FEMS Yeast Research 4 (2004) 789–794

www.fems-microbiology.org

Hansenula polymorpha Tup1p is important forperoxisome degradation

Adriana N. Le~ao-Helder, Arjen M. Krikken, Marcel G.J. Lunenborg, Jan A.K.W. Kiel,Marten Veenhuis, Ida J. van der Klei *

Eukaryotic Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen,

P.O. Box 14, 9750 AA Haren, The Netherlands

Received 9 February 2004; received in revised form 22 April 2004; accepted 22 April 2004

First published online 18 May 2004

Abstract

In the yeast Hansenula polymorpha peroxisomes are selectively degraded upon a shift of cells from methanol to glucose-con-

taining media. We identified the H. polymorpha TUP1 gene by functional complementation of the peroxisome degradation deficient

mutant pdd2-4. Tup1 proteins function in transcriptional repression of specific sets of genes involved in various cellular processes.

Our combined data indicate that H. polymorpha TUP1 is involved in regulation of the switch between peroxisome biogenesis and

selective degradation. The initial DNA fragment that complemented H. polymorpha pdd2-4 contained a second gene, encoding

H. polymorpha Vps4p. Deletion of the VPS4 gene did not affect selective peroxisome degradation.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Yeast; Peroxisome homeostasis; Hansenula polymorpha; ATG genes

1. Introduction

Peroxisomes are membrane-bound organelles that

harbour enzymes involved in a wide range of metabolic

pathways. In the yeast Hansenula polymorpha these or-ganelles are massively induced during growth of cells on

methanol and are crucial to support growth since they

contain the key enzymes of methanol metabolism: al-

cohol oxidase (AO), dihydroxyacetone synthase

(DHAS) and catalase (CAT). Upon a shift of methanol-

grown cells into fresh glucose-containing media these

organelles become redundant for growth and are rapidly

and selectively degraded. We have isolated variousH. polymorpha mutants defective in selective peroxisome

degradation (pdd mutants [1]) and identified the first

H. polymorpha PDD genes [2,3].

* Corresponding author. Tel.: +31-50-363-2176/2167;

fax: +31-50-363-8280/5205.

E-mail address: i.j.van.der.klei@biol.rug.nl (I.J. van der Klei).

1567-1356/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsyr.2004.04.006

Here we report the cloning of the H. polymorpha

PDD2 gene, which encodes a protein similar to yeast

Tup1 proteins. Tup1 proteins are involved in tran-

scriptional repression of distinct sets of genes that play a

role in various cellular processes like glucose repression,mating type regulation, flocculation and bud–hypha

transition [4–6].

Our data suggest that H. polymorpha Tup1p is in-

volved in the repression of specific genes upon induction

of selective peroxisome degradation, which are neces-

sary to allow selective peroxisome degradation to

proceed.

2. Materials and methods

2.1. Micro-organisms and growth conditions

Hansenula polymorpha cells were grown at 37 �C in

minimal media containing 0.67% yeast nitrogen base

(DIFCO) supplemented with 1% glucose (YND) or

. Published by Elsevier B.V. All rights reserved.

790 A.N. Le~ao-Helder et al. / FEMS Yeast Research 4 (2004) 789–794

0.5% methanol (YNM), or mineral media (MM [7])

supplemented with 0.5% glucose or 0.5% methanol. The

following strains have been used: (i) NCYC 495 leu1.1

ura3 [8], (ii) the original pdd2-4 mutant [1], (iii) the

TUP1 deletion strain (tup1; this study) and (iv) theVPS4 deletion strain (vps4; this study).

2.2. DNA techniques

The primers used in this study are listed in Table 1.

