GFP-Centrin as a Marker for CentrioleDynamics in Living CellsRICHARD A. WHITE, ZHANG PAN, AND JEFFREY L. SALISBURY*Tumor Biology Program, Mayo Clinic, Rochester, Minnesota

KEY WORDS centrosome; mitosis; GFP-centrin

ABSTRACT A long-standing puzzle in cell biology is the question of how cells generate one andonly one new centrosome in each cell cycle and what is the role of the centriole pair in this process. Inthis study, the introduction of GFP-centrin into cultured cells allows direct visualization of centriolebehavior in living cells and in real time. Using this method, centriole dynamics can be observedthroughout the cell cycle and following a variety of experimental treatments. Our studies demonstratethat the biogenesis of new centrioles from individual members of a preexisting centriole pair isasynchronous: the older centriole initiates assembly of a new daughter centriole before the youngercentriole initiates assembly of its daughter. Microsc. Res. Tech. 49:451–457, 2000. © 2000 Wiley-Liss, Inc.

INTRODUCTIONSince they were first described as the “polar corpus-

cle” by Van Beneden in 1876, the centrosome, centri-oles, and their structural elaborations have been givena variety of expressive names: “attraction sphere,”“basal body,” “blepharoplast,” “cell center,” “centralbody,” “central corpuscle,” “centriole,” “centroplasm,”“centrosphere,” “centrosome,” “deuterosome,” “diplo-some,” “division center,” “kinetosome,” “periplast,” and“mitotic center,” to name a few. This brings to mind theshort story by Arthur C. Clark entitled “The Nine Bil-lion Names of God” in which, upon the utterance of allof the names of God time comes to an end and the cycleof the universe is completed. While at the close of the20th Century centrosome research is experiencing arenaissance of activity and discovery (Karsenti, 1999;Marshall and Rosenbaum, 1999) we are still far fromunderstanding the details of centrosome composition,function, and regulation.

The fundamental characteristic of the centrosome isthat it embodies the major microtubule organizing cen-ter (MTOC) of the cell. As such, the centrosome deter-mines the number and polarity of cytoplasmic micro-tubules, as well as the general form of the microtubulearray. Once in each cell cycle, the centrosome is dupli-cated to give rise to two centrosomes (i.e., the mitoticspindle poles) that organize the microtubule array ofthe mitotic spindle and thereby make possible equalsegregation of sister chromatids into each of twodaughter cells. A central question that puzzles cellbiologists is precisely how cells generate one and onlyone new centrosome in each cell cycle, and does theelaborate structure of the enigmatic centriole pair holda key to fully understanding this process? Simplystated, “How does a cell count from one to two?”

Although centrosome duplication has been well de-fined at the morphological level (Kuriyama and Borisy,1981; Rieder and Borisy, 1982), very little is knownabout the molecular regulation of centrosome duplica-tion (for a recent review of this problem, see Sluder andRieder, 1996). Centrosome duplication requires at leastthree levels of control that operate during the cell cycle:1) regulation of expression of centrosome precursor

proteins; 2) posttranslational modification of centro-some protein function through specific centrosome pro-tein phosphorylation and glutamylation; and 3) tem-plate control whereby a molecular scaffold directs theassembly of a single new centrosome. Centrosome du-plication is regulated at one or more cell cycle check-points, including: 1) the transition of quiescent cellsthrough the G1 restriction point where the decision ismade to complete a new cell cycle; 2) as cells progressthrough DNA synthesis or S-phase when centriole du-plication is initiated; and 3) at the time of assembly ofthe mitotic spindle at the G2/M phase of the cell cycle.Microsurgical removal of centrosomes from culturedcells uncouples cell growth from centriole biogenesisand centrosome duplication (Maniotis and Schliwa,1991; McNiven and Porter, 1988). In these studies,karyoplasts (nucleated cell fragments) and cytoplastsdenuded of their centrioles reestablish a juxtanuclearmicrotubule organizing center, an astral array of mi-crotubules, and a compact Golgi apparatus, and when anucleus is present they enter and presumably completeS phase and grow beyond the size of an average cell.However, karyoplasts do not regenerate centrioles intime periods equivalent to more than 10 cell cycles anddo not undergo cell division. Therefore, removal of cen-trioles uncouples cell growth from cell reproductionand impedes de novo centriole biogenesis and centro-some duplication. Moreover, Kuriyama et al. (1986)demonstrated that when centriole duplication is com-pletely inhibited by the microtubule-directed drugtaxol (added to M phase or early G1 cells), cellsprogress through the cell cycle and become blocked inmitosis, as indicated by an increase in the mitotic in-dex. Therefore, while normally coordinated in time cen-triole duplication is not a prerequisite for entry into S

Contract grant sponsor: the National Cancer Institute of the NIH; Contractgrant numbers: R01 CA72836, T32 CA09441; Contract grant sponsor: the MayoClinic Foundation.

