ORIGINAL ARTICLE

GJB2, SLC26A4 and mitochondrial DNA A1555G mutations inprelingual deafness in Northern Chinese subjects

YU-FEN GUO1,*, XIAO-WEN LIU1,*, JING GUAN1,3, MING-KUN HAN2,

DA-YONG WANG2, YA-LI ZHAO4, SHAO-QI RAO2,5 & QIU-JU WANG2

1Department of Otolaryngology-Head and Neck Surgery, Second Hospital of Lanzhou University, Lanzhou, 2Department of

Otolaryngology-Head and Neck Surgery, Chinese People’s Liberation Army Institute of Otolaryngology, Chinese People’s

Liberation Army General Hospital, Beijing, 3Department of Otolaryngology-Head and Neck Surgery and 4Department of

Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking

Union Medical College, Beijing and 5Department of Bioinformatics, Harbin Medical University, Harbin, China

AbstractConclusion. This genetic epidemiological study demonstrated that 26.65% of the prelingual deafness in Northern Chinesepatients can be detected at younger ages by genetic testing of three common hearing loss genes (GJB2, SLC26A4 andmtDNA A1555G), and thus, early intervention measures could be undertaken to help them in language acquisition.Objectives. The GJB2, SLC26A4 and mtDNA A1555G mutations are the prevalent causes of prelingual deafness worldwide.Numerous studies have revealed that the forms and frequencies of the mutations in the three genes are largely dependent onthe ethnic or geographic origins. Hence, this study aimed to characterize the mutation profiles of the three genes inprelingual deafness in Northern Chinese patients. Subects and methods. An investigation of 514 patients with prelingualdeafness and 117 controls with normal hearing was conducted. Bidirectional sequencing (or enzyme digestion) was appliedto identify sequence variations. Results. This study revealed that 26.65% patients had two mutated alleles (homozygote orcompound heterozygote) of GJB2 (9.14%) or SLC26A4 (8.95%) and/or an mtDNA A1555G (8.56%) mutation. In detail,19.26% patients carried GJB2 mutations including 10.12% single mutant carriers. 235delC was the most common type,making up 69.18% of all mutants for GJB2. The mutant carrier rate for SLC26A4 was 15.2%, including 6.23% singlemutant carriers. The two most common types (IVS7-2A�G and H723R) accounted for 51.61% and 33.06% mutations,respectively. Forty-five patients had mtDNA A1555G, giving a frequency of 8.75%. In the control group with normalhearing, 2.56%, 1.71% and 0% of the subjects carried a single mutant for GJB2, SLC26A4 and mtDNA A1555G,respectively.

Keywords: Prelingual deafness, non-syndromic hearing loss, genetic testing, Chinese

Introduction

Severe or profound prelingual deafness occurs in

approximately 1 per 1000 newborns [1,2]. The

affected children usually suffer from delayed lan-

guage acquisition and can experience social isolation.

Prelingual deafness can be caused by many genetic

and environmental factors, and at least half of the

cases are thought to be genetically determined [3].

Recent advances in genetic studies of hearing loss

have provided a better understanding of the genetic

mutations that cause prelingual deafness [4]. There

have been reports revealing that prelingual severe or

profound hearing loss is mainly due to recessive

inheritance, and mutations in GJB2 (DNFB1,

OMIM: 121011) and SLC26A4 (DFNB4, OMIM:

600791) genes are thought to be the major causes of

autosomal recessive non-syndromic deafness [5].

GJB2 gene is currently recognized as the gene

notably responsible for non-syndromic autosomal

recessive and sporadic prelingual deafness [6,7].

Mutations in the SLC26A4 gene have been identified

as a major cause of non-syndromic hearing loss

Correspondence: Qiu-Ju Wang, MD, PhD, Prof., Department of Otolaryngology-Head and Neck Surgery and Institute of Otolaryngology, Chinese People’s

Liberation Army General Hospital, Beijing, China. Tel: �86 10 68172228. Fax: �86 10 68156974. E-mail: wqcr@263.net or wangqj@301hospital.com.cn

*The first two authors contributed equally to this work.

Acta Oto-Laryngologica, 2008; 128: 297�303

(Received 5 September 2007; accepted 25 October 2007)

ISSN 0001-6489 print/ISSN 1651-2551 online # 2008 Taylor & Francis

DOI: 10.1080/00016480701767382

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

associated with enlarged vestibular aqueduct (EVA)

and Pendred syndrome [8,9]. The 1555A�G mito-

chondrial mutation in the highly conserved coding

region of the mitochondrial 12S rRNA gene has been

found to be the most prevalent mitochondrial muta-

tion associated with both aminoglycoside-induced

and non-syndromic sensorineural hearing loss

(OMIM: 561000) in subjects of many ethnic origins

[10,11].

