Electrochemistry Communications 13 (2011) 31–33

Contents lists available at ScienceDirect

Electrochemistry Communications

j ourna l homepage: www.e lsev ie r.com/ locate /e lecom

Graphene quantum dots-based platform for the fabrication ofelectrochemical biosensors

Jing Zhao a,b, Guifang Chen a, Li Zhu a, Genxi Li a,b,⁎a Laboratory of Biosensing Technology, School of Life Sciences, Shanghai University, Shanghai 200444, P. R. Chinab Department of Biochemistry and National Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, P. R. China

⁎ Corresponding author. Tel.: +86 25 83593596; fax:E-mail address: genxili@nju.edu.cn (G. Li).

1388-2481/$ – see front matter © 2010 Elsevier B.V. Aldoi:10.1016/j.elecom.2010.11.005

a b s t r a c t

a r t i c l e i n f o

Article history:Received 29 September 2010Received in revised form 15 October 2010Accepted 1 November 2010Available online 9 November 2010

Keywords:Graphene quantum dotsProbe ssDNATarget DNAThrombinElectrochemical biosensor

Based on the strong interaction between single-stranded DNA (ssDNA) and graphene material, we havedesigned a simple but smart platform in this work to fabricate electrochemical biosensors by using graphenequantum dots modified pyrolytic graphite electrode coupled with specific sequence ssDNA molecules asprobes. Due to the excellent conductivity of graphene material, the modified electrode can exhibit very fineelectrochemical response. Nevertheless, the probe ssDNA will inhibit the electron transfer between theelectrochemical active species [Fe(CN)6]3-/4- and the electrode after the probe molecules are strongly boundto the surface of the modified electrode via their interaction with graphene. However, when the targetmolecules such as target ssDNA or target protein also exist in the test solution, the probe ssDNAwill bind withthe target instead of graphene if the sequence of the probe ssDNA is designed as complementary to the targetDNA or as the aptamer of the target protein. As a result, the obtained peak currents of [Fe(CN)6]3-/4- willincrease with the target molecules, thus various electrochemical biosensors can be easily developed with thisproposed platform. The fabricated electrochemical biosensors may also have high sensitivity and selectivity,which may have potential applications in the future.

+86 25 83592510.

l rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Sensitive, effective and rapid detection of specific biomolecules iscritical in medical diagnosis, biological engineering and environmentalprotection [1]. With the highly developed nanotechniques, numeroussensitive, stable and cost-effective biosensors have been reported byusing different kinds of nanomaterials, such as gold nanoparticles [2–4],carbon nanotubes [5–7] and quantum dots [8–13]. In recent years,graphene, a single atom thick and two dimensional carbonmaterial hasbecome a shining star of nanomaterials and a hotspot for scientificresearch, owing to the outstanding electronic, thermal and mechanicalproperties and good chemical stability [14–16]. Coupled with adye-labeled single-stranded DNA (ssDNA) probe, graphene oxide(GO) has been used for sensitive and selective detection of metal ions,DNA and proteins with the fluorescent detection technique [17,18].Meanwhile, graphene has been used as film material to modifyelectrode surface, which has proven to greatly facilitate electrochemicalbiosensing studies [19–21]. In thiswork, a newmember of the graphenefamily ultrafine graphene quantumdots (GQD) [22] is employed, whichis the nanometer-sized graphene piece with a well-confined shape. So,GQDmay also have the excellent properties of nanomaterial, in additionto the advantages of the other graphene materials. We have then

proposed a platform for the fabrication of electrochemical biosensors byusing GQD in this work. As shown in Fig. 1, GQD can be readilymodifiedonto the surface of pyrolytic graphite (PG) electrode, and then the probessDNA (ssDNA-1) can be easily immobilized due to the interactionbetween thenucleobases andgraphene. Nevertheless, in thepresence ofthe target molecules (ssDNA-2 or thrombin), the interaction betweenthe probe ssDNA and target molecules will alter the structure of probessDNA and disturb the adsorption of the probe onto the GQD modifiedelectrode. Consequently, electrochemical response obtained at theelectrode will be changed, thus the target can be detected. Since thesequence of the probe ssDNA can be designed for various targets,platform todevelopGQD-based electrochemical biosensors is proposed.