DNA manipulations were carried out according to es-

tablished techniques [9–11]. DNA sequencing was per-

formed at BaseClear (Leiden, The Netherlands) using aLiCor automated DNA-sequencer and dye primer

chemistry (LiCor, Lincoln, NB). For DNA sequence

analysis, the Clone Manager 5 program (Scientific and

Educational Software, Durham, USA) was used. The

BLASTP algorithm [12] was used to screen databases at

the National Center for Biotechnology Information

(Bethesda, MD). The ClustalX program was used to

align protein sequences [13].Hansenula polymorpha pdd2-4 cells were transformed

with a H. polymorpha genomic library [14]; prototrophic

transformants were screened for their ability to degrade

peroxisomes using the AO activity plate assay [1]. The

smallest complementing plasmid, pPDD2-30, contained

a 6.5-kb insert that was sequenced. The nucleotide re-

Table 1

Primers used in this study

Name Sequence

PDD2-S 50-CACTTGCCTCGCCTGTCTGATC-

PDD2-AS 50-GAAGTTAGCGTCGAAACTGAAG

TUP1-1 5′ AGAGAGAGGCGGCCGCACCTCGT NotI

TUP1-2 5′ GAAGATCTCCACGGTTGCTGCTTCBglII

TUP1-3 50-GCGGATGCTGCTGAGACTGG-3

TUP1-4 5′ CCATCGATAACGGGCCAATCAGA ClaI

VPS4-1 5′ CGGGATCCGGTGTTTTAGTACTTGBamHI

VPS4-2 5′ AGAGAGAGGCGGCCGCCGAGTTG NotI

VPS4-3 5′ AACTGCAGCCGGCAATATGACAGPstI

VPS4-4 5′ CCATCGATGCAGAGATGTGTCAT ClaI

gion of the complementing region (4.1 kb) was deposited

at GenBank (Accession No. AY383553).

To identify the mutation in pdd2-4, the corresponding

DNA region was amplified by PCR using Pwo poly-

merase and primers PDD2-S and PDD2-AS (Table 1).Two independent PCR products were digested with

XbaI and XhoI and cloned into XbaI/ SalI-digested

pYT3 prior to sequencing.

2.3. Gene disruptions

A H. polymorpha TUP1 deletion strain (tup1) was

constructed as follows. First, DNA fragments compris-ing two regions of the TUP1 gene (corresponding to

nucleotides 1818–2601 and 3484–4147 in GenBank Ac-

cession No. AY383553) were obtained by PCR using

pPDD2-30 as template and primers TUP1-4+TUP1-3

and TUP1-2+TUP1-1 (Table 1). The corresponding

PCR products were digested with ClaI/PstI and BglII/

NotI and cloned, respectively, upstream and down-

stream the H. polymorpha URA3 gene present in thepBSK-URA3 vector [15], generating plasmid pBSK-

URA3-Tup1. The 2.4-kb DraI/DrdI fragment from the

pBSK-URA3-Tup1 plasmid was transformed into H.

polymorpha NCYC495 leu1.1 ura3.

For construction of a H. polymorpha VPS4 deletion

strain (vps4), DNA fragments comprising two regions of

30

C-30

TCGTATAAATCC 3′

GCCG 3′

0

ACACG 3′

GAGC 3′

TCGAAGGTGGTGG 3′

CTTCC 3′

GAGAG 3′

A.N. Le~ao-Helder et al. / FEMS Yeast Research 4 (2004) 789–794 791

the VPS4 gene (corresponding to nucleotides 75–656

and 1004–1515 in GenBank Accession No. AY383553)

were obtained by PCR using pPDD2-30 as template and

the primers VPS4-2+VPS4-1 and VPS4-3+VPS4-4

(Table 1). The resulting PCR products were digestedwith NotI/BamHI and PstI/ClaI, respectively and cloned

downstream and upstream the H. polymorpha URA3

gene present in the pBSK-URA3 vector, giving rise to

plasmid pBSK-URA3-Vps4. The 2.2-kb DrdI/AatII

fragment from plasmid pBSK-URA3-Vps4 was trans-

formed into H. polymorpha NCYC495 leu1.1 ura3. Of

both above mutants uracil prototrophic colonies were

selected and correct insertion was confirmed by South-ern-blot analysis.

2.4. Biochemical methods

The presence of carboxypeptidase (CPY) protein in

culture media was determined as described previously

[16]. Preparation of crude extracts, SDS–PAGE and

Western-blot analyses were performed by establishedprocedures.

2.5. Morphological analysis

Intact cells were prepared for electron microscopy as

detailed before [17].