The forms of GJB2 and SLC26A4 mutations are

largely dependent on either ethnic or geographic

origins of the populations [12�15]. Mutation 35delG

in GJB2 is the most common type in sporadic or

familial Caucasian patients [16,17]. Mutation

167delT is the leading type in Israeli patients [18].

Mutation 235delC is the major type in Japanese,

Chinese and Korean patients [19]. In China, by

studying 118 probands from 60 simplex and 58

multiplex families, Liu et al. [20] estimated that the

GJB2 mutation rate in the non-syndromic hearing

loss patients was 27.5%. The 235delC mutation

accounted for 81% of the pathogenic alleles in

multiplex cases and 67% in simplex cases.

Numerous studies indicate that the SLC26A4

mutation(s) is associated with a congenital inner

ear malformation, EVA, which often accompanies

sensorineural hearing loss [8,9]. Prasad et al. [21]

reported that about 1�8% of the patients with

congenital hearing loss in a Western population

had EVA caused by SLC26A4 mutation(s). To

date, there are 100 reported mutations in

SLC26A4. However, the mutation hot spots were

also found to be race-specific [22�24]. In Northern

Europe, T416P and IVS8�1G�A are the most

common mutation types [24]; in Japan and South

Korea H723R is the most common type [22,23]. In

contrast to Japan, there is one additional common

type, IVS7-2A�G, in South Korea [23]. In Taiwan,

Wu et al. [25] screened SLC26A4 in 38 Chinese

families with EVA and found 8 mutation types in 33

families. IVS7-2A�G is most common, accounting

for 84% of all the alleles. Very recently, Hu et al. [26]

reported the results for 15 patients with deafness and

EVA in 13 unrelated Chinese families recruited to

the study from the Central South area of China.

IVS7-2A�G is most common among 15 pathogenic

mutations identified, accounting for 22.3% of all the

mutant alleles. In our recent study of 107 Chinese

patients with EVA and/or Mondini dysplasia in 101

familes (95 simplex and 6 multiplex familes) ascer-

tained by the Department of Otolaryngology, Chi-

nese People’s Liberation Army General Hospital

(Beijing, China), IVS7-2A�G was the most com-

mon form, accounting for 57.63% of all the mutant

alleles [27].

Discovery of the association between mtDNA 12S

rRNA A1555G and hearing loss is attributed to work

by Prezant et al. in 1993, who investigated three

families with aminoglycoside antibiotic-induced

deafness [10]. Now, the mtDNA A1555G mutation

has been estimated in different races all over the

world, which again indicates that the frequency of

the mutant in non-syndromic hearing loss is depen-

dent on racial or geographic origins. The frequency

estimates for this mutation are 2.4%, 0.7%, 1.8%

and 2.4% for Danes, Germans, Hungarians and

Poles, respectively [28,29]. In Asia, the frequency

estimates are 3.0%, 5.3% and 3.43% for Japanese,

Indonesians and Chinese subjects, respectively

[30,31].

Overall, these data show that significant differ-

ences in both frequencies and types in the three

genes can be observed in either different ethnic or

geographic origins. In particular, in the Chinese,

who make up approximately one-fifth of the world

population, high genetic heterogeneity may be pre-

sent among geographic origins. For instance, it is

known that Chinese in southern and northern areas

have distinct ancestral origins, with Malay and

Mongolian lineages, respectively. Therefore, this

study aimed to define the forms and frequencies of

the three well-known hearing loss genes in Northern

Chinese using a large sample of 514 patients with

prelingual deafness and 117 controls with normal

hearing.

