Cancer Genetics and Cytogenetics 163 (2005) 151–155

Glucose transporter polymorphisms areassociated with clear-cell renal carcinoma

Tobias Page*, Andrea D. Hodgkinson, Martin Ollerenshaw,John C. Hammonds, Andrew G. Demaine

Molecular Medicine Research Group, Peninsula Medical School, Institute of Biomedical Sciences,

Peninsula Medical School Headquarters, Derriford, Plymouth PL6 8BU, United Kingdom

Received 1 June 2005; accepted 5 July 2005

Abstract Clear-cell renal cell carcinoma (CCRCC) is identified by abundant glycogen-rich cytoplasm, due tothe aberrant influx and storage of glucose. The objective was to investigate the frequency of poly-morphisms of the facilitative glucose transporter (GLUT1). GLUT1 is a downstream target ofHypoxia-inducible factor (HIF-1a), a mediator of hypoxia-controlled angiogenesis. In this study,we examine the allelic frequency of polymorphisms in the promoter and the second intron of theGLUT1 gene. Genomic DNAwas extracted from normal tissue of 92 patients undergoing nephrec-tomy for CCRCC, and 99 normal cord blood DNA samples were used to provide control frequen-cies. The regions of DNA encompassing the polymorphisms were amplified and digested withappropriate endonuclases. The products were separated and viewed by gel electrophoresis. Therewas a highly significant decrease in the A-2841 genotype (P 5 0.0004) in the promoter regionof those patients with CCRCC compared to the control population. There was also a significant de-crease in the T122999 allele in the intron 2 of those patents with CCRCC (P5 0.004) compared tothe same control population. This study suggests that GLUT1 is one of a number of genes that mayincrease susceptibility to developing CCRCC. � 2005 Elsevier Inc. All rights reserved.

1. Introduction

Renal cell carcinoma (RCC) is diagnosed in 30,000 peo-ple every year in the United States, and 12,000 die from re-nal cell carcinoma annually [1]. This is equal to about 2%of all cancer deaths in the United States. Worldwide, renalcell carcinoma is responsible for 100,000 deaths per year[1]. The most common type of renal cell carcinoma is clearcell (CCRCC), arising from cells of the proximal convol-uted tubule. These tumors are identified by their abundantclear cytoplasm, which is mainly stores glycogen.

Clear-cell renal carcinomas have been shown to beclearly associated with a large number of gene mutations,most notably in the von Hippel-Lindau (VHL) gene [2].Studies of VHL gene function have shown that the productof this gene is a key controller of levels of hypoxia-inducible factor one-a (HIF-1a) and that this control is reg-ulated by hypoxia [3]. As a sensor of cellular hypoxia, theprotein VHL contributes to the process of angiogenesis and

* Corresponding author. Tel.:144-1752-247-413; fax:144-1752-247-

413.

E-mail address: Toby.page@pms.ac.uk (T. Page).

0165-4608/05/$ – see front matter � 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.cancergencyto.2005.07.004

to a number of yet unknown functions. HIF-1a is a tran-scription factor for a number of genes associated with an-giogenesis, such as vascular endothelial growth factor(VEGF ) and the facilitative glucose transporter 1 (GLUT1).

mRNA studies and immunohistochemistry have demon-strated GLUT1 to be greatly increased in both pancreaticand renal cell carcinoma [4,5]. The GLUT1 gene is locatedon chromosome 1p31/1~p35. It consists of approximately35,000 base pairs (bp) spread over 10 exons [6].