2. Experimental

GQD was synthesized based on the previous report [22]. DNA wasmanufactured by Invitrogen Biotechnology Co., Ltd. The sequence ofssDNA-1 is 5’ - TCTCTCAGTCCGTGGTAGGGCAGGTTGGGGTGACT -3’.The sequence of ssDNA-2 is 5’- AG TCA CCC CAA CCT GCC CTA CCA CGGACT GAG AGA -3’.

The substrate PG electrode was prepared and pretreated accordingto our previous report [23]. After dryingwith nitrogen, the surface of thePG electrodewas drippedwith a 10 μL 15 mg L-1 GQD solution, and thendried overnight at the room temperature to obtain a uniform film. Afterthoroughly rinsedwith purewater, the GQDmodified PG electrodewasready for use.

Fig. 1. Schematic illustration of the preparation of a GQD modified PG electrode as aplatform to develop different kind of electrochemical biosensors.

Fig. 2. Differential pulse voltammograms for a 10 mM tris-HCl buffer solutioncontaining 5 mM [Fe(CN)6]3-/4- with pH 6.0 obtained at a GQD modified electrode for(a) the cases that probe ssDNA (ssDNA-1) has hybridized with different concentrationsof ssDNA-2; (b) the cases that ssDNA-1 has been incubated by thrombin with differentconcentrations. Insets are the plots of the peak current against the concentration ofssDNA-2 or thrombin. The concentration of probe ssDNA-1 is 500 nM.

32 J. Zhao et al. / Electrochemistry Communications 13 (2011) 31–33

To immobilize theprobeDNA(ssDNA-1)onto the surface of theGQDmodified electrode, the electrode should be immersed into a 70 μL10 mM Tris-HCl buffer (1 mM EDTA, 0.1 M NaCl, pH 7.4) containing500 nM ssDNA-1, followed by thoroughly rinsing with double-distilledwater. For electrochemical measurements of the targets such as ssDNAor thrombin, the desired amount of target should be firstly added in thesolution containing ssDNA-1 and incubated for 1 h before theimmobilization. The electrochemical measurement with differentialpulse voltammetry (DPV) was performed on a model 660 C Electro-chemical Analyzer (CH Instruments) with a 10 mM Tris-HCl buffercontaining 5 mM [Fe(CN)6]3-/4- (pH 6.0) as the electrolyte. Theparameters were as follows: pulse amplitude, 50 mV; pulse width,50 ms; scan rate, 20 mV s−1.

3. Results and discussion

To check whether our proposal can work or not, we have firstlyexamined whether the probe DNA can be immobilized onto the GQDmodified electrode by using [Fe(CN)6]3-/4- as the electrochemicalactive species. If the probe ssDNA can bind to GQD film on the PGelectrode surface, the immobilized ssDNA will inhibit the electrontransfer between the electro-active species [Fe(CN)6]3-/4- and theelectrode because of the electrostatic repulsion. In fact, afterimmersing the GQD modified electrode into the buffer containingssDNA-1 for 1 h, we may observe an evidently decreased peak currentof [Fe(CN)6]3-/4- obtained at the GQD modified electrode, confirmingthe binding of ssDNA-1 with the nanomaterials. Moreover, the furtherexperimental results reveal that the immobilization of ssDNA-1 ontothe GQD modified electrode surface is a concentration-dependentprocess. The more ssDNA-1 is used, the more drastically theelectrochemical signal will decrease.