3. Results

3.1. Functional complementation of Hansenula polymor-

pha pdd2-4

To clone the gene that is affected in H. polymorpha

pdd2-4, cells of this strain were transformed using a H.

polymorpha genomic library. Three colonies were ob-tained that showed a decrease in AO activity upon

replica-plating cells from methanol to glucose-contain-

ing agar plates, a property that is indicative for normal

peroxisome degradation. The complementing plasmids

of the strains were rescued in Escherichia coli and re-

introduced into pdd2-4 cells. All three plasmids

appeared to be able to complement the defect in per-

oxisome degradation of the H. polymorpha pdd2-4 mu-tant strain, based on the AO activity plate assay (data

not shown). Restriction analysis revealed that these

plasmids contained overlapping inserts ranging in size

from 6.5 to 20 kb. Sequencing of the smallest insert

(pPDD2-30) revealed the presence of two ORFs

(Fig. 1(a)). The first ORF encodes a protein of 439

amino acids that shared homology to Vps4 proteins of

various organisms (73% identity to Vps4p of Saccharo-myces cerevisiae and 59% identity to H. sapiens Vps4-

Bp; see Fig. 1(b)). We designated the gene HpVPS 4 and

its translation product HpVps4p.

The second ORF encodes a protein of 602 amino

acids that was 55% identical to Tup1p of Candida albi-

cans and 46% identical to S. cerevisiae Tup1p. Tup1

proteins are characterised by seven WD40 repeats in the

carboxyterminal domain (Fig. 1(c)). We designated thisORF HpTUP1 and the corresponding protein

HpTup1p.

A subclone containing the XbaI–XhoI fragment of the

pPDD2-30 insert was constructed. This plasmid enables

the expression of only HpTUP1. Upon transformation

of this plasmid to pdd2-4 cells, AO activity plate assays

indicated that the expression ofHpTUP1 gene alone was

sufficient to complement the deficiency in peroxisomedegradation of this strain. This was confirmed

biochemically, using cells grown in liquid cultures.

Western-blot analysis of crude extracts, prepared of H.

polymorpha pdd2-4 cells transformed with pYT3-TUP1,

revealed that the AO protein levels gradually decreased

after exposure of methanol-grown to glucose excess

conditions (Fig. 2). A similar pattern was observed in

WT control cells, while in cells of the pdd2-4 straintransformed with the empty plasmid (pYT3) AO protein

levels remained virtually unaffected.

In order to analyse the mutation in HpTUP1 that

caused the peroxisome degradation-deficient phenotype

of the pdd2-4 strain, a genomic DNA fragment con-

taining the TUP1 gene was amplified by PCR and se-

quenced. Analysis of two independent PCR products

revealed a point mutation (cytosine to thymine) at basepair +577. This mutation results in a truncated protein

as it turns a glutamine codon into a stop codon

(Fig. 1(c)).

3.2. Characterisation of the H. polymorpha tup1 and

vps4 strains

A H. polymorpha TUP1 deletion strain (tup1) wasconstructed by replacing 882 bp from the TUP1 ORF

(corresponding to amino acids 127 to 421) by the H.

polymorpha URA3 gene (Fig. 1(a)). The tup1 strain grew

normally on glucose, glycerol and methanol (not

shown). Upon a shift of methanol-grown tup1 cells to

glucose excess conditions, the levels of AO did not sig-

nificantly decrease (Fig. 2). Morphological analysis re-

vealed that, like in cells of the original pdd2-4 mutant,peroxisomes were not degraded. Occasionally, partially

sequestered peroxisomes were observed. However, fu-

sion of sequestered peroxisomes with vacuoles, an event

that precedes uptake of the organelle for proteolytic

degradation, was not observed (Fig. 3).