Subjects and methods

Subjects and phenotyping

In this study, 514 patients (292 males and 222

females), whose ages ranged from 5 to 22 years, were

ascertained from the students at 3 schools for deaf

and dumb subjects in Gansu Province, Northern

China. As a control, 117 subjects with normal

hearing were recruited from the same region as this

study. Information consent, blood samples and

clinical evaluations were obtained from all the

participants according to the protocols approved by

the collectors’ institution review boards of the ethics

committees. Their clinical data, hearing test data

(including pure tone audiometry, acoustic immit-

tance, and auditory-evoked brainstem response),

and blood were collected by the Department of

Otorhinolaryngology & Head and Neck Surgery in

the Second Affiliated Hospital of Lanzhou Univer-

sity. The examinations demonstrated that these

students had severe or profound prelingual non-

syndromic hearing loss. Their ages of onset were less

than 3 years, and as a result they were only able to

communicate using sign language. Furthermore,

298 Y.-F. Guo et al.

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

children in whom with SLC26A4 homozygous or

compound heterozygous mutations were detected

underwent high-resolution computed tomography

(HRCT) scan of petrous temporal bone to examine

for bilateral EVA. The criterion for classifying the pa-

tients with EVA was defined as a diameter ]1.5 mm

for the midpoint between the common crus and the

external aperture in the HRCT scanning [32].

General procedures for DNA isolation and sequencing

Genomic DNA from peripheral blood leukocytes

was obtained by the phenol/chloroform method. All

PCR amplified products for the target fragments of

three genes were purified with the Millipore plate,

and were then sequenced with an ABI 3730

Sequencer (Applied Biosystems, Foster City, CA,

USA). The sequence data were analyzed by aligning

with the reference sequences in NCBI (NC_000013

for GJB2, NT_007933 for SLC26A and AC_000021

for mtDNA 12S rRNA A1555G) using the DNAS-

tar 5.0 and BioEdit software. Mutations or poly-

morphisms were identified according to the

reference sequences.

GJB2 mutation screening

The GJB2 gene has two exons, and the coding

region is in exon 2. With the use of the Primer 5.0

software package, the primer pair � forward primer

(GJB2-F): TGCTTACCCAGACTCGAGAA and

reverse primer (GJB2-R): CGACTGAGCCTTGA-

CAGCTGA � were designed for the coding region of

GJB2, and the PCR product was an 864 bp

fragment. To amplify the exon, Touch-down PCR

with annealing temperatures of T1�688C (10

cycles) and T2�638C (25 cycles) was carried out

in an ABI 9700 thermal cycler.

SLC26A4 mutation screening

The SLC26A4 gene contains an open reading frame

of 2343 bp, and encompasses 21 exons. Mutations in

exons 8, 19, 10, 17 and 15 were often found in non-

syndromic hearing loss associated with EVA in

Chinese subjects [27]. Hence, the following sequen-

tial procedures were used to systematically detect

mutations in the SLC26A4 gene. PCR amplifications

of five exons (8, 19, 10, 17 and 15) were first

performed; if a mutation was not detected in these

five exons, the DNA sample was further screened for

mutations in exons 3, 4, 5, 7, 11, 12 and 14,

respectively.

Exons 3, 5, 8 and 15 were amplified using the

primer pairs displayed in Table I, which were

designed using the online Primer 3.0 software. For

exons 4, 7, 10, 11, 12, 14, 17 and 19, the primer

pairs were designed based on those in Coucke et al.

[33]. All the primer pairs were synthesized by

Shanghai Sangon Biological Engineering Technol-

ogy and Services (Shanghai, China). Touch-down

PCR with conditions shown in Table I was con-

ducted for amplifying exons 3, 5, 8 and 15 in an ABI

9700 thermal cycler. The other exons were amplified

according to the reaction conditions described by

Coucke et al. [33].

Mitochondrial DNA A1555G mutation screening

PCR amplication. With the use of the primer pair

synthesized by Shanghai Sangon Biological Engi-

neering Technology and Services � forward primer

(M-F): TCAACCTCACCACCTCTT and reverse

primer (M-R): TTTGTCGCCTCTACCTAT � a

767 bp mtDNA fragment (nt 1229�nt 1995) was

amplified using an annealing temperature of 628Cfor 30 cycles.

Alw26I digestion analysis. For detecting mtDNA

A1555G, 6.0 ml of the PCR product was mixed with

2.0 ml of buffer and 0.2 ml of Alw26I restriction

enzyme (Tango, Shanghai, China). ddH2O was

added to the mixture until the volume reached

25.0 ml. The reaction mixture was incubated at

378C for 150 min. The electrophoresis on the 2%

agarose gel was run to examine the digested product.

If the digested product showed the specific band for

Table I. Primer pairs and PCR conditions for exons 3, 5, 8 and 15 of SLC26A4 gene.

Temperature (8C)

Exon Primer sequence T1 T2 Size (bp)

3 5?GGCAAAAGCATGGTAAGCAC3?3?AGGGTAAGCAACCATCTGTCA5?