*Correspondence to: Dr. Jeffrey L. Salisbury, Tumor Biology Program, MayoClinic, Rochester, MN 55905. E-mail: salisbury@mayo.edu

Received 28 July 1999; accepted in revised form 2 January 2000

MICROSCOPY RESEARCH AND TECHNIQUE 49:451–457 (2000)

© 2000 WILEY-LISS, INC.

phase and the two events appear to be independent ofeach other.

Recent progress in this area has provided a clearerpicture of the basis of cell cycle regulation of centro-some duplication. For somatic cells, centrosome dupli-cation requires Cdk 4/6-cyclin D activation of E2F tran-scription factors, presumably leading to the transcrip-tion of genes essential for centrosome duplication, andCdk2-cyclin A phosphorylation of yet-unidentified key(centrosome?) substrates (Meraldi et al., 1999). Simi-larly, Cdk2-cyclin E regulates this process in earlyembryos (Hinchcliffe et al., 1999; Lacey et al., 1999).Thus, centrosome duplication is initiated through cellcycle controls that also operate to regulate DNA repli-cation.

The mammalian centrosome consists of a pair ofcentrioles and a pericentriolar matrix (PCM) that sur-rounds and connects individual centrioles to one an-other, and to microtubules (Paintrand et al., 1992;Rieder and Borisy, 1982). PCM has the properties of agel since the centrosome excludes small cytoplasmicparticles such as ribosomes and small membrane ves-icles. The precise role of the preexisting centrosome, itscentriole pair, and surrounding PCM in the assemblyand organization of a new centrosome, however, re-mains a mystery. We note that a role for centrioles inthe organization and function of the centrosome hasbeen questioned. This doubt is based, in part, on theobservations that most plant cells lack centrioles en-tirely, that female germ cells in some species eliminatetheir centrioles during development (Szollosi et al.,1972), and that some cultured cell lines that lack cen-trioles (Debec et al., 1982; Szollosi et al., 1986). Indeed,a challenge can be extended to the long-held assump-tion that centrosomes, themselves, are essential orga-nizers of mitotic spindles (Vidwans and O’Farrell,1999). Nevertheless, there is a correlation between thereproductive capacity of a centrosome and the numberof centrioles that it contains (Mazia et al., 1960; Sluderand Rieder, 1985; Sluder and Begg, 1985; Sluder et al.,1989); that is, duplication of centrosomes requires a“seed” or “polar organizer,” and the behavior of thepolar organizer is coincident with the behavior of thecentriole. This concept is also supported by the recentobservation suggesting a role for polyglutamylated tu-bulin in the stabilization of centriole structure and inthe organization of the centrosome by concentratingPCM in the vicinity of the centrioles (Bobinnec et al.,1998). Additionally, the experiments mentioned earlierin which cell growth and centriole biogenesis becomeuncoupled in nucleated cytoplasmic fragments lackingcentrioles implicates a template function for preexist-ing centrioles in their duplication.

Moreover, operational and structural considerationsillustrate additional important features of centrosomeduplication. The centrosome is operationally defined bythe number of functional microtubule organizing cen-ters (MTOCs) in the cell (Fig. 1): There is one MTOCequivalent in interphase (the centrosome), and thereare two MTOC equivalents during mitosis (the spindlepoles). A structural determination of the number ofcentrosome equivalents, independent of MTOC activ-ity, can be made by counting centrioles: each centro-some equivalent has two centrioles. Since centriole dis-tribution into daughter cells at the time of cell division

is semiconservative, with each cell receiving a centro-some containing one new and one old centriole(Kochanski and Borisy, 1990), the younger centriole ofthe pair is in its first cell cycle, while the older centriolehas experienced at least one earlier complete cell cycle.