We have then checkedwhether the target may induce the probe toproduce observed changes of the obtained electrochemical signal forthe detection of the target. Firstly, we have used the proposedplatform to fabricate a biosensor for the detection of ssDNA. As is wellknown, two complementary ssDNA can hybridize with each other andform a double helix structure. Obviously, the hybridization may alterthe secondary conformation of the probe ssDNA, and the status of theprobe ssDNA immobilized onto the GQD modified electrode surfacewill be changed correspondingly. For instance, the electrostaticrepulsion to the electro-active species [Fe(CN)6]3-/4- resulted fromthe immobilized ssDNAwill be removed. Therefore, the GQDmodifiedelectrode can be developed as a sensor to efficiently detect thecomplementary strand of the probe ssDNA-1. As is shown in Fig. 2a,when the concentration of probe ssDNA-1 is fixed (500 nM), the peak

current of [Fe(CN)6]3-/4- obtained at the modified electrode increasesalong with the concentration of ssDNA-2, indicating that the form ofdouble stranded DNA has indeed disturbed the immobilization ofprobe ssDNA onto the modified electrode. The more target DNAmolecules are in the test solution, the less free ssDNA probes are in thesystem to bind with GQD modified on the electrode surface, thushigher electrochemical response can be observed. The resultingcalibration plot of the current (Y) versus the target DNA concentration(x) is linearly ranged from 200 nM to 500 nM with a linear equation:Y (μA)=27.35+0.031 x (nM), R=0.999. And the target ssDNA-2 canbe detected with the minimum concentration of 100 nM.

Nowadays, oligonucleic acid as aptamer has been known to be ableto specially bind to a series of targets, such as small chemicals, proteinsand even cells [24]. Since the aptamer molecules will fold into uniquethree-dimensional conformation when binding to the target molecules,the presence of target in the test solution will then prohibit theimmobilization of the aptamer ssDNA onto the surface of the GQDmodified electrode. The probe ssDNA used in this study is also athrombin aptamer, so we have then fabricated a biosensor for thedetection of thrombin with the proposed platform in this work so as todemonstrate the generality of the platform. As a matter of fact, with thepresence of thrombin in the test solution, the probe ssDNA as theaptamer of theproteinwill recognize andbind to the target protein, thusless ssDNA probes can be immobilized onto the modified electrodesurface. Therefore, the electrochemical signal increases with thethrombin concentration (Fig. 2b). Further studies reveal that the peak

Fig. 3. Differential pulse voltammograms obtained at an unmodified PG electrode, theunmodified electrode further immobilized with ssDNA-1, and the cases that ssDNA-1has been incubated with ssDNA-2 or thrombin. Others as in Fig. 2.

33J. Zhao et al. / Electrochemistry Communications 13 (2011) 31–33

current (Y) is linear with the concentration of thrombin (x) from200 nM to 500 nM. The linear equation is: Y (μA)=29.461+0.02577 x(nM), R=0.999. And the detectable concentration for thrombin is100 nM. The detection limits for both target DNA and thrombin arelower than the previous reports [25,26].

We have also conducted control experiments to check whether theunmodified PG electrode is able to be developed as a sensor platform.The experimental results show that the unmodifiedPG electrode cannotdistinguish the conformational changes of theprobe ssDNA, eitherwhenhybridizingwith the target ssDNA or when binding to thrombin (Fig.3).These results have confirmed again that GQDmodified on the surface ofthe substrate PG electrode plays an important role in the fabrication ofthe sensing platform. Moreover, the specific recognization of thecomplementary DNA and the binding of aptamer to its target proteinmay also ensure the specificity and selectivity of our detection method,compared to the previous reports [25,26]. Besides, it is worthy tomention that no label is needed for the probe DNA in our detection,which makes the detection much more simple and cheap to beperformed.

4. Conclusion

In summary,we have demonstrated that GQDmodifiedPG electrodecoupledwithprobe ssDNAcanbeused asa platform todevelopdifferentkinds of electrochemical biosensors for the sensitive and selective

detection of various target molecules. Since more and more aptamersare discovered, study of such kinds of electrochemical biosensors can beextended for the detection of more molecules, not limited tocomplementary DNA or the protein with known aptamers. Certainly,our method also has some shortcomings, such as comparably narrowdetection range, although the sensitivity is favorable enough by usingunlabeled probe ssDNA. Nevertheless, the platform may be furtherimproved in the future by labeling the probe DNAwith electrochemicalsignal molecules, such as ferrocene and methylene blue. Therefore,more studies will be conducted following this work, and the starnanomaterial graphene can be applied in more research fields.