61 54 400

5 5?CAAAGTGCTGCGGTTACAGA3?3?AATTTTGGGTTCCAGGAAAT5?

59 52 480

8 5?AAGTTCAGCATTATTTGGTTGACA3?3?TGGTTGTTTCTTCCAGATCACA5?

60 53 305

15 5?GCTCCTCTGAGCAACTGTGA3?3?GGGTCTAGGGCCTATTCCTG5?

67 60 302

GJB2, SLC26A4 and mtDNA A1555G mutations in Chinese 299

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

mtDNA A1555G, the PCR product was verified by

direct sequencing.

Results

GJB2 mutations

Fifteen different DNA sequence variations were

detected in 514 patients, as shown in Table II.

Among the variations, 11 types had already been

reported, including 6 mutations (35delG, R32C,

E47K, 176-191del16, 235delC and 299�300delAT)

[6,34�36], 5 polymorphisms (V37I, V27I, E141G,

G160S and I203T) and 4 novel variants (T18I,

Y68C, A78T and T86R), all situated in a highly

conserved region in GJB2. In comparison, among

117 controls, only 2 subjects were 235delC carriers

(heterozygotes) and 1 subject was a 299�300delAT

carrier (a heterozygote), which gave an estimate of

2.56% (3/117) for mutant carrier rate in the group

with normal hearing.

In all, 99 of 514 patients with hearing loss

(99/514, 19.26%) were found to have a GJB2

mutation(s), and the total number of mutant alleles

was 146 (Figure 1), of which 52 (52/514, 10.12%)

patients had only 1 mutant allele and the remaining

patients (47/514, 9.14%) had two mutant GJB2

alleles, in either homozygous or compound hetero-

zygous states. 235delC was most common, account-

ing for 69.18% (101/146) of the mutant alleles

(Figure 1), and next was 299�300delAT, with a

frequency of 11.64%.

SLC26A4 mutations

Seventy-eight patients carried a SLC26A4 muta-

tion(s), of which 46 had 2 mutant alleles (either

homozygotes or compound heterozygotes), making

up 8.95% of 514 patients, and the remaining

32 patients had single mutant allele. Ten mutations

were IVS7-2A�G, IVS10-12T�A, IVS15�5G

�A, N392Y, R409H, T410M, V659L, L676Q,

I714K and H723R (Figure 2). The two leading

variants, IVS7-2A�G and H723R, accounted for

51.61% and 33.06% of mutations, respectively.

Twenty-five patients who were detected with

SLC26A4 homozygous or compound heterozygous

mutations underwent an HRCT scan on their

petrous temporal bones and 24 patients showed

evidence of EVA, indicating that almost all of the

hearing-impaired patients with such SLC26A4 mu-

tation configurations suffered from some inner ear

malformations such as EVA. Among 117 controls,

only 2 mutant alleles were identified in 2 IVS7-2A

�G heterozygotes, which gave an estimate of 1.71%

of the mutant carrier rate.

Mitochondrial DNA A1555G mutation

Forty-five patients in the cohort had mtDNA

A1555G, of which 23 (23/45, 51.11%) had a history

of being prescribed aminoglycosides. Interestingly, a

few patients also had either GJB2 or SLC26A4

Table II. DNA variations detected in GJB2 gene.

Codon Nucleotide change Case (1028 alleles) Control (234 alleles) Mutation type

35delG 35delG 4 � Frameshift

T18I 53C�T 1 � Novel variation

V27I 79G�A 297 76 Polymorphism

R32C 94C�T 1 � Synonymous

V37I 109G�A 22 12 Polymorphism

E47K 139G�A 1 � Missense

176�191del16 176�191del16 1 � Frameshift

Y68C 203A�G 1 � Novel variation

A78T 232G�A 1 � Novel variation

235delC 235delC 101 2 Frameshift

T86R 257C�G 2 � Novel variation

299�300delAT 299�300delAT 17 1 Frameshift

E114G 341A�G 205 59 Polymorphism

G160S 478G�A 1 � Polymorphism

I203T 608T�C 20 � Polymorphism

101

17

4 1 1 10

20

40

60

80

100

120

235delC 299-300delAT

35delG R32C E47K 176-191del16

Num

ber

of M

utan

t Alle

les

Figure 1. Distribution of GJB2 mutant alleles.

