Geochemistry and microbial diversity of a trichloroethene-contaminated Superfund site undergoing intrinsic in situ reductive dechlorination

Geochemistry and microbial diversity of atrichloroethene-contaminated Superfund site undergoing intrinsic

in situ reductive dechlorination

Mary Lowe a, Eugene L. Madsen b, Karen Schindler a, Courtney Smith a,Scott Emrich a, Frank Robb c, Rolf U. Halden d;�

a Physics Department, Loyola College, Baltimore, MD 21210, USAb Department of Microbiology, Cornell University, Ithaca, NY 14853, USA

c Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, MD 21202, USAd Environmental Protection Department, Lawrence Livermore National Laboratory, Livermore, CA 94551, USA

Received 11 October 2001; received in revised form 1 February 2002; accepted 5 February 2002

First published online 22 April 2002

Abstract

This study explored the geochemistry and microbial diversity of a Superfund site containing trichloroethene (TCE) and an unusual co-pollutant, tetrakis(2-ethylbutoxy)silane. Geochemical analysis of contaminated groundwater indicated subsurface anaerobiosis, reductivedechlorination of TCE to predominantly cis-1,2-dichloroethene, and (transient) accumulation of 2-ethylbutanol and 2-ethylbutyrate as aresult of tetrakis(2-ethylbutoxy)silane breakdown. Comparative analysis of 106 16S rDNA and 61 16S^23S rDNA intergenic spacer regionsequences ^ obtained from pristine and contaminated groundwater via DNA extraction, PCR amplification, cloning and sequencing ^revealed that the contaminated groundwater featured (i) a distinct microbial community, (ii) reduced species diversity, (iii) variousanaerobes, and (iv) bacteria closely related to the TCE-dechlorinating, dichloroethene-accumulating genus Dehalobacter, whereas (v) theTCE-dechlorinating, ethene-producing species Dehalococcoides ethenogenes was not detectable. Thus, geochemical and molecularbiological results were in excellent agreement in this first ecological field study linking in situ reductive dechlorination of TCE tometabolism of tetraalkoxysilanes. 7 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. Allrights reserved.

Keywords: 16S rDNA; 16S^23S intergenic spacer region; Tetraalkoxysilane; Bioremediation; Reductive dechlorination

1. Introduction

Bioremediation of contaminated subsurface environ-ments by microorganisms is an emerging technology [1].It is becoming recognized that the lack of su⁄cient micro-bial diversity at contaminated sites may explain why bio-degradable pollutants fail to be biotransformed in situ [2].While new ¢ndings on the metabolic routes and bottle-necks of degradation are still accumulating [3], it is alreadyclear that the capacity of indigenous microbial populationsto adapt to the presence of toxic pollutants and to biode-

grade these compounds may be the most important factorin determining the fate of subsurface contaminants (for areview, see [4]).In situ reductive dechlorination is considered to be the

most promising mechanism for bioremediation of chloro-ethene spill sites [5]. When trichloroethene (TCE) repre-sents the primary contaminant, sequential reductive de-chlorination may yield cis-1,2-dichloroethene (cis-DCE),minor quantities of trans-1,2-dichloroethene, vinyl chlo-ride, and ultimately non-toxic, chlorine-free end productsin the form of ethene and ethane [6,7]. Many of thesetransformations can be performed cometabolically bymethanogenic, acetogenic and sulfate-reducing microor-ganisms that produce enzymes containing transition metalcofactors (see [8,9] and references therein). The reactionsproceed at orders of magnitude faster rates, however,when carried out by respiratory organochlorine-reducing

0168-6496 / 02 / $22.00 7 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.PII: S 0 1 6 8 - 6 4 9 6 ( 0 2 ) 0 0 2 2 9 - 5

* Corresponding author. Present address: Department of Environmen-tal Health Sciences, Bloomberg School of Public Health, Johns HopkinsUniversity, 615 N. Wolfe Street, Suite W6001, Baltimore, MD 21205-2103, USA. Tel. : +1 (410) 955 2609; Fax: +1 (410) 955 9334.

E-mail address: [email protected] (R.U. Halden).