In this study, we have examined the frequency of twopolymorphisms in the GLUT1 gene, single nucleotide poly-morphism (SNP) Rs 3820589 and SNP Rs 3754218. Wehave looked exclusively at clear-cell carcinomas collectedover the course of 2 years in a regional urological centerin southwestern England. The first is in the promoter regionat position 22841 bp upstream of the start of exon 1 andconsists of an A/T substitution that abolishes a restrictionsite for the endonuclase HPY CH4V. We have chosen thisSNP for investigation because it is closely positioned toa number of putative binding sites for transcription factors,including HIF-1a. The second is in intron 2 at position122999 bp from the start of exon 1, which has been inves-tigated previously as a risk factor for diabetic nephropathy

152 T. Page et al. / Cancer Genetics and Cytogenetics 163 (2005) 151–155

[7–9] and consists of a G/T substitution that abolishesa cut site for the endonuclase Xba 1. Although intronic, thisSNP has been identified as a marker of susceptibility to di-abetic nephropathy; this effect may be through linkage withanother as yet unidentified SNP or by an undeterminedmechanism.

2. Materials and methods

Tumor and normal tissue were collected from patientsundergoing nephrectomy for suspected neoplasm at thetime of surgery. Tissue was amassed from two sources: firstfrom fresh nephrectomy specimens and from paraffin-embedded tissue taken before the start of this project. Inthe freshly harvested tissue, a trained histopathologist iden-tified an area of tumor and removed two small pieces witha sterile blade, which were immediately frozen in liquid ni-trogen. Two similarly sized pieces of normal tissue weretaken from the opposite pole of the kidney and immediatelyfrozen in a separate storage vessel. This normal tissue wasused to provide DNA from patients with CCRCC. For theparaffin-embedded tissue, 5 � 5-mm sections were takenfrom an area of tumor and 5 � 5-mm sections were removedfrom an area of normal kidney.

High–molecular weight DNA was extracted from thefresh-frozen tissue using a modified digestion and salt elu-tion technique, and the resultant DNA was stored in water.Genomic DNA was extracted from the paraffin samples byusing a Nucleospin kit (Abgene, Epsom, Surrey, UK) mod-ified for paraffin extraction by the preliminary step of re-moving paraffin with xylene. Cord blood taken fromsequential normal deliveries at the obstetrics departmentin Derriford Hospital (Plymouth, UK) was used for normalcontrols, and genomic DNAwas extracted using the Nucle-on extraction kit (Scotlab, Paisley, Scotland, UK). Cordblood controls are a well-recognized source of genomicDNA to ascertain the true prevalence of polymorphismswithin a population. All patients consented to freely donatetheir tissue to the study, and the local ethical committee’sapproval was given.

After histologic confirmation of type, all tissue con-firmed as clear-cell carcinoma were used in the study.The same histopathologist also used the Fuhrman gradingsystem to grade the tissue for nuclear stage [10]. The clin-ical stage of each patient’s tumor was assessed with the in-ternational tumor, nodes, metastasis (TNM) staging system[11]. The patients were classified by both Fuhrman gradeand Robson stage, with the latter based on the TNM classi-fication system [12].

Two pairs of amplimers, which were designed usingthe GenBank sequence, were used to amplify the areas ofinterest. For the A 22841T polymorphism, the followingamplimers were used: 5# gctgagaatggccttccctcaat 3#and 5# gtctgccttactcagcccatgggtc 3#. For the G122999Tpolymorphism, the following amplimers were used: 5#cagtccggctctggagcactt 3# and 5# atgaggcggcgaacactgcct 3#.

The amplification reaction was carried out in 30-mL vol-umes, with each tube containing the appropriate amplimerpair, MgCl2, 10X buffer solution (HT Biotech, Cambridge,UK), d NTPs, and Taq polymerase (Pharmacia Biotech,Uppsala, Sweden). Each sample was subjected to 35 cyclesof amplification in a three-step reaction proceeded by a hotstart. For the promoter polymorphism, the conditions wereas follows: hot start at 95�C for 4 minutes followed by 35cycles of denaturing for 2 minutes at 95�C, annealing at57.3�C, and extension for 2 minutes at 72�C in an i-Cyclerthermal cycler (Biorad, Hemel Hempstead, UK), which re-sulted in a 339-bp product. For the intron 2 polymorphism,the conditions were as follows: hot start at 95�C for 4 mi-nutes followed by 35 cycles of denaturing for 2 minutes at95�C, annealing at 61.3�C, and extension for 2 minutes at72�C in an i-Cycler thermal cycler (Biorad), which resultedin a 403-bp product.