Centrosome duplication can be divided into four dis-tinct phases based on the development of the new cen-triole partner for each of two preexisting centrioles(Fig. 1). These phases include: 1) disorientation, whenthe two orthogonal centrioles of a pair separate fromone another as the cell passes the restriction point ofthe cell cycle; 2) budding of a new centriole along thelateral wall near the proximal end of a preexistingcentriole during S-phase of the cell cycle; 3) elongationof the microtubules of the newly formed centrioles; and4) maturation of the centriole that is completing itsfirst complete cell cycle as it acquires the structuraland biochemical features of a mature centriole. Thefinal products of the duplication process are two cen-trosomes, one containing the original mature centrioleand a newly formed daughter centriole, and the secondcontaining the original immature centriole, which isnow “mature,” and its newly formed daughter. In thismanner, a cell in late G2 of the cell cycle contains threegenerations of centrioles: one mature centriole, a sec-ond newly matured centriole that was “born” duringthe previous cell cycle, and two “neonatal” daughtercentrioles that were formed during the current cellcycle. Centriole generations can be distinguished onthe basis of structural (Rieder and Borisy, 1982) andbiochemical features. For example, the mature centri-ole typically has appendages on its distal outer wall, itserves as a basal body for a primary cilium, it containsthe protein cenexin (Lange and Gull, 1995), and typi-cally most of the PCM surrounds the mature centriole(Rieder and Borisy, 1982). The immature centriole thatarose during the previous cell cycle lacks these featuresduring most of the present cell cycle, but acquires themor their precursors as it matures late in G2. The “neo-natal” daughter centrioles lack these structural fea-tures entirely until they proceed through a subsequentcell cycle.

Because of their small size and intrinsic lack of con-trast, it is difficult to observe individual centrioles inliving cells. Most modern light microscopy studies ofcentrioles have employed indirect immunofluorescencefor tubulin, cenexin, centrin, or one of several monoclo-nal antibody preparations that recognize centriole com-ponents on fixed cells. The obvious drawback of thesemethods is that the investigator must draw inferencesabout centriole dynamics based on interpretation ofdifferent images of dead cells. To resolve this difficulty,we employed recombinant techniques in which cellswere transfected with green fluorescent protein (GFP)-centrin constructs in order to render centrioles visiblein living cells. In this work, we describe methods usedto visualize centrioles and some initial observations oncentriole dynamics in living cultured cells.

MATERIALS AND METHODSConstruction of pEGFP-Human Centrin 2

(pEGFP-CETN2) Expression VectorThe open reading frame of CETN2 was amplified by

PCR from pJLS112, a plasmid containing a full-lengthcDNA for human centrin 2 using primers that incorpo-

452 R.A. WHITE ET AL.

rated Xma I and Bgl II restriction sites into the 59 and39 ends, respectively, of the ORF: (forward primer)59GGAAGATCTATGGCCTCCAACTTTAAGAAGGGC39 and (reverse primer) 59CCCCCCGGGATAGAGGCT-

GGTCTTTTTCATGATGCGCAG 39. The ORF was di-rectionally cloned in frame into the pEGFP-C1 expres-sion vector (Clontech, Palo Alto, CA) to give the expres-sion construct pEGFP-CETN2.

Fig. 1. The centriole and cell cycles. Cells are born with one MTOCequivalent consisting of a centrosome that contains a pair of centri-oles, which typically show an orthogonal relationship to one another.One of the centrioles (M: mature) has been in existence for at least onecomplete previous cell cycle and is older than the other centriole (I:immature) that was formed during S phase of the previous cell cycle.As the cell passes through the G1 restriction point a decision is madeto enter the DNA synthesis phase (S) and the centriole pair undergoesdisorientation. Budding follows this stage where the two centriolesinitiate the biogenesis of new daughter (d2) centrioles. Elongation ofthe daughters is completed during G2 phase of the cell cycle and twoMTOC equivalents are established when the immature centriole un-dergoes maturation and acquires structural and biochemical featuresof a mature centriole (I.M) at around the time of mitosis.

