearing cells is strongly affected after in-duction. pKOR1 has been successfully used in S. aureus and alsoonce in S. epidermidis (35), but it is unclear whether it would workin S. carnosus, since the S. aureus and S. carnosus secY genes shareonly 83% identity.

In conclusion, the newly described suicidal counterselectionsystem, based on the activation of a bacteriocin precursor, allowsthe extremely fast and highly efficient identification and isolationof plasmid-free mutants in S. carnosus at which false-positiveclones can nearly be excluded. With this method, it should bepossible to also create mutants with severe growth defects, whichare often missed in conventional mutagenesis procedures. It re-mains to be investigated if the pGS1- and pGS2-based selectionmethod is transmissible to other staphylococci or even less-relatedspecies. However, staphylococci and related Gram-positive bacte-ria differ largely in their susceptibilities to gallidermin and in theproduction of proteases that may interfere with the selection pro-cess, either by activation of pregallidermin in correct mutants orby gallidermin inactivation by GdmP-expressing clones. Thus, thenew selection system will need to be carefully evaluated and opti-mized for other bacterial species.

ACKNOWLEDGMENTS

We thank Gabriele Hornig for technical assistance and Dirk Kraus forhelpful discussions.

This work was supported by the German Ministry of Research and

Education (SkinStaph) to A.P. and by a fund of the German industry (DR.PETRY genmedics GMBH) to B.K. and F.G.

REFERENCES1. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient

allelic replacement in naturally nontransformable, low-GC-content,Gram-positive bacteria. Appl. Environ. Microbiol. 70:6887– 6891.

2. Augustin J, Gotz F. 1990. Transformation of Staphylococcus epidermidisand other staphylococcal species with plasmid DNA by electroporation.FEMS Microbiol. Lett. 54:203–207.

3. Augustin J, et al. 1992. Genetic analysis of epidermin biosynthetic genesand epidermin-negative mutants of Staphylococcus epidermidis. Eur. J.Biochem. 204:1149 –1154.

4. Bae T, Schneewind O. 2006. Allelic replacement in Staphylococcus aureuswith inducible counterselection. Plasmid 55:58 – 63.

5. Bierbaum G, et al. 1996. The biosynthesis of the lantibiotics epidermin,gallidermin, Pep5 and epilancin K7. Antonie Van Leeuwenhoek 69:119–127.

6. Bonelli RR, Schneider T, Sahl HG, Wiedemann I. 2006. Insights into invivo activities of lantibiotics from gallidermin and epidermin mode-of-action studies. Antimicrob. Agents Chemother. 50:1449 –1457.

7. Breidt F, Jr, Stewart GC. 1986. Cloning and expression of the phospho-beta-galactosidase gene of Staphylococcus aureus in Escherichia coli. J. Bac-teriol. 166:1061–1066.

8. Breidt F, Jr, Stewart GC. 1987. Nucleotide and deduced amino acidsequences of the Staphylococcus aureus phospho-beta-galactosidase gene.Appl. Environ. Microbiol. 53:969 –973.

9. Bruckner R. 1997. Gene replacement in Staphylococcus carnosus andStaphylococcus xylosus. FEMS Microbiol. Lett. 151:1– 8.

10. Bruckner R. 1992. A series of shuttle vectors for Bacillus subtilis andEscherichia coli. Gene 122:187–192.

11. Charpentier E, et al. 2004. Novel cassette-based shuttle vector system forGram-positive bacteria. Appl. Environ. Microbiol. 70:6076 – 6085.

12. Christ K, et al. 2008. Membrane lipids determine the antibiotic activity ofthe lantibiotic gallidermin. J. Membr. Biol. 226:9 –16.

13. Corbiere Morot-Bizot S, Leroy S, Talon R. 2007. Monitoring of staph-ylococcal starters in two French processing plants manufacturing dry fer-mented sausages. J. Appl. Microbiol. 102:238 –244.

