Upload
ellard
View
43
Download
4
Tags:
Embed Size (px)
DESCRIPTION
Development & Optimization of a Sensitive & Specific Quantitative Real-Time PCR Assay for Borrelia lonestari. HaoQi (Esther) Li 06/21/06 – 08/11/06. U.S. Naval Medical Research Center. Infectious Diseases Directorate Rickettsial Diseases Department 503 Robert Grant Avenue - PowerPoint PPT Presentation
Citation preview
Development & Development & Optimization of a Sensitive Optimization of a Sensitive
& Specific Quantitative & Specific Quantitative Real-Time PCR Assay for Real-Time PCR Assay for
Borrelia lonestariBorrelia lonestariHaoQi (Esther) LiHaoQi (Esther) Li
06/21/06 – 08/11/0606/21/06 – 08/11/06
U.S. Naval Medical Research U.S. Naval Medical Research CenterCenter
Infectious Diseases Infectious Diseases DirectorateDirectorate
Rickettsial Diseases Rickettsial Diseases DepartmentDepartment
503 Robert Grant 503 Robert Grant AvenueAvenue
Silver Spring, MD Silver Spring, MD 2091020910
MentorsMentors Dr. Allen RichardsDr. Allen Richards Former Director of Former Director of
Rickettsial Diseases Rickettsial Diseases DepartmentDepartment
Dr. Ju JiangDr. Ju Jiang Naval Medical Naval Medical
Research Center Research Center ScientistScientist
OrganizationOrganization
My role: science My role: science researcherresearcher
Working environment:Working environment: Clean roomClean room Dirty hoodDirty hood Smart cyclersSmart cyclers SafetySafety
Problem/RationaleProblem/Rationale
Borrelia lonestariBorrelia lonestariNewly discoveredNewly discoverednot related to not related to RickettsiaRickettsia
Southern Tick-Associated Rash Illnesses Southern Tick-Associated Rash Illnesses (STARI)(STARI)Resembles Lyme diseaseResembles Lyme diseaseNot Not Borrelia burgdorferiBorrelia burgdorferiDiagnosis problemDiagnosis problem
Purpose/GoalPurpose/Goal
To find a molecular probe sensitive and To find a molecular probe sensitive and specific for specific for Borrelia lonestari Borrelia lonestari flagellin flagellin genegene
Borrelia lonestari Borrelia lonestari BacteriaBacteria
Spirochete is spiral shapedSpirochete is spiral shapedCarried by lone-star ticks Carried by lone-star ticks
http://www.health.state.ok.us/program/cdd/STARI.htm
The Borrelia burgdorferi spirochete:the agent of Lyme disease
http://www.marvistavet.com/html/body_lyme_disease.html
Infection of BacteriaInfection of Bacteria
Rash IllnessesRash IllnessesLocationLocation
http://newsletter.mydna.com/health/diseases/lyme/othertick/staritick.html
Patient with a classic erythema migrans; 1) site of tick bite, 2) red, radial, expanding edge of rash. 3) central
clearing.
Previous ResearchPrevious Research
Cultured isolationCultured isolation PCR-RFLPPCR-RFLP Deer samplesDeer samples
http://www.policlinicagipuzkoa.com/GeneticaMolecular/imagenes/PROTOMBINA2.jpg
Beacon Probe + qPCRBeacon Probe + qPCRFAM reporter and Black Hole Quencher 1FAM reporter and Black Hole Quencher 1Quantitative real-time PCRQuantitative real-time PCR
http://www.marine.usf.edu/microbiology/nasba.shtml http://bio.takara.co.jp/catalog/catalog_d.asp?C_ID=C1322
AssaysAssays
Find unique sequence of Find unique sequence of B. lonestari B. lonestari
Use full-gene primers to clone the geneUse full-gene primers to clone the gene
11F Primer 594F Primer 655 FAM 719R Primer 970R Primer
Assay MaterialsAssay Materials
NCBI GenBank – findNCBI GenBank – find Basic Local Alignment Search Tool – relateBasic Local Alignment Search Tool – relate ClustalW – alignClustalW – align GeneDoc – color unique bpGeneDoc – color unique bp
Gene Sequence (5’ – 3’) starting from 655 base pair
Borrelia species GCAGCTCCAGCTCCAGCAGCAGCTCCAGCTCAAGGTGGAGTTAA
Borrelia lonestari CCAGCTCCAGCTC AAGGTGGGATTAG
Optimization TestsOptimization Tests
PrimersPrimersProbeProbeMgClMgCl22Annealing TemperatureAnnealing Temperature
Concentration variations testing all done Concentration variations testing all done by qPCRby qPCR
Sensitivity TestsSensitivity Tests
Full gene PCRFull gene PCRConcentration calculation Concentration calculation qPCR standard testsqPCR standard tests
Specificity TestsSpecificity Tests
TypesTypes 7 related 7 related Borrelia Borrelia
spp.spp. 23 non-related 23 non-related
bacteria DNAbacteria DNA
HypothesisHypothesis qPCRqPCR
No. Borrelia Bacterial DNANon-Borrelia Bacterial