Fig. 3. GFP-centrin localization in Syrian hamster ts745 cells. a:Two green spots of GFP-centrin mark the centrioles of G1 phase cells.One cell is in late G2 phase of the cell cycle and shows four GFP-centrin labeled centrioles. Nuclei are stained with Hoechst 33342.

Inset: (b) four GFP-centrin containing centrioles in a late G2 phasecell are also stained with anti-centrin antibody and rhodamine (red)conjugated secondary antibody by indirect immunofluorescence (c).Bar 5 2 mm.

453GFP-LABELED CENTRIOLES

Transfection and Selection of Cells ExpressingpEGFP-CETN2

pEGFP-CETN2 was transfected into HeLa (Gey etal., 1952) and Syrian hamster ts745 cells (Wang et al.,1983) using the calcium phosphate DNA precipitationmethod (Ausubel et al., 1989). Transfected cells werecultured for 18 hours, followed by selection in freshmedium containing 500 mg/ml G418 for 60 hours. Cul-tures expressing pEGFP-CETN2 were further selectedby direct examination using fluorescence microscopyfollowed by fluorescence-activated cell sorting for cellsexpressing high levels of pEGFP-CETN2. Colonies de-rived from single cells were isolated by limiting dilu-tion into 96-well plates. Individual subclones weregrown to 60–75% confluence and frozen. All observa-tions reported here were made on stabile transfectedcell lines in which all cells present show persistentGFP-centrin labeled centrioles.

Fluorescence MicroscopyCells expressing pEGFP-CETN2 were grown for 48

hours on DTC3 environmental chamber culture dishes(Bioptech, Butler, PA) and observed using a Zeiss IM35microscope equipped with a heated (Bioptech) 1003objective (1.3 N.A.). HeLa and Syrian Hamster cellswere maintained at 37°C and 33°C, respectively. Im-ages were captured using a Hamamatsu CCD (C4742-95, Hamamatsu Photonics, Hamamatsu City, Japan)camera and processed using Metamorph Imaging Sys-tem software (Universal Imaging Corp., West Chester,PA). In some experiments, cells transfected withpEGFP-CETN2 were stained for centrin using the in-direct immunofluorescence technique. Monoclonal an-ti-centrin (20H5) was used as the primary antibody at1:2,000 dilution followed by rhodamine conjugated sec-ondary goat antimouse IgG.

Western AnalysisTen micrograms of cell lysate were separated by SDS

PAGE and protein was transferred to PDVF membrane(W.E.P. Co., Bedford, MA) using a semidry transfertechnique (MilliBlot™, W.E.P.). The membrane wasincubated overnight at 4°C with anti-centrin monoclo-nal antibody (20H5) diluted 1:2,000 in blocking bufferand detected with secondary antibody conjugated toBCPIP (Sigma, St. Louis, MO). The Western blots weredeveloped according to the instructions of the manu-facturer.

RESULTSThe open reading frame for human centrin 2 cDNA

was cloned in-frame into the C-terminal enhancedgreen fluorescent protein vector, pEGFP (Clontech), togive the recombinant pEGFP-CETN2 plasmid (Fig.2a). Expression of the EGFP-centrin fusion protein inmammalian cells is driven by the immediate early pro-moter of human cytomegalovirus (CMV). HeLa cellsand the Syrian Hamster cell line ts745 were trans-fected and stable clones were obtained following selec-tion in G418, fluorescence-activated cell sorting forhigh fluorescence, and finally, cloning by limiting dilu-tion. Western blot analysis of stable transfectants dem-onstrates that GFP-centrin is expressed in the selectedtransfected cells (Fig. 2b). Lysates from nontransfected

cells contain centrin at 20 kDa (Fig. 2b, lane 1) andtransfected cells contain two bands that react withanti-centrin monoclonal antibody; centrin at 20 kDaand GFP-centrin at the anticipated molecular weight of;47 kDa (;20 kDa centrin 1 27 kDa EGFP). Cell cycleanalyses using fluorescence activated cell sorting(FACS) demonstrate that cultures transfected with thepEGFP vector alone or pEGFP-CETN2 show nearlyidentical cell cycle dynamics with similar proportionsof G0/G1, S, and G2/M phase cells (Fig. 2c). For theobservations reported in this work, all cultured lineswere stabile transfectants in which all of the cellspresent showed GFP-centrin incorporation into theircentrioles.