Acknowledgments

This work is supported by the National Science Fund for Distin-guished Young Scholars (Grant No. 20925520).

References

[1] J. Wang, Anal. Chim. Acta 500 (2003) 247.[2] S.J. Park, A. Taton, C.A. Mirkin, Science 295 (2002) 1503.[3] H. Li, L. Rothberg, PNAS 101 (2004) 14036.[4] J. Liu, Y. Lu, Angew. Chem. Int. Ed. 45 (2006) 90.[5] X. Yu, D. Chattopadhyay, I. Galeska, F. Papadimitrakopoulos, J.F. Rusling,

Electrochem. Commun. 5 (2003) 408.[6] J.S. Ye, Y. Wen, W.D. Zhang, L.M. Gan, G.Q. Xu, F.S. Sheu, Electrochem. Commun. 6

(2004) 66.[7] X.Z. Zhang, K. Jiao, S.F. Liu, Y.W. Hu, Anal. Chem. 81 (2009) 6006.[8] J. Wang, G. Liu, M.R. Jan, Q.Y. Zhu, Electrochem. Commun. 5 (2003) 1000.[9] S. Dwarakanath, J.G. Bruno, A. Shastry, T. Phillips, A. John, A. Kumar, L.D.

Stephenson, Biochem. Biophys. Res. Commun. 325 (2004) 739.[10] L. Shi, V. DePaoli, N. Rosenzweig, Z. Rosenzweig, J. Am. Chem. Soc. 128 (2006) 10378.[11] J.H. Choi, K.H. Chen, M.S. Strano, J. Am. Chem. Soc. 128 (2006) 15584.[12] S. Le Gac, I. Vermes, A. van den Berg, Nano Lett. 6 (2006) 1863.[13] H. Peng, L. Zhang, T.H.M. Kjallman, C. Soeller, J. Travas-Sejdic, J. Am. Chem. Soc. 129

(2007) 3048.[14] K.S. Novoselov, A.K. Geim, S.V. Morozov, D. Jiang, Y. Zhang, S.V. Dubonos, A.A.

Firsov, Science 306 (2004) 666.[15] A.C. Ferrari, J.C. Meyer, V. Scardaci, C. Casiraghi, M. Lazzeri, F. Mauri, S. Piscanec, D.

Jiang, K.S. Novoselov, S. Roth, A.K. Geim, Phys. Rev. Lett. 97 (2006) 187401.[16] A.K. Geim, Science 324 (2009) 1530.[17] C.H. Lu, H.H. Yang, C.L. Zhu,X. Chen, G.N. Chen, Angew. Chem. Int. Ed. 48 (2009)4785.[18] S.J. He, B. Song, D. Li, C.F. Zhu, W.P. Qi, Y.Q. Wen, L.H. Wang, S.P. Song, H.P. Fang, C.H.

Fan, Adv. Funct. Mater 20 (2010) 453.[19] M. Zhou, Y.M. Zhai, S.J. Dong, Anal. Chem. 81 (2009) 5603.[20] Y.X. Huang, X.C. Dong, Y.M. Shi, C.M. Li, L.J. Li, P. Chen, Nanoscale 2 (2010) 1485.[21] S. Alwarappan, A. Erdem, C. Liu, C.Z. Li, J. Phys. Chem. C 113 (2009) 8853.[22] D.Y. Pan, J.C. Zhang, Z. Li, M.H. Wu, Adv. Mater. 22 (2010) 734.[23] J. Zhao, X. Zheng, W. Xing, J. Huang, G. Li, Intl. J. Mol. Sci. 8 (2007) 42.[24] T. Li, Q. Fan, T. Liu, X. Zhu, J. Zhao, G. Li, Biosens. Bioelectron. 25 (2010) 2686.[25] Y. Xiao, V. Pavlov, T. Niazov, A. Dishon, M. Kotler, I. Willner, J. Am. Chem. Soc. 126

(2004) 7430.[26] S. Centi, G. Messina, S. Tombelli, I. Palchetti, M. Mascini, Biosens. Bioelectron. 23

(2008) 1602.