DNA 1 B. recurrentis R. prowazekii Breinl2 B. coriaceae* R. typhi Wilmington3 B. burgdorferi R. canadensis4 B. afzelii R. rickettsii VR 8915 B. hermsii R. conorii6 B. garinii R. parkeri 7 B. duttoni R. montanensis8 R . slovaca9 R. sibirica
10 R. japonica 11 R. akari12 Escherichia coli13 Proteus mirabilis OXK14 Salmonella enterica15 Legionella pneumophila16 Francisella persica17 Bartonella quintana18 Bartonella vinsonii19 Neorickettsia sennetsu20 Neorickettsia risticii21 Orientia tsutsugamushi 22 Staphylococcus aureus 23 Corynebacterium sp
Results: Initial Testing of AssayResults: Initial Testing of Assay
Results: Transformant DNA Results: Transformant DNA
Results: Assay SensitivityResults: Assay Sensitivity
Results: Assay Sensitivity LineResults: Assay Sensitivity Line
Results: Assay SpecificityResults: Assay Specificity
Negative resultsNegative results ImplicationsImplications
Conclusions Conclusions
• Primers and probe Primers and probe • create a specific and sensitive create a specific and sensitive B. lonestariB. lonestari
qPCR assay. qPCR assay. • The assayThe assay
• SensitiveSensitive• SpecificSpecific
• Future researchFuture research• clinical samplesclinical samples
ReflectionsReflectionsWonderful learning experienceWonderful learning experiencePatient, informative mentorsPatient, informative mentorsRelaxed environmentRelaxed environmentLong drive, but worth the effortLong drive, but worth the efforthttp://www.nmrc.navy.mil/nmrc_stdt_main.http://www.nmrc.navy.mil/nmrc_stdt_main.
htmhtmhttp://http://www.asee.org/SEAP/index.cfmwww.asee.org/SEAP/index.cfm
AcknowledgementsAcknowledgements
• Dr. Allen L. Richards, Director Rickettsial Diseases Dr. Allen L. Richards, Director Rickettsial Diseases DepartmentDepartment
• Dr. Ju Jiang, Navy Medical Research CenterDr. Ju Jiang, Navy Medical Research Center• Dr. Barbara Wood, Thomas Jefferson High School Dr. Barbara Wood, Thomas Jefferson High School
for Sci. & Tech.for Sci. & Tech.• Mr. Fred Lampazzi, Thomas Jefferson High School Mr. Fred Lampazzi, Thomas Jefferson High School
for Sci. & Tech.for Sci. & Tech.• Joey Flyer, University of RochesterJoey Flyer, University of Rochester• Science & Engineering Apprentice Program, NMRCScience & Engineering Apprentice Program, NMRC• TJHSST Mentorship ProgramTJHSST Mentorship Program
Literature CitedLiterature Cited Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S. Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S.
(2001, May/June). (2001, May/June). Borrelia lonestari Borrelia lonestari DNA in adult DNA in adult Amlyomma americanumAmlyomma americanum ticks, Alabama. ticks, Alabama. Emerging Infectious Diseases, 7Emerging Infectious Diseases, 7(3), 471-473.(3), 471-473.
Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of lyme disease Borreliae. typing of lyme disease Borreliae. International Journal of Systematic Bacteriology, 46International Journal of Systematic Bacteriology, 46(4), 898-(4), 898-905.905.
Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Orientia tsutsugamushiOrientia tsutsugamushi. . American Society of Tropical Medicine and Hygiene, 70American Society of Tropical Medicine and Hygiene, 70(4), 351-356.(4), 351-356.
Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Rickettsia Rickettsia prowazekiiprowazekii and and Borrelia recurrentisBorrelia recurrentis. In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. . In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. Raoult (Eds.), Raoult (Eds.), Rickettsiology present and future directionsRickettsiology present and future directions (pp. 302-310). New York: New York (pp. 302-310). New York: New York Academy of Sciences. From Academy of Sciences. From Rickettsiology Present and Future DirectionsRickettsiology Present and Future Directions..
Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Detection of Detection of Borrelia lonestariBorrelia lonestari, putative agent of southern tick-associated rash illness, in white-, putative agent of southern tick-associated rash illness, in white-tailed deer (tailed deer (Odocoileus virginianusOdocoileus virginianus) from the southeastern United States. ) from the southeastern United States. Journal of Clinical Journal of Clinical Microbiology, 41Microbiology, 41(1), 424-427.(1), 424-427.