Employing these cell lines, we studied GFP-centrinlocalization in living mammalian cells by fluorescencemicroscopy. GFP-centrin is selectively incorporatedinto the structure of both centrioles, making themclearly visible in living cells (Fig. 3). The GFP-centrinappears to incorporate directly into the centriolesthemselves, as well as PCM that immediately sur-rounds each centriole. One member of the centriolepair shows brighter labeling, appears larger, and prob-ably represents the older centriole of the pair. Thebrighter labeling of the older centriole probably reflectsa larger amount of centrin-containing PCM concen-trated immediately surrounding the mature centriole.Interphase cells exhibit two GFP-centrin containingcentrioles that lie close to one another near the nucleusand late G2 phase cells show four GFP-centrin contain-ing centrioles (Fig. 3a). Double-labeling experiments inwhich the EGFP-CETN2 transfected cells were alsostained for centrin using indirect immunofluorescencetechniques (Fig. 3b,c) demonstrate that the green flu-orescence of GFP-centrin colocalizes with centrin asfour staining spots near the nucleus. The cell shown inFigure 3b,c has four centrioles because duplication hasproceeded, resulting in two pairs of centrioles. For oneof these pairs, the centrioles have remained orientedclose to one another, while the other pair shows dis-union of the centriole pair.

Fig. 2. pEGFP-CETN2, Western blot, and cell cycle analysis.a: The expression vector pEGFP-CETN2 is illustrated showing thesite of incorporation of human centrin 2 cDNA, CETN2, to yield theEGF-centrin recombinant gene. Expression in mammalian cells isdriven by the early immediate promoter of CMV. b: Western blotanalysis for centrin using monoclonal anti-centrin 20H5. Syrian ham-ster ts745 cells transfected with the pEGFP vector alone (lane 1), orpEGFP-CETN2 (lane 2) show centrin at 20,000 kDa, or centrin andGFP-centrin recombinant at 47,000 kDa, respectively (arrows). Abacterially expressed centrin standard is shown in lane 3. c: Fluores-cence activated cell sorting (FACS) analyses of Syrian hamster ts745cell lines transfected with pEGFP alone or pEGFP-CETN2. Both celllines show a similar proportion of cells at each stage of the cell cycle.

454 R.A. WHITE ET AL.

Study of individual cells illustrates the duplication ofcentrioles during a complete cell cycle (Fig. 4). As cellspass through S phase of the cell cycle the centrosomeduplicates to give rise to two centrosomes, each con-taining two centrioles. Careful observation suggeststhat during this time the brighter GFP-centrin labeledcentriole initiates “neonatal” daughter centriole bio-genesis earlier than the dimmer preexisting centriole(Fig. 4b). At later times, however, the level of GFP-centrin fluorescence in each of the preexisting centri-oles becomes more or less equivalent and the secondcentriole of the original pair initiates daughter centri-ole growth. This is illustrated in Figure 4b, where threeGFP-centrin spots are seen in a cell, and Figure 4c,where the cell has four GFP-centrin spots. Finally, inmitotic cells four GFP-centrin labeled centrioles areseen, with one centriole pair residing at each spindlepole; each centriole pair consists of one bright and onedim centriole (Fig. 4d).

The pattern of fluorescence observed in living cells,along with the Western blot and FACS analysis de-scribed above, demonstrate three important aspects ofrecombinant GFP-centrin incorporation into centrioles:1) GFP-centrin transfected cells grow normally in cul-ture and show no adverse effect associated with GFP-centrin expression; 2) newly duplicated centrioles in-corporate centrin during their genesis with the initia-

tion of a new daughter centriole proceeding first fromthe original mature centriole and subsequently by theoriginal immature centriole; and 3) GFP-centrin incor-poration into centrioles does not grossly affect cell cycleprogression or centrosome function.