For the A 22841T polymorphism, a thymine (T) to ad-enine (A) change, 15 units of the restriction enzyme HPYCH4 v was used (New England Biolabs, Beverly, MA)for 3 hours at 37.5�C. Where the cut site was present,two bands of 130 and 209 bp were produced, and thesewere visualized on a 2% agarose gel (Roche Diagnostics,Mannheim, Germany) and scored under ultraviolet light.The G122999T polymorphism consists of a guanine (G)to thymine (T) base substitution that abolishes the cut sitefor the restriction enzyme Xba-I. The digestion conditionswere 10 units of enzyme at 37�C for 6 hours, and the frag-ments produced were 102 and 301 bp long.

Patients who were homozygous for the cut site wereused in each batch of digestion as internal controls for un-der digestion. The genotypes for the promoter polymor-phism were confirmed by automated DNA sequencing(MWG, Edersberg, Germany), and polymerase chain reac-tion and digestion were run twice with genomic DNA fromboth the tumor and DNA from the opposite normal pole ofthe kidney.

Statistical analysis was based on the frequency of allelesand genotypes between the control group of cord bloodsamples and the tumor group consisting of DNA extractedfrom the tumor. The chi-square test and contingency tableswere used. The P values were corrected by using Yates cor-rection. A corrected P value of less than 0.05 was consid-ered to be significant.

3. Results

The details of the patients’ clinical characteristics areshown in Table 1. None of the patients selected for thisstudy had a family history of von Hippel-Lindau disease.The patients’ ages ranged from 35 to 85 years at the timeof operation. Histopathologic staging included the entirespectrum of nuclear grades (Furhman stages I–IV) as wellas most possibilities of TNM staging.

For the A 22841T polymorphism, the assay was runboth on tumor tissue and tissue from the opposite normal

153T. Page et al. / Cancer Genetics and Cytogenetics 163 (2005) 151–155

pole of the kidney. Therewas a significant decrease in the fre-quency of the AA genotype between the patients (n 5 36)and controls (n 5 65; 39 vs. 66%, Pc 5 0.0004). There wasalso a corresponding increase in the frequency of theheterozygote genotype between patients (n 5 52) and con-trols (n 5 32; 57 vs. 32%, Pc 5 0.0013). The frequencyof the A 22841 allele was also significantly decreased inthe patient population (n 5 124) compared to the controls(n 5 162; 67 vs. 82%, Pc 5 0.0017). The T-2841 allelewas rare and was increased in frequency in the patientpopulation (n 5 60) versus the controls (n 5 36; 33 vs.18%, Pc 5 0.0017) (see Table 2).

For the G122999T polymorphism, there was a decreasein the frequency of the TT genotype in the patient population(n5 6) versus the controls (n5 23; 7 vs. 23%, Pc5 0.003).This corresponded to an increase in the heterozygote popu-lation in the patients (n5 71) versus the controls (n5 55; 77vs. 56% Pc 5 0.003). No significant difference was seenbetween the patient population and the control populationwhen the alleles were assessed (see Table 3).

The normal control genotypes for both the A 22841Tand G122999T polymorphisms are in Hardy-Weinbergdistribution.

Table 1

Patient demographics

Range Median

Age (yr) 35–85 64.7

Fuhrman stage 1 (1.4%) to 4 (6.8%) 3

TNM T1 (30.4%) to T4N1M1 (1.1%) N/A

Robson staging 1 (30.4%) to 4 (17.7%) 2

The percentage of patients falling into each group is shown in paren-

theses. The age shown in years was calculated from the date of birth to

time of operation and rounded to the nearest year. Fuhrman stage is a mea-

sure of nuclear features and is graded from 1 to 4. The 1997 tumor nodes

metastasis (TNM) system is a widely used system for grading cancers.