VPS gene products may play an essential role in se-

lective peroxisome degradation as well [3]. To confirm

that HpTUP1 represents the sole complementing activ-ity on the original complementing plasmid, we analysed

peroxisome degradation in a constructed H. polymor-

phaVPS4 deletion strain (vps4) as well. The vps4 strain

Fig. 1. Schematic representation of the H. polymorpha chromosomal region containing VPS4 and TUP1 (a), alignments of HpVps4p (b) and

HpTup1p (c). In (a) the strategies to constructH. polymorpha tup1 and vps4 strains are indicated as well. (b) shows an alignment of HpVps4p with S.

cerevisiae (SwissProt P52917) andH. sapiens (SwissProt O75351) homologs. The AAA-ATPase domain is underlined by black bars. White regions in

the black bars indicate the Walker A and B motif (� and ��, respectively). In (c) HpTup1p is aligned with its C. albicans (SwissProt P56093) and S.

cerevisiae (P16649) counterparts. The seven WD repeats are underlined by black bars. Glutamine 193, mutated in H. polymorpha pdd2-4, is indicated

by an arrow. Gaps were introduced to maximize the similarity. Residues that are similar in all three proteins are shaded black and those that are

similar in two of the proteins are shaded dark grey.

792 A.N. Le~ao-Helder et al. / FEMS Yeast Research 4 (2004) 789–794

grew normally on glucose, glycerol and methanol (not

shown). Western-blot analysis indicated that in metha-nol-grown vps4 cells exposed to excess glucose, the AO

protein levels gradually decreased at rates comparable to

the AO decrease in WT control cells (Fig. 2), indicating

that peroxisome degradation is not significantly affected

in vps4.

In Saccharomyces cerevisiae vps4 mutants the vacu-

olar enzyme carboxypeptidase Y (CPY) is mistargeted

and secreted into the growth medium [18]. We observed

that in a constructed H. polymorpha vps4 deletion strain

CPY is secreted as well, confirming its Vps phenotype.As expected, CPY protein was not detectable in media

of WT and pdd2-4 cultures (Fig. 4).

4. Discussion

This paper describes the isolation of the gene that

functionally complements the H. polymorpha pdd2-4

Fig. 2. Biochemical analysis of selective peroxisome degradation. Cells

of the indicated H. polymorpha strains were grown on methanol media

and shifted to glucose media to induce selective peroxisome degrada-

tion. Samples were taken at the indicated time points after the shift.

Equal volumes of cultures were loaded per lane and analysed for the

presence of AO protein by Western blotting using anti-AO antibodies.

Fig. 4. Western-blot analysis of the presence of CPY protein in media

of WT, pdd2-4 and vps4 cultures. Using anti-CPY antibodies, two

protein bands were detected on Western blots prepared from the me-

dium of a vps4 culture grown for 24 h on YPD media. These bands

most likely represent the pro-(PrCPY) and mature (mCPY) forms of

CPY. In growth media of WT or pdd2-4 cells these bands were absent.

Equal volumes of medium were loaded per lane.

A.N. Le~ao-Helder et al. / FEMS Yeast Research 4 (2004) 789–794 793

mutant. H. polymorpha pdd2-4 has been described to be

defective in selective peroxisome degradation [1], but not

in N-starvation-induced non-selective autophagy (mi-

croautophagy)[19]. The initial complementing DNAfragment contained two ORFs that showed homology

to bakers yeast VPS4 and TUP1 and were designated

HpVPS4 and HpTUP1.

Complementation analysis revealed that the defect in

selective peroxisome degradation in H. polymorpha

pdd2-4 was solely due to a mutation (cytosine to thymine

at position 577) in the HpTUP1 gene. In S. cerevisiae,

Tup1p is involved in repression of transcription of sev-eral sets of genes. These vary from genes involved in

glucose repression, mating-type regulated genes, osmo-

stress-inducible genes to sporulation-related genes [4].

Also in Candida albicans TUP1 is important for the

regulation of a variety of genes, including those involved

in bud-hypha transition and virulence [5]. In the path-

ogenic fungus Penicillium marneffei the Tup1p homo-

logue TupA coordinates cell fate by promoting

Fig. 3. Peroxisome sequestration is affected in tup1 cells. In tup1 cells shifted

but never observed to be completed, a phenomenon that is readily detectable

sequestering membranes into the vacuole in the wild-type cell (left below). Mic

mitochondrion; N, nucleus; P, peroxisome. Marker represents 0.5 lm.)

filamentation and repressing both spore and yeastmorphogenetic programmes [6]. Apparently, Tup1p’s

function is regulating switches from one state to another

(e.g., glucose induction/repression, mating type a/a,yeast/filamentous growth). Tup1p is shown to be re-

cruited to specific sets of promoters through interaction

with specific DNA-binding proteins for each function-

ally related set of genes. It has been suggested that

Tup1p mediates repression by interfering with chroma-tin structure [20] and interaction with the basal tran-

scription machinery [21].