DISCUSSIONThe “reproductive” capacity (duplication) and “cell

autonomous” behavior of centrioles and their occur-rence at the very center of the centrosome and mitoticspindle poles has fascinated cell biologists for over 100years (Boveri, 1900). In Wilson’s classic text entitledThe Cell in Development and Heredity (Wilson, 1925),the centriole is described “as a single granule of ex-treme minuteness, staining intensely with iron-hema-toxylin, crystal violet and some other dyes, and oftenhardly to be distinguished from a microsome save bythe fact that it lies at the focus of the astral rays.” Theallure of centrioles rose to new heights when the nine-fold geometric structure and orthogonal relationship ofpaired centrioles was revealed by electron microscopy(see Paintrand et al., 1992, for a recent review). Cent-rioles are cylinders approximately 0.5 mm long and0.2 mm in diameter. The walls of the centriole cylinderconsist of nine triplet microtubule-based “blades” thattwist from the proximal to distal end of the centriole.The C-member of the microtubule triplet terminates

Fig. 4. The centriole cycleas demonstrated by GFP-cen-trin transfected cells. a: Syrianhamster ts745 show a pair ofGFP-centrin labeled centriolesin a G1 phase cell. b: An earlyS phase cell shows one brightGFP-centrin labeled centrioleand its associated daughtercentriole, and a second GFP-centrin labeled centriole thathas not yet initiated the as-sembly of its daughter centri-ole. c: A late G2 phase cellshows two pairs of GFP-cen-trin-labeled centrioles. d: A mi-totic cell with a pair of GFP-centrin labeled centrioles ateach spindle pole. Note thatcentriole pairs typically showone centriole that labels moreintensely with GFP-centrin.The more intense GFP-centrinlabel probably marks the oldercentriole of the pair. Bar 5 2mm.

455GFP-LABELED CENTRIOLES

distally before the A- and B-microtubules. The matureor older centriole has a number of appendages along itswall, including associated pericentriolar material,basal feet, and membrane linking fibers and it is thebasal body for primary cilia. The younger centriolelacks these features throughout most of the cell cycle,but acquires them or their precursors late in G2 orearly in the G1 phase of the subsequent cell cycle. Inmany cell types the two centrioles show an orthogonalrelationship to one another during G1 of the cell cycle,with the younger centriole’s proximal end closely asso-ciated with the proximal wall of the older centriole. Thetwo centrioles are connected to one another by fibersthat may have elastic or contractile properties (Paint-rand et al., 1992). One curious feature of centriole pairsis that, while highly geometric in organization, theyare extremely asymmetric in their structure. While thecentriole pair is credited with conferring organizationalproperties to the cytoplasm in general (Albrecht-Buehler, 1981), with few exceptions (Albrecht-Buehler,1977; Albrecht-Buehler and Bushnell, 1979) there islittle experimental work in mammalian cells confirm-ing this proposition. Evidence that centrioles play arole in the structural organization of the cell cortex ofepithelia and in certain protozoa is more compelling(Dirksen, 1991; Meads and Schroer, 1995; Sonneborn,1975; Tucker et al., 1992).

Centrin is a ubiquitous centrosome protein that is acomponent of centrioles and of the pericentriolar latticeimmediately surrounding the centrioles (Paoletti et al.,1996; Salisbury, 1995). The remarkable properties ofthe jellyfish Aequorea victoria green fluorescent protein(GFP) (Chalfie et al., 1994; Prasher et al., 1992) as areporter molecule for monitoring gene expression andprotein localization in vivo and in real time make itpossible to follow centriole dynamics in living cells.Here, we demonstrate that, when expressed in mam-malian cells, recombinant GFP-centrin does not signif-icantly alter cell cycle progression since transfectedcells can be selected which, as clonally derived lines,grow well in culture. In addition, selected cell lines thathave been transfected with GFP-centrin show similarproportions of cells at each stage of the cell cycle. Ourexperiments also demonstrate that GFP-centrin be-comes incorporated into the structure of individual cen-trioles and surrounding pericentriolar material, themmaking them clearly visible at the light microscopelevel.

The use of GFP-centrin to label centrioles in livingcells reveals an important feature concerning centriolebiogenesis. During the cell cycle, the brighter (older)GFP-labeled centriole initiates incorporation of GFP-centrin into its newly forming daughter centriole be-fore the dimmer (younger) centriole does. This suggeststhat the older centriole of a pair may retain a struc-tural template that can function in the biogenesis of anew daughter centriole, while younger centriole mustacquire this capacity during late G1 or early S phasebefore it can initiate daughter centriole assembly. Per-haps the disorientation of the pair of centrioles in lateG1 unmasks structural features on the older centriolemaking them available to template new centriole as-sembly. The process is probably not as simple as thisbecause centriole pairs show transient and sometimepersistent disunion in certain cell types and following