Robson staging is divided in to four categories numbered from 1 to 4, with

4 being worst based on the size and spread of renal tumors.

Table 2

Results of A 22841T polymorphism in the GLUT1 promoter

Patients (n 5 92) (%) Controls (n 5 99) (%)

Genotype

AT 57a 32a

AA 39b 66b

TT 4c 2c

Alleles

A 67d 82d

T 33d 18d

Frequency of genotype and alleles in patients with clear-cell renal car-

cinoma versus healthy controls. Figures shown are percentages of the total

number shown in the headings in parentheses.a Patients versus controls, P value corrected with Yates correction 5

0.0013.b Patients versus controls, P value corrected with Yates correction 5

0.0004.c Patients versus controls, P value N/S, Fisher’s exact test used as less

than five occurrences measured.d Patients versus controls, P value corrected with Yates correction 5

0.0017.

4. Discussion

It is well recognized that between 45 and 70% of allRCC have a defect in the von Hippel-Lindau gene [13]and that VHL protein is a key controller of hypoxic control.In those tumors that have an intact VHL gene, other genesdownstream of it make likely targets for further investiga-tion in the study of carcinogenesis in RCC, and GLUT1is an example of one of those downstream genes. In thosetumors that have a defective VHL gene, the role of GLUT1is equally important because it may be overexpressed [5] byhigh levels of HIF-1a and, when overexpressed, small func-tional differences between polymorphisms may becomeamplified. Rat studies have shown that overexpression ofGLUT1 can lead to a range of diabetic conditions as a resultof high glucose levels [14], and overexpression of GLUT1protein has been shown in CCRCC. When considering tu-mor growth and development, however, it may be very ad-vantageous to have high levels of cellular glucose fuelingthe rapid and uncontrolled mitoses of cells. In addition, oth-er high-energy dependent processes such as vessel growthand metastasis may well be favored by such cellular de-fects. It has also been shown that excessive expression ofGLUT1 leads to an overproduction of the extracellular ma-trix, which may aid cell survival [14].

The A 22841T polymorphism is 400 bp upstream fromthe hypoxic response element site for HIF-1a. Such close-ness to this transcription factor–binding site may well affectthe binding or release of HIF-1a, which in turn affects pro-moter function. Indeed, the HIF-1a core sequence of5# cgtg 3# is found on the 3#–5# strand at the A 22841Tsite, although it remains to be elucidated if this site is infact another HRE in the promoter of GLUT1. This poly-morphism’s degree of effect over promoter function is cur-rently being investigated.

The G122999T polymorphism has been studied ina number of diabetic populations around the world withlittle agreement on its exact role in the development of dia-betic complications but the general consensus is that it is

Table 3

Results of G122999T polymorphism in intron 2 of the GLUT1 gene

Patients (n 5 92) (%) Controls (n 5 99) (%)

Genotype

GT 77a 56a

GG 16 21

TT 7b 23b

Allele

G 55% 49%

T 45% 51%

Frequency of genotype and alleles in patients with clear-cell renal car-

cinoma versus healthy controls. The figures shown are the percentages of

the total number shown in the headings in parentheses.a Patients versus controls, P value corrected with Yates correction 5

0.003b Patients versus controls, P value corrected with Yates correction 5

0.003

154 T. Page et al. / Cancer Genetics and Cytogenetics 163 (2005) 151–155

an important polymorphism [7–9,15–17]. This SNP is notin a regulatory region of the GLUT1 gene, and the signifi-cant differences seen in its distribution between cancer pa-tients and controls almost certainly reflects the fact that thispolymorphism is in linkage disequilibrium with a trulyfunctional polymorphism.

The highly significant decrease in the AA genotype inthe A 22841T polymorphism and TT genotypes in theG122999T polymorphism between the patients and thecontrols suggests that these genotypes may have a protectiverole in the carcinogenesis process. The different alleles mayalso be dominant over each other, making a clinical patterndifficult to elucidate.