14. Dilsen S, et al. 2000. Fed-batch production of recombinant human cal-citonin precursor fusion protein using Staphylococcus carnosus as anexpression-secretion system. Appl. Microbiol. Biotechnol. 54:361–369.

15. Fast B, Lindgren PE, Gotz F. 1996. Cloning, sequencing, and character-ization of a gene (narT) encoding a transport protein involved in dissim-ilatory nitrate reduction in Staphylococcus carnosus. Arch. Microbiol. 166:361–367.

16. Fedtke I, Kamps A, Krismer B, Gotz F. 2002. The nitrate reductase andnitrite reductase operons and the narT gene of Staphylococcus carnosus arepositively controlled by the novel two-component system NreBC. J. Bac-teriol. 184:6624 – 6634.

17. Foster TJ. 1998. Molecular genetic analysis of staphylococcal virulence.Methods Microbiol. 27:433– 454.

18. Gaupp R, Schlag S, Liebeke M, Lalk M, Gotz F. 2010. Advantage ofupregulation of succinate dehydrogenase in Staphylococcus aureus bio-films. J. Bacteriol. 192:2385–2394.

19. Geissler S, Gotz F, Kupke T. 1996. Serine protease EpiP from Staphylo-coccus epidermidis catalyzes the processing of the epidermin precursorpeptide. J. Bacteriol. 178:284 –288.

20. Gotz F, Kreutz B, Schleifer KH. 1983. Protoplast transformation ofStaphylococcus carnosus by plasmid DNA. Mol. Gen. Genet. 189:340 –342.

21. Gotz F, Schumacher B. 1987. Improvements of protoplast transforma-tion in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285–288.

22. Hanahan D. 1983. Studies on transformation of Escherichia coli withplasmids. J. Mol. Biol. 166:557–580.

23. Hille M. 2002. Untersuchungen zur Biosynthese der Lantibiotika Galli-dermin und Epidermin. Dissertation. Eberhard-Karls-Universität, Tübin-gen, Germany.

24. Hille M, Kies S, Gotz F, Peschel A. 2001. Dual role of GdmH in producerimmunity and secretion of the staphylococcal lantibiotics gallidermin andepidermin. Appl. Environ. Microbiol. 67:1380 –1383.

25. Jack RW, Sahl HG. 1995. Unique peptide modifications involved in thebiosynthesis of lantibiotics. Trends Biotechnol. 13:269 –278.

26. Ji Y, et al. 2001. Identification of critical staphylococcal genes using

Pregallidermin Selection System

February 2012 Volume 78 Number 4 aem.asm.org 1155

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from

conditional phenotypes generated by antisense RNA. Science 293:2266 –2269.

27. Kamps A, Achebach S, Fedtke I, Unden G, Gotz F. 2004. StaphylococcalNreB: an O(2)-sensing histidine protein kinase with an O(2)-labile iron-sulphur cluster of the FNR type. Mol. Microbiol. 52:713–723.

28. Keller G, Schleifer KH, Gotz F. 1983. Construction and characterizationof plasmid vectors for cloning in Staphylococcus aureus and Staphylococcuscarnosus. Plasmid 10:270 –278.

29. Kellner R, et al. 1988. Gallidermin: a new lanthionine-containing poly-peptide antibiotic. Eur. J. Biochem. 177:53–59.

30. Kempf M, Theobald U, Fiedler HP. 1999. Economic improvement of thefermentative production of gallidermin by Staphylococcus gallinarum.Biotechnol. Lett. 21:663– 667.

31. Kreiswirth BN, et al. 1983. The toxic shock syndrome exotoxin structuralgene is not detectably transmitted by a prophage. Nature 305:709 –712.

32. Kupke T, Kempter C, Gnau V, Jung G, Gotz F. 1994. Mass spectroscopicanalysis of a novel enzymatic reaction. Oxidative decarboxylation of thelantibiotic precursor peptide EpiA catalyzed by the flavoprotein EpiD. J.Biol. Chem. 269:5653–5659.

33. Leibig M, et al. 2008. Marker removal in staphylococci via Cre recombi-nase and different lox sites. Appl. Environ. Microbiol. 74:1316 –1323.