stimulation of cell migration without ensuing centriolebiogenesis (Aubin et al., 1980; Gudima et al., 1988;Komesli et al., 1989). As cells progress through the cellcycle Cdk 4/6-cyclin D activation of E2F transcriptionfactors may effect genes encoding proteins that are keyto the template function. Alternatively, posttransla-tional modification of preexisting components along thewall of the younger centriole may occur to give themthe appropriate conformation to act as a template forcentriole assembly. In either case, precisely how a cen-triole template functions to generate a new centrioleremains a mystery, and the solution to this problem isthe essence of the question, “How does a cell count fromone to two?”

The studies presented here provide a new tool for theexperimental dissection of centriole dynamics in livingcells. For the first time, through the incorporation ofGFP-centrin, centrioles are rendered visible in livingcells. It is now possible to observe GFP-centrin-labeledcentrioles under conditions where centriole choreogra-phy can be followed microscopically in real time, andwhere centriole behavior is modified or perturbed byexperimental treatment.

ACKNOWLEDGMENTSWork in the laboratory is supported by a grant from

the National Cancer Institute of the NIH (R01CA72836) and by the Mayo Clinic Foundation. RAWwas supported by a Training Grant from the NCI (T32CA09441).

REFERENCESAlbrecht-Buehler G. 1977. Daughter 3T3 cells. Are they mirror im-

ages of each other? J Cell Biol 72:595–603.Albrecht-Buehler G. 1981. Does the geometric design of centrioles

imply their function? Cell Motil 1:237–245.Albrecht-Buehler G, Bushnell A. 1979. The orientation of centrioles in

migrating 3T3 cells. Exp Cell Res 120:111–118.Aubin JE, Osborn M, Weber K. 1980. Variations in the distribution

and migration of centriole duplexes in mitotic PtK2 cells studied byimmunofluorescence microscopy. J Cell Sci 43:177–194.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, SmithJA, Struhl K. 1989. Current protocols in molecular biology. NewYork: Greene Publishing and Wiley-Interscience.

Bobinnec Y, Khodjakov A, Mir LM, Rieder CL, Edde B, Bornens M.1998. Centriole disassembly in vivo and its effect on centrosomestructure and function in vertebrate cells. J Cell Biol 143:1575–1589.

Boveri T. 1900. Zellenstudien IV. Uber die natur der centrosomen.Jena Z Naturwiss 35:1–220.

Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC. 1994. Greenfluorescent protein as a marker for gene expression. Science 263:802–805.

Debec A, Szollosi A, Szollosi D. 1982. A Drosophila melanogaster cellline lacking centrioles. Biol Cell 44:133–138.

Dirksen ER. 1991. Centriole and basal body formation during cilio-genesis revisited. Biol Cell 72:31–38.

Gey GO, Coffman WD, Kubicek MT. 1952. Tissue culture studies ofthe proliferative capacity of cervical carcinoma and normal epithe-lium. Cancer Res 12:264–265.

Gudima GO, Vorobjev IA, Chentsov Yu S. 1988. Centriolar locationduring blood cell spreading and motion in vitro: an ultrastructuralanalysis. J Cell Sci 89:225–241.

Hinchcliffe EH, Li C, Thompson EA, Maller JL, Sluder G. 1999.Requirement of Cdk2-cyclin E activity for repeated centrosomereproduction in Xenopus egg extracts [see comments]. Science 283:851–854.

Karsenti E. 1999. Centrioles reveal their secrets. Nat Cell Biol 1:E62–E64.

Kochanski RS, Borisy GG. 1990. Mode of centriole duplication anddistribution. J Cell Biol 110:1599–1605.

456 R.A. WHITE ET AL.

Komesli S, Tournier F, Paintrand M, Margolis RL, Job D, Bornens M.1989. Mass isolation of calf thymus centrosomes: identification of aspecific configuration. J Cell Biol 109:2869–2878.

Kuriyama R, Borisy GG. 1981. Centriole cycle in Chinese hamsterovary cells as determined by whole-mount electron microscopy.J Cell Biol 91:814–821.