300 Y.-F. Guo et al.

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

mutations (Table III). For example, one subject who

carried mtDNA A1555G was a GJB2_235delC

homozygote. Another subject who carried mtDNA

A1555G was a SLC26A4-D661E heterozygote. Ac-

cording to the current perspective that mtDNA

A1555G may exacerbate the severity of hearing

loss associated with GJB2 [35], we reclassified the

patient who carried both mtDNA A1555G and two

GJB2 mutants into the hearing loss group associated

with GJB2. As a result, the estimate of the carrier

rate for mtDNA A1555G becomes 8.56% (44/514).

However, mtDNA A1555G was not found in 117

subjects with normal hearing.

Discussion

Severe or profound prelingual deafness has a nega-

tive impact on language acquisition in patients.

Many prelingual deafness cases were not discovered

at early stages of the disease development, and thus

lost opportunities for early interventions, such as

wearing hearing aids and receiving speech training.

Consequently, these patients had to communicate

by sign language, which often led to social isolation.

Needless to say, early diagnosis of prelingual

deafness is fundamental to prevent such an undesir-

able outcome. This study involved 514 patients with

prelingual deafness from Northern China. We found

that 26.65% of the patients had two mutant alleles in

either GJB2 (9.14%) or SLC26A4 (8.95%), and/or

with mtDNA A1555G (8.56%). Based on the

recessive inheritance mode, the results suggest that

by conducting a proper DNA test, more than one-

quarter of the prelingual deafness cases may be

identified at a younger age, which would allow early

intervention measures to be undertaken to help them

acquire timely language skills.

However, designing an efficient genetic test for the

ear clinic may become complicated because of high

genetic heterogeneity in hereditary deafness and the

further complication of a need to screen numeruous

exons such as SLC26A4, which can be very time-

consuming. A more effective approach is to only

screen the pathogenic mutations of high frequencies.

In this study, we found seven previously reported

GJB2 mutations in the patients. Of the mutations,

235delC (72.14%) and 299�300delAT (12.14%)

were most common, and jointly accounted for

84.28% of GJB2 mutations in the studied cohort.

It is likely that IVS7-2A�G (51.61%) and H723R

(33.06%) jointly accounted for 84.67% of SLC26A4

mutations. If considering the 8.56% of patients

who carried mtDNA A1555G, we reasonably

believe that screening five mutations, i.e GJB2_

235delC, GJB2_299�300delAT, SLC26A4_H723R,

SLC26A4_IVS7-2A�G and mtDNA A1555G, may

be sufficient to identify most cases of prelingual

deafness in Northern Chinese patients at an earlier

age.

Due to its very high mutation load in either

recessively inherited or sporadic hearing loss, defini-

tion of the mutation rate and types of GJB2 in

populations of different racial or geographic origins

has become an intensely studied aspect of the

64

41

5 4 3 2 2 1 1 10

10

20

30

40

50

60

70

IVS7-

2A>G

H723R

L676

Q

IVS10

-12T

>A

R409H

N392Y

V659L

IVS15

+5G>A

T410M

D661E

Num

ber

of M

utan

t Alle

les

Figure 2. Distribution of SLC26A4 mutant alleles.

Table III. Frequencies of the subjects who had both mtDNA A1555G and GJB2 or SLC26A4 mutations.

Gene/locus

mtDNA A1555G GJB2 SLC26A4 Number of subjects

A1555G 79G�A /wt � 7

A1555G 79G�A /wt;341A�G/wt � 5

A1555G 79G�A/79G�A; 341A�G/wt � 2

A1555G 79G�A /79G�A; 341A�G/ 341A�G � 1

A1555G 235delC /235delC � 1

A1555G 235delC/wt � 2

A1555G 341A�G /341A�G � 1

A1555G 478 G�A/wt � 1

A1555G 79G�A /wt;608T�C /wt � 2

A1555G 109G�A/wt � 1

A1555G 608T�C/wt � 2

A1555G 79G�A/wt;341A�G /wt D661E/wt 1

GJB2, SLC26A4 and mtDNA A1555G mutations in Chinese 301

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

molecular epidemiology of hearing loss. Several

studies revealed that European or American peoples

(e.g. Caucasians [16,17] and Jewish [18]) have

distinct GJB2 mutation types or rates from Mon-

golians (e.g. Chinese, Japanese and Koreans) in East

Asia [19,20]. In this study, the GJB2 mutant carriers

made up 19.26% (99/514) of all prelingual hearing

loss cases recruited from Northern China. Mutation

235delC was the most common type, accounting for

69.18% of mutated alleles; next was 299�300delAT

accounting for 11.64%. It is interesting to note that

the most common mutation type, 35delG, in Cau-

casians accounted only 2.74% mutated alleles and

167delT, the most common in Jewish subjects, was

not detected in the Chinese cohort. Based on the

present study and previous studies of Japanese,

Korean and Chinese subjects [19,20], 235delC is

the leading variant in all three races, despite its rates

varied.