How HpTup1p exactly functions in selective peroxi-

some degradation is still speculative. Most likely

HpTup1p is directly involved in repression of specific

genes, which allow selective peroxisome degradation to

proceed. Hence, selective peroxisome degradation can

be added to the list of cellular processes that are con-trolled via Tup1 proteins. The alternative explanation,

namely that the block in selective peroxisome degrada-

tion in H. polymorpha tup1 cells is solely an indirect

effect due to a defect in glucose repression is unlikely.

This view is consistent with the finding that H. poly-

morpha pdd2-4mutant cells are also impaired in ethanol-

induced peroxisome degradation[1]. Moreover, a H.

polymorpha regulatory mutant has been described that isblocked in glucose repression, but is still capable to

degrade peroxisomes [22]. Hence, peroxisome degrada-

from methanol to glucose, peroxisome sequestration (�) is initiated (b)

in wild-type control cells (a). Note the characteristic protrusion of the

rographs are taken of cells exposed for 30 min to glucose. (KMnO4; M,

794 A.N. Le~ao-Helder et al. / FEMS Yeast Research 4 (2004) 789–794

tion can occur without functional glucose repression.

Future DNA-array studies in which mRNA levels in H.

polymorpha WT cells are compared to tup1 cells during

induction of peroxisome degradation may elucidate

which genes are repressed by HpTup1p.Based on earlier findings that Vps proteins may affect

selective peroxisome degradation we also cloned the

HpVSP4 gene and showed that this gene, as expected, is

involved in vacuolar protein sorting as indicated by the

missorting of vacuolar carboxypeptidase Y (CPY) in a

constructed H. polymorpha VPS4 deletion strain, but

not in selective peroxisome degradation. Vps4p proteins

are AAA-type ATPases and act in a common step re-quired for transport of various proteins out of an en-

dosomal compartment. Most likely vacuolar proteins

like CPY are transported from the Golgi apparatus to

this compartment, prior to trafficking to the vacuole. It

has been shown that in the absence of Vps4p vacuolar,

endocytic and Golgi marker, proteins accumulate in this

compartment, which in S. cerevisiae vps4 cells form

aberrant multilammelar structures (designated the classE-compartment) [18]. Since HpVps4p is not involved in

selective peroxisome degradation, the endosome may

not play an important role in the selective peroxisome

degradation machinery.

Acknowledgements

A.N.L.H. is supported by a grant from CAPES-

Brasilia/UERJ, Brazil. I.J.V.D.K. is supported by a

PIONIER fellowship of the Dutch Organization for the

Advancement of Pure Research (NWO). J.A.K.W.K. is

supported by a grant from NWO. The authors would

like to thank Klaas Sjollema and Patricia Stevens for

skilful technical assistance.

References

[1] Titorenko, V.I., Keizer, I., Harder, W. and Veenhuis, M. (1995)

Isolation and characterization of mutants impaired in the selective

degradation of peroxisomes in the yeast Hansenula polymorpha. J.

Bacteriol. 177, 357–363.

[2] Le~ao, A.N. and Kiel, J.A.K.W. (2003) Peroxisome homeostasis in

Hansenula polymorpha. FEMS Yeast Res. 4, 131–139.

[3] Kiel, J.A.K.W., Komduur, J.A., Van der Klei, I.J. and Veenhuis,

M. (2003) FEBS Lett. 549, 1–6.

[4] Smith, R.L. and Johnson, A.D. (2000) Turning genes off by Ssn6-

Tup1: a conserved system of transcriptional repression in eukary-

otes. Trends Biochem. Sci. 25, 325–330.

[5] Zhao, R., Lockhart, S.R., Daniels, K. and Soll, D.R. (2002) Roles

of TUP1 in switching, phase maintenance, and phase-specific gene

expression in Candida albicans. Euk. Cell 1, 353–365.

[6] Todd,R.B.,Greenhalgh, J.R.,Hynes,M.J. andAndrianopoulos,A.