34. Leibig M, et al. 2011. Pyruvate formate lyase acts as a formate supplier formetabolic processes during anaerobiosis in Staphylococcus aureus. J. Bac-teriol. 193:952–962.

35. Li M, et al. 2007. Gram-positive three-component antimicrobial peptide-sensing system. Proc. Natl. Acad. Sci. U. S. A. 104:9469 –9474.

36. Lofblom J, Kronqvist N, Uhlen M, Stahl S, Wernerus H. 2007. Opti-mization of electroporation-mediated transformation: Staphylococcus car-nosus as model organism. J. Appl. Microbiol. 102:736 –747.

37. Morse ML, Alire ML. 1958. An agar medium indicating acid production.J. Bacteriol. 76:270 –271.

38. Pantel I, Lindgren PE, Neubauer H, Gotz F. 1998. Identification andcharacterization of the Staphylococcus carnosus nitrate reductase operon.Mol. Gen. Genet. 259:105–114.

39. Pereira PM, Veiga H, Jorge AM, Pinho MG. 2010. Fluorescent reportersfor studies of cellular localization of proteins in Staphylococcus aureus.Appl. Environ. Microbiol. 76:4346 – 4353.

40. Peschel A, Ottenwalder B, Gotz F. 1996. Inducible production andcellular location of the epidermin biosynthetic enzyme EpiB using an im-

proved staphylococcal expression system. FEMS Microbiol. Lett. 137:279 –284.

41. Planchon S, et al. 2007. Surface properties and behaviour on abioticsurfaces of Staphylococcus carnosus, a genetically homogeneous species.Food Microbiol. 24:44 –51.

42. Rosenstein R, Gotz F. 2010. Genomic differences between the food-gradeStaphylococcus carnosus and pathogenic staphylococcal species. Int. J.Med. Microbiol. 300:104 –108.

43. Rosenstein R, et al. 2009. Genome analysis of the meat starter culturebacterium Staphylococcus carnosus TM300. Appl. Environ. Microbiol. 75:811– 822.

44. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

45. Schleifer KH. 1982. Description of a new species of the genus Staphylo-coccus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32:153–156.

46. Strauss A, Gotz F. 1996. In vivo immobilization of enzymatically activepolypeptides on the cell surface of Staphylococcus carnosus. Mol. Micro-biol. 21:491–500.

47. Tomich PK, An FY, Clewell DB. 1980. Properties of erythromycin-inducible transposon Tn917 in Streptococcus faecalis. J. Bacteriol. 141:1366 –1374.

48. Vagner V, Dervyn E, Ehrlich SD. 1998. A vector for systematic geneinactivation in Bacillus subtilis. Microbiology 144(Part 11):3097–3104.

49. Valsesia G, Medaglia G, Held M, Minas W, Panke S. 2007. Circumvent-ing the effect of product toxicity: development of a novel two-stage pro-duction process for the lantibiotic gallidermin. Appl. Environ. Microbiol.73:1635–1645.

50. Wernerus H, Lehtio J, Samuelson P, Stahl S. 2002. Engineering ofstaphylococcal surfaces for biotechnological applications. J. Biotechnol.96:67–78.

51. Wernerus H, Stahl S. 2002. Vector engineering to improve a staphylo-coccal surface display system. FEMS Microbiol. Lett. 212:47–54.

52. Wieland KP, Wieland B, Gotz F. 1995. A promoter-screening plasmidand xylose-inducible, glucose-repressible expression vectors for Staphylo-coccus carnosus. Gene 158:91–96.

53. Youngman PJ, Perkins JB, Losick R. 1983. Genetic transposition andinsertional mutagenesis in Bacillus subtilis with Streptococcus faecalis trans-poson Tn917. Proc. Natl. Acad. Sci. U. S. A. 80:2305–2309.

Krismer et al.

1156 aem.asm.org Applied and Environmental Microbiology

on August 7, 2019 by guest

http://aem.asm

.org/D

ownloaded from