For SLC26A4, two leading types, IVS7-2A�G

(51.61%) and H723R (33.06%), made up 84.67%

of pathogenic mutants in the prelingual hearing loss

cohort recruited in Northern China; these results of

mutation types and frequencies are unique to the

large cohort of Northern Chinese subjects. In

comparison with other races, T416P and IVS8�1G�A are most frequent in Northern Europeans

[24], and in Japanese and Koreans, H723R (53%

and 40%, respectively) is the most frequent

SLC26A4 mutation [22,23]. Even within the same

broad category of race � Chinese � Hu et al. [26]

reported markedly different results in a Chinese

cohort from the Central South area of China, in

which the leading variant IVS7-2A�G accounted

for 22.3% of all the mutant alleles, and H723R was

infrequent. These data suggest that there are sig-

nificant differences not only between different races,

but also within a same broad racial category (e.g.

Chinese cohorts of different geographic or ancestral

origins).

A number of racial populations over the world

have been screened for locus mtDNA A1555G,

again indicating markedly different mutation rates

among different geographic or racial origins. In

Caucasians living in Europe or America, the rates

are 0.7�2.4%; in Japanese, it is 3.0%; and in

Indonesians, a rate of 5.3% was observed [30]. In

Chinese, based on genetic screening of 1836 non-

syndromic hearing loss subjects, Liu et al. [31] gave

an estimate of 3.43%, which is lower than the

estimate (8.35%) obtained in this study, the highest

rate reported so far. The following reasons may

contribute to this fact. First, there may be a founder

effect. Northern Chinese are largely derived from

Mongolian lineage, which is quite different from the

ancestor(s) for Caucasians in European countries. It

should also be noted that Southern Chinese are

mainly derived from Malay (Southeast Asian race),

which appear to have a lower mutation rate than

Northern Chinese according to this study and the

study conducted by Liu et al. [31]. Second, China is

a large country inhabited by numerous nationalities.

Especially in Northern China where several mino-

rities live, marriages between Han and other races

can increase genetic diversity in this region. Third,

Northern China is a less developed region and 80%

of subjects among 514 deaf school students came

from the countryside. Thus, it is not surprising that

the incidence of deafness can be higher, because of

the poor (or improper) medical care (e.g. the wide

use of aminoglycoside antibiotics [37]) and lack of

the relevant knowledge of genetics.

In conclusion, in this study the epidemiological

characteristics for the three most important patho-

genic genes were investigated by using a large cohort

of prelingually deaf subjects recruited from Northern

China. These data show that more than one-quarter

of the deaf cases can potentially be detected at an

earlier age using the proposed genetic screening, so

that some timely intervention procedures could be

provided to help them develop their language ability.

Acknowledgements

This research was supported in part by the National

High-Tech R&D Project (grant no. 2006AA02

Z181), National Natural Science Foundation of

China (grant nos 30570424, 30672310, 30771203

and 30771857), Beijing Science & Technology

Major Project (grant nos D0906005040291 and

7070002), and National Outstanding PhD Thesis

Grant (grant no. 200463), National 973 Project

(2007CB507400) and Heilongjiang Province De-

partment of Education Outstanding Overseas Scien-

tist grant (grant no. 1055HG009) and Gansu

Province grant for Young and Middle-Aged Scien-

tists (grant no. 3YS061-A25-012).

References

[1] Marazita ML, Ploughman LM, Rawlings B, Remington E,

Arnos KS, Nance WE. Genetic epidemiological studies of

early-onset deafness in the U.S. school-age population. Am J

Med Genet 1993;46:486�91.

[2] Morton NE. Genetic epidemiology of hearing impairment.

Ann N Y Acad Sci 1991;630:16�31.

[3] Denoyelle F, Marlin S, Weil D, Moatti L, Chauvin P,

Garabedian EN, et al. Clinical features of the prevalent

form of childhood deafness, DFNB1, due to a connexin-26

gene defect: implications for genetic counselling. Lancet

1999;353:1298�303.

[4] Schrijver I, Gardner P. Hereditary sensorineural hearing loss:

advances in molecular genetics and mutation analysis.

Expert Rev Mol Diagn 2006;6:375�86.