Obesity is a well-recognized risk factor for the devel-opment of clear-cell renal cancer, but neither of thesepolymorphisms has been shown to be associated withobesity. None of the glucose transporter family polymor-phisms has been shown to be associated with obesity[18].

One of the distinguishing pathologic features of clear-cell renal cancer is the abundant storage of glycogenwithin the cytosol of the tumor cells, which gives thecells their ‘‘clear’’ appearance. This glycogen productionreflects the relative excess of intracellular glucose causedby the upregulation of the GLUT1 gene. Like the liver,kidney tissue also contains the enzyme glucose-6-phos-phatase, making it capable of gluconeogenesis. This doesnot seem to occur, however, as reflected by the abundantlystored glycogen seen in these tumors. Glycogen metab-olism is controlled at a number of levels, including thehormones insulin and glucagons, the energy state of thecell, ATP, and glucose-6-phosphate. For glucose 6-phos-phate to be broken down, it must be transported to the lu-men of the endoplasmic reticulum to be hydrolyzed byphosphatase. It is will recognized that VHL protein hasan effect on microtubule function [19], and mutant or ab-sent VHL protein in the tumor cells may affect the trans-port of glucose 6-phosphatase to the endoplasmicreticulum.

Since the tumor cell is hypoxic compared to surroundingnormal tissue, the targeted degradation of HIF-1a by an in-tact VHL protein is decreased by the lack of prolyl hydox-ylation on the VHL-binding site [20,21], with the additionallikelihood (70–85%) of a mutation in the VHL gene furtheraffecting the proper function of the VHL protein. Althoughaberrant VHL protein dysfunction or hypoxia-induced lackof VHL ubiquitination will increase levels of HIF-1a,this may not lead to an increase in the functional activeHIF-1a dimer [22].

Our study has shown that the GLUT1 gene is involved inclear-cell renal cell carcinoma although its exact role is un-clear at this time. We do hypothesize that it may be advan-tageous for renal cell tumors to be in a high-energyenvironment. We have also described a proposed mecha-nism by which the excessive storage of glycogen thatdefines these tumors may be occurring.

References

[1] Landis SH, Murray T, Bolden S, Wingo PA. Cancer statistics, 1999.

CA Cancer J Clin 1999;49:8–31.

[2] Pisani P, Parkin DM, Ferlay J. Estimates of the worldwide mortality

from eighteen major cancers in 1985. Implications for prevention and

projections of future burden. Int J Cancer 1993;55:891–903.

[3] Wang GL, Semenza GL. Purification and characterization of hypoxia-

inducible factor 1. J Biol Chem 1995;270:1230–7.

[4] Yamamoto T, Seino Y, Fukumoto H, Koh G, Yano H, Inagaki N,

Yamada Y, Inoue K, Manabe T, Imura H. Overexpression of facilita-

tive glucose transporter genes in human cancer. Biochem Biophys

Res Commun 1990;170:223–30.

[5] Nagase Y, Takata K, Moriyama N, Aso Y, Murakami T, Hirano H.

Immunohistochemical localization of glucose transporters in human

renal cell carcinoma. J Urol 1995;153:798–801.

[6] Fukumoto H, Seino S, Imura H, Seino Y, Bell GI. Characterization

and expression of human HepG2/erythrocyte glucose-transporter

gene. Diabetes 1988;37:657–61.

[7] Hodgkinson AD, Millward BA, Demaine AG. Polymorphisms of the

glucose transporter (GLUT1) gene are associated with diabetic ne-

phropathy. Kidney Int 2001;59:985–9.

[8] Grzeszczak W, Moczulski DK, Zychma M, Zukowska-

Szczechowska E, Trautsolt W, Szydlowska I. Role of GLUT1 gene

in susceptibility to diabetic nephropathy in type 2 diabetes. Kidney

Int 2001;59:631–6.