(2003) TupA, thePenicilliummarneffeiTup1p homologue, represses

both yeast and spore development. Mol. Microbiol. 48, 85–94.

[7] van Dijken, J.P., Otto, R. and Harder, W. (1976) Growth of

Hansenula polymorpha in a methanol-limited chemostat. Physio-

logical responses due to the involvement of methanol oxidase as a

key enzyme in methanol metabolism. Arch. Microbiol. 111, 137–

144.

[8] Gleeson, M.A.G. and Sudbery, P.E. (1988) Genetic analysis in the

methylotrophic yeast Hansenula polymorpha. Yeast 4, 293–

303.

[9] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular

Cloning, A Laboratory Manual, 2nd Edn. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY.

[10] Faber, K.N., Swaving, G.J., Faber, F., Ab, G., Harder, W.,

Veenhuis, M. and Haima, P. (1992) Chromosomal targeting of

replicating plasmids in the yeast Hansenula polymorpha. J. Gen.

Microbiol. 138, 2405–2416.

[11] Faber, K.N., Haima, P., Harder, W., Veenhuis, M. and AB, G.

(1994) Highly-efficient electrotransformation of the yeast Hansen-

ula polymorpha. Curr. Genet. 25, 305–310.

[12] Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,

Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-

BLAST: a new generation of protein database search programs.

Nucleic Acids Res. 25, 3389–3402.

[13] Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F.

and Higgins, D.G. (1997) The CLUSTAL_X windows

interface: flexible strategies for multiple sequence alignment

aided by quality analysis tools. Nucleic Acids Res. 25,

4876–4882.

[14] Tan, X., Waterham, H.R., Veenhuis, M. and Cregg, J.M. (1995)

The Hansenula polymorpha PER8 gene encodes a novel peroxi-

somal integral membrane protein involved in proliferation. J. Cell

Biol. 128, 307–319.

[15] Le�ao-Helder, A.N., Krikken, A.M., Van der Klei, I.J., Kiel,

J.A.K.W. and Veenhuis, M. (2003) Transcriptional down-regula-

tion of peroxisome numbers affects selective peroxisome degrada-

tion in Hansenula polymorpha. J. Biol. Chem. 278, 40749–

40756.

[16] Kiel, J.A.K.W., Rechinger, K.B., van der Klei, I.J., Salomons,

F.A., Titorenko, V.I. and Veenhuis, M. (1999) The Hansenula

polymorpha PDD1 gene product, essential for the selective

degradation of peroxisomes, is a homologue of Saccharomyces

cerevisiae Vps34p. Yeast 15, 741–754.

[17] Waterham, H.R., Titorenko, V.I., Haima, P., Cregg, J.M.,

Harder, W. and Veenhuis, M. (1994) The Hansenula

polymorpha PER1 gene is essential for peroxisome biogenesis

and encodes a peroxisomal matrix protein with both

carboxy- and amino-terminal targeting signals. J. Cell Biol.

127, 737–749.

[18] Babst, M., Sato, T.K., Banta, L.M. and Emr, S.D. (1997)

Endosomal transport function in yeast requires a novel AAA-

type ATPase, Vps4p. EMBO J. 16, 1820–1831.

[19] Bellu, A.R., Kram, A.M., Kiel, J.A.K.W., Veenhuis, M. and Van

der Klei, I.J. (2001) Glucose-induced and nitrogen-starvation-

induced peroxisome degradation are distinct processes in Hansen-

ula polymorpha that involve both common and unique genes.

FEMS Yeast Res. 1, 23–31.

[20] Edmondson, D.G., Smith, M.M. and Roth, S.Y. (1996)

Repression domain of the yeast global repressor Tup1 interacts

directly with histones H3 and H4. Genes Dev. 10, 1247–

1259.

[21] Grom€oller, A. and Lehming, N. (2000) Srb7p is a physical and

physiological target of Tup1p. EMBO J. 19, 6845–6852.

[22] Parpinello, G., Berardi, E. and Strabbioli, R. (1998) A regulatory

mutant of Hansenula polymorpha exhibiting methanol utilization

metabolism and peroxisome proliferation in glucose. J. Bacteriol.

180, 2958–2967.