302 Y.-F. Guo et al.

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.

[5] Gurtler N, Lalwani AK. Etiology of syndromic and non-

syndromic sensorineural hearing loss. Otolaryngol Clin

North Am 2002;35:891�908.

[6] Kudo T, Ikeda K, Kure S, Matsubara Y, Oshima T,

Watanabe K, et al. Novel mutations in the connexin 26

gene (GJB2) responsible for childhood deafness in the

Japanese population. Am J Med Genet 2000;90:141�5.

[7] Zelante L, Gasparini P, Estivill X, Melchionda S, D’Agruma

L, Govea N, et al. Connexin26 mutations associated with the

most common form of non-syndromic neurosensory auto-

somal recessive deafness (DFNB1) in Mediterraneans. Hum

Mol Genet 1997;6:1605�9.

[8] Abe S, Usami S, Hoover DM, Cohn E, Shinkawa H,

Kimberling WJ. Fluctuating sensorineural hearing loss

associated with enlarged vestibular aqueduct maps to 7q31,

the region containing the Pendred gene. Am J Med Genet

1999;82:322�8.

[9] Usami S, Abe S, Weston MD, Shinkawa H, Van Camp G,

Kimberling WJ. Non-syndromic hearing loss associated with

enlarged vestibular aqueduct is caused by PDS mutations.

Hum Genet 1999;104:188�92.

[10] Prezant TR, Agapian JV, Bohlman MC, Bu X, Oztas S, Qiu

WQ, et al. Mitochondrial ribosomal RNA mutation asso-

ciated with both antibiotic-induced and non-syndromic

deafness. Nat Genet 1993;4:289�94.

[11] Li R, Xing G, Yan M, Cao X, Liu XZ, Bu X, et al.

Cosegregation of C-insertion at position 961 with the

A1555G mutation of the mitochondrial 12S rRNA gene in

a large Chinese family with maternally inherited hearing loss.

Am J Med Genet A 2004;124:113�17.

[12] Morell RJ, Kim HJ, Hood LJ, Goforth L, Friderici K, Fisher

R, et al. Mutations in the connexin 26 gene (GJB2) among

Ashkenazi Jews with nonsyndromic recessive deafness. N

Engl J Med 1998;339:1500�5.

[13] Fuse Y, Doi K, Hasegawa T, Sugii A, Hibino H, Kubo T.

Three novel connexin26 gene mutations in autosomal

recessive non-syndromic deafness. Neuroreport 1999;10:

1853�7.

[14] Gasparini P, Rabionet R, Barbujani G, Melchionda S,

Petersen M, Brondum-Nielsen K, et al. High carrier

frequency of the 35delG deafness mutation in European

populations. Genetic Analysis Consortium of GJB2 35delG.

Eur J Hum Genet 2000;8:19�23.

[15] Hutchin T, Coy NN, Conlon H, Telford E, Bromelow K,

Blaydon D, et al. Assessment of the genetic causes of

recessive childhood non-syndromic deafness in the UK �implications for genetic testing. Clin Genet 2005;68:506�12.

[16] Dent KM, Kenneson A, Palumbos JC, Maxwell S, Eichwald

J, White K, et al. Methodology of a multistate study of

congenital hearing loss: preliminary data from Utah new-

born screening. Am J Med Genet C Semin Med Genet

2004;125:28�34.

[17] Tekin M, Arnos KS, Pandya A. Advances in hereditary

deafness. Lancet 2001;358:1082�90.

[18] Sobe T, Vreugde S, Shahin H, Berlin M, Davis N, Kanaan

M, et al. The prevalence and expression of inherited

connexin 26 mutations associated with nonsyndromic hear-

ing loss in the Israeli population. Hum Genet 2000;106:

50�7.

[19] Abe S, Usami S, Shinkawa H, Kelley PM, Kimberling WJ.

Prevalent connexin 26 gene (GJB2) mutations in Japanese.

J Med Genet 2000;37:41�3.

[20] Liu XZ, Xia XJ, Ke XM, Ouyang XM, Du LL, Liu YH,

et al. The prevalence of connexin 26 ( GJB2) mutations in

the Chinese population. Hum Genet 2002;111:394�7.

[21] Prasad S, Kolln KA, Cucci RA, Trembath RC, Van Camp

G, Smith RJ. Pendred syndrome and DFNB4-mutation

screening of SLC26A4 by denaturing high-performance

liquid chromatography and the identification of eleven novel

mutations. Am J Med Genet A 2004;124:1�9.