Kuriyama R, Dasgupta S, Borisy GG. 1986. Independence of centrioleformation and initiation of DNA synthesis in Chinese hamsterovary cells. Cell Motil Cytoskel 6:355–362.

Lacey KR, Jackson PK, Stearns T. 1999. Cyclin-dependent kinase controlof centrosome duplication. Proc Natl Acad Sci USA 96:2817–2822.

Lange BM, Gull K. 1995. A molecular marker for centriole maturationin the mammalian cell cycle. J Cell Biol 130:919–927.

Maniotis A, Schliwa M. 1991. Microsurgical removal of centrosomesblocks cell reproduction and centriole generation in BSC-1 cells.Cell 67:495–504.

Marshall WF, Rosenbaum JL. 1999. Cell division: the renaissance ofthe centriole. Curr Biol 9:R218–220.

Mazia D, Harris P, Bibring T. 1960. The multiplicity of the mitoticcenters and time-course of their duplication and separation. J Bio-phys Biochem Cytol 7:1–20.

McNiven MA, Porter KR. 1988. Organization of microtubules in cen-trosome-free cytoplasm. J Cell Biol 106:1593–1605.

Meads T, Schroer TA. 1995. Polarity and nucleation of microtubulesin polarized epithelial cells. Cell Motil Cytoskel 32:273–288.

Meraldi P, Lukas J, Fry A, Bartek J, Nigg E. 1999. Centrosomeduplication in mammalian somatic cells requires E2F and Cdk2-cyclin A. Nat Cell Biol 1:88–93.

Paintrand M, Moudjou M, Delacroix H, Bornens M. 1992. Centrosomeorganization and centriole architecture: their sensitivity to divalentcations. J Struct Biol 108:107–128.

Paoletti A, Moudjou M, Paintrand M, Salisbury JL, Bornens M. 1996.Centrosomal centrin is confined to the distal lumen of centrioles.J Cell Sci 109:3089–3102.

Prasher DC, Eckenrode VK, Ward WW, Prendergast FG, Cormier MJ.1992. Primary structure of the Aequorea victoria green-fluorescentprotein. Gene 111:229–233.

Rieder C, Borisy G. 1982. The centrosome cycle in PtK2 cells: asym-metric distribution and structural changes in the pericentriolarmaterial. Biol Cell 44:117–132.

Salisbury JL. 1995. Centrin, centrosomes, and mitotic spindle poles.Curr Opin Cell Biol 7:39–45.

Sluder G, Begg DA. 1985. Experimental analysis of the reproductionof spindle poles. J Cell Sci 76:35–52.

Sluder G, Rieder CL. 1985. Centriole number and the reproductivecapacity of spindle poles. J Cell Biol 100:887–896.

Sluder G, Rieder CL. 1996. Controls for centrosome reproduction inanimal cells: issues and recent observations. Cell Motil Cytoskel33:1–5.

Sluder G, Miller FJ, Lewis K, Davison ED, Rieder CL. 1989. Centro-some inheritance in starfish zygotes: selective loss of the maternalcentrosome after fertilization. Dev Biol 131:567–579.

Sonneborn TM. 1975. Positional information and nearest neighborinteractions in relation to spatial patterns in ciliates. Ann Biol14:565–584.

Szollosi D, Callarco P, Donahue R. 1972. Absence of centrioles in thefirst and second meiotic spindles of mouse oocytes. J Cell Sci 11:521–541.

Szollosi A, Ris H, Szollosi D, Debec A. 1986. A centriole-free Drosoph-ila cell line. A high voltage EM study. Eur J Cell Biol 40:100–104.

Tucker JB, Paton CC, Richardson GP, Mogensen MM, Russell IJ.1992. A cell surface-associated centrosomal layer of microtubule-organizing material in the inner pillar cell of the mouse cochlea.J Cell Sci 102:215–226.

Vidwans SJ, O’Farrell PH. 1999. Cytoskeleton: centrosome-in absen-tia. Curr Biol 9:R764–R766.

Wang RJ, Wissinger W, King EJ, Wang G. 1983. Studies on celldivision in mammalian cells. VII. A temperature-sensitive cell lineabnormal in centriole separation and chromosome movement.J Cell Biol 96:301–306.

Wilson EB. 1925. The cell in development and heredity. New York:Macmillan. p 674–675.

457GFP-LABELED CENTRIOLES