[9] Ng DP, Canani L, Araki S, Smiles A, Moczulski D, Warram JH,

Krolewski AS. Minor effect of GLUT1 polymorphisms on suscepti-

bility to diabetic nephropathy in type 1 diabetes. Diabetes 2002;51:

2264–9.

[10] Fuhrman SA, Lasky LC, Limas C. Prognostic significance of mor-

phologic parameters in renal cell carcinoma. Am J Surg Pathol

1982;6:655–63.

[11] Hermanek P, Schrott KM. Evaluation of the new tumor, nodes and

metastases classification of renal cell carcinoma. J Urol 1990;144:

238–41.

[12] Gettman MT, Boelter CW, Cheville JC, Zincke H, Bryant SC,

Blute ML. Charlson co-morbidity index as a predictor of outcome af-

ter surgery for renal cell carcinoma with renal vein, vena cava or right

atrium extension. J Urol 2003;169:1282–6.

[13] Ma X, Yang K, Lindblad P, Egevad L, Hemminki K. VHL gene alter-

ations in renal cell carcinoma patients: novel hotspot or founder mu-

tations and linkage disequilibrium. Oncogene 2001;20:5393–400.

[14] Heilig CW, Concepcion LA, Riser BL, Freytag SO, Zhu M, Cortes P.

Overexpression of glucose transporters in rat mesangial cells cultured

in a normal glucose milieu mimics the diabetic phenotype. J Clin In-

vest 1995;96:1802–14.

[15] Gutierrez C, Vendrell J, Pastor R, Broch M, Aguilar C, Llor C,

Simon RC. GLUT1 gene polymorphism in non-insulin-dependent

diabetes mellitus: genetic susceptibility relationship with cardio-

vascular risk factors and microangiopathic complications in a

Mediterranean population. Diabetes Res Clin Pract 1998;41:

113–20.

[16] Liu ZH, Guan TJ, Chen ZH, Li LS. Glucose transporter (GLUT1) al-

lele (XbaI-) associated with nephropathy in non-insulin-dependent

diabetes mellitus. Kidney Int 1999;55:1843–8.

[17] Tarnow L, Grarup N, Hansen T, Parving HH, Pedersen O. Diabetic

microvascular complications are not associated with two polymor-

phisms in the GLUT-1 and PC-1 genes regulating glucose metabo-

lism in Caucasian type 1 diabetic patients. Nephrol Dial Transplant

2001;16:1653–6.

[18] Oelbaum RS. Analysis of three glucose transporter genes in a Cauca-

sian population: no associations with non-insulin-dependent diabetes

and obesity. Clin Genet 1992;42:260–6.

[19] Hergovich A, Lisztwan J, Barry R, Ballschmieter P, Krek W. Regu-

lation of microtubule stability by the von Hippel-Lindau tumour sup-

pressor protein pVHL. Nat Cell Biol 2003;5:64–70.

155T. Page et al. / Cancer Genetics and Cytogenetics 163 (2005) 151–155

[20] Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ,

Kriegsheim Av, Hebestreit HF, Mukherji M, Schofield CJ,

Maxwell PH, Pugh CW, Ratcliffe PJ. Targeting of HIF-alpha to the

von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl

hydroxylation. Science 2001;292:468–72.

[21] Ivan M, Kondo K, Yang H, Kim W, Valiando J, Ohh M, Salic A,

Asara JM, Lane WS, Kaelin WG Jr. HIFalpha targeted for VHL-

mediated destruction by proline hydroxylation: implications for O2

sensing. Science 2001;292:464–8.

[22] Mandriota SJ, Turner KJ, Davies DR, Murray PG, Morgan NV,

Sowter HM, Wykoff CC, Maher ER, Harris AL, Ratcliffe PJ,

Maxwell PH. HIF activation identifies early lesions in VHL kidneys:

evidence for site-specific tumor suppressor function in the nephron.

Cancer Cell 2002;1:459–68.