[22] Tsukamoto K, Suzuki H, Harada D, Namba A, Abe S,

Usami S. Distribution and frequencies of PDS (SLC26A4)

mutations in Pendred syndrome and nonsyndromic hearing

loss associated with enlarged vestibular aqueduct: a unique

spectrum of mutations in Japanese. Eur J Hum Genet

2003;11:916�22.

[23] Park HJ, Lee SJ, Jin HS, Lee JO, Go SH, Jang HS, et al.

Genetic basis of hearing loss associated with enlarged

vestibular aqueducts in Koreans. Clin Genet 2005;67:160�5.

[24] Campbell C, Cucci RA, Prasad S, Green GE, Edeal JB,

Galer CE, et al. Pendred syndrome, DFNB4, and PDS/

SLC26A4 identification of eight novel mutations and

possible genotype-phenotype correlations. Hum Mutat

2001;17:403�11.

[25] Wu CC, Yeh TH, Chen PJ, Hsu CJ. Prevalent SLC26A4

mutations in patients with enlarged vestibular aqueduct and/

or Mondini dysplasia: a unique spectrum of mutations in

Taiwan, including a frequent founder mutation. Laryngo-

scope 2005;115:1060�4.

[26] Hu H, Wu L, Feng Y, Pan Q, Long Z, Li J, et al. Molecular

analysis of hearing loss associated with enlarged vestibular

aqueduct in the mainland Chinese: a unique SLC26A4

mutation spectrum. J Hum Genet 2007;52:492�7.

[27] Wang Q-J, Zhao Y-L, Rao S-Q, Guo Y-F, Yuan H, Zong L,

et al. A distinct spectrum of SLC26A4 mutations in patients

with enlarged vestibular aqueduct in China. Clin Genet

2007;72:245�54.

[28] Ostergaard E, Montserrat-Sentis B, Gronskov K, Brondum-

Nielsen K. The A1555G mtDNA mutation in Danish

hearing-impaired patients: frequency and clinical signs.

Clin Genet 2002;62:303�5.

[29] Kupka S, Toth T, Wrobel M, Zeissler U, Szyfter W, Szyfter

K, et al. Mutation A1555G in the 12S rRNA gene and its

epidemiological importance in German, Hungarian, and

Polish patients. Hum Mutat 2002;19:308�9.

[30] Malik SG, Pieter N, Sudoyo H, Kadir A, Marzuki S.

Prevalence of the mitochondrial DNA A1555G mutation

in sensorineural deafness patients in island Southeast Asia.

J Hum Genet 2003;48:480�3.

[31] Liu X, Dai P, Huang DL, Yuan HJ, Li WM, Cao JY, et al.

[Large-scale screening of mtDNA A1555G mutation in

China and its significance in prevention of aminoglycoside

antibiotic induced deafness.] Zhonghua Yi Xue Za Zhi

2006;86:1318�22 (in Chinese).

[32] Valvassori GE, Clemis JD. The large vestibular aqueduct

syndrome. Laryngoscope 1978;88:723�8.

[33] Coucke PJ, Van Hauwe P, Everett LA, Demirhan O,

Kabakkaya Y, Dietrich NL, et al. Identification of two

different mutations in the PDS gene in an inbred family

with Pendred syndrome. J Med Genet 1999;36:475�7.

[34] Park HJ, Hahn SH, Chun YM, Park K, Kim HN.

Connexin26 mutations associated with nonsyndromic hear-

ing loss. Laryngoscope 2000;110:1535�8.

[35] Abe S, Kelley PM, Kimberling WJ, Usami SI. Connexin 26

gene (GJB2) mutation modulates the severity of hearing loss

associated with the 1555A��G mitochondrial mutation.

Am J Med Genet 2001;103:334�8.

[36] Wang YC, Kung CY, Su MC, Su CC, Hsu HM, Tsai CC,

et al. Mutations of Cx26 gene (GJB2) for prelingual deafness

in Taiwan. Eur J Hum Genet 2002;10:495�8.

[37] Hu DN, Qui WQ, Wu BT, Fang LZ, Zhou F, Gu YP, et al.

Genetic aspects of antibiotic induced deafness: mitochon-

drial inheritance. J Med Genet 1991;28:79�83.

GJB2, SLC26A4 and mtDNA A1555G mutations in Chinese 303

Act

a O

tola

ryng

ol D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

onas

h U

nive

rsity

on

11/0

2/14

For

pers

onal

use

onl

y.