FEMSEC 1354 23-5-02

FEMS Microbiology Ecology 40 (2002) 123^134

www.fems-microbiology.org

bacteria that gain energy during the process. The latter areobligate anaerobes of phylogenetically diverse origin andinclude strains of Dehalobacter restrictus, Dehalospirillummultivorans, Desulfuromonas sp. and Dehalococcoides ethe-nogenes [7,10^12]. Detection of any or all of these micro-organisms at a chloroethene spill site would represent oneimportant line of evidence indicating the potential applic-ability of in situ bioremediation to the site. Certainly,many other factors need to be considered by regulatoryagencies before committing to biological cleanup: geo-chemical site data, the availability of electron donor com-pounds suitable for driving microbial dechlorination reac-tions, and types and abundances of chloroethene daughterproducts [1,13].The chloroethene spill site investigated in this report ^

Lawrence Livermore National Laboratory’s (LLNL)Building 834 Operable Unit at Site 300 ^ is interestingfrom a microbiological standpoint for at least two reasons.First, maximum groundwater concentrations of the toxiccontaminant TCE historically have been close to the pointof saturation (V1084 mg l31) [14], thereby creating anunusually challenging environment for indigenous micro-organisms. Second, TCE was spilled together with tetra-kis(2-ethylbutoxy)silane (TKEBS), a silicon-based lubri-

cant that potentially may support both the anaerobic[15,16] and aerobic [17] metabolism of chloroethenes. Pre-vious laboratory experiments had shown that the fourbranched alkane side chains of the water-insoluble TKEBScan be released under ambient conditions via slow hydro-lysis [17]. Additional evidence from groundwater micro-cosm studies suggests that the liberated 2-ethylbutanolcan be fermented to 2-ethylbutyrate, acetate and hydrogen[15,18]. If these anaerobic fermentation reactions occur inthe ¢eld at a relevant scale, TKEBS may support reductivedechlorination of chlorinated ethenes by serving as a long-term electron donor source.In order to gain insight into the microbial diversity,

physiology, and geochemistry of the study site, two mon-itoring wells were selected for sampling and analysis. Theselected contaminated well is located in the source area ofthe site where mixtures of TCE and TKEBS were spilled.The second well, which served as a background well, issituated outside of the chloroethene-impacted area. Specif-ic objectives of the present study were to (i) search forevidence of ongoing in situ reductive dechlorination, (ii)analyze the microbial community composition and identi-fy population shifts that may have occurred in response tothe presence of TCE and TKEBS, and (iii) determine therelative usefulness of two culture-independent microbialpro¢ling tools that are based on the 16S rRNA geneand the 16S^23S rDNA intergenic spacer region (ISR).

2. Materials and methods

2.1. Site description

Site 300 is an active explosives test site situated in theremote Altamont Hills approximately 100 hwy km south-east of San Francisco. It is operated by the Department ofEnergy and listed as an EPA Superfund site. The areaunder study, the Building 834 Complex, is located in thesoutheastern corner of Site 300. It was constructed in the1950s for conducting thermal shock and humidity testingof weapons components. The building complex is locatedon an isolated hilltop at an elevation of 311 m. In thevicinity of Well W-834-D3 (Fig. 1), periodic leakage of amixture of TCE (100^30%) and TKEBS (0^70%) to thesubsurface from a piping system resulted in the environ-mental release of approximately 3000 kg of TCE and anunknown quantity of the unregulated TKEBS compound.The above mixture of two non-aqueous phase liquids isheavier than water, which allowed both contaminants tojointly penetrate the water table and migrate deep into thesubsurface. Following discovery of soil and groundwatercontamination in the early 1980s, the piping system wasdismantled and the facility abandoned.The hydrogeology of the Building 834 area is complex.

The source area ^ located on a hilltop ^ is underlain by ashallow (V15 m) perched water-bearing zone of variable

Fig. 1. Plan view of the study location containing the primary contami-nants TCE and TKEBS as well as the TCE metabolite cis-DCE.

FEMSEC 1354 23-5-02

M. Lowe et al. / FEMS Microbiology Ecology 40 (2002) 123^134124

thickness (6 0.1^4 m). A contour plot, generated fromgroundwater compliance monitoring data using Earthvi-sion software, indicates that the TCE plume measuresabout 500 m by 200 m (Fig. 1). It occurs in a semi-con-solidated conglomerate of sand and gravel that is under-lain by a bedrock sequence containing several layers oflow permeability. The most shallow of these aquitards(Tps clay), is located 10^20 m below the surface and pre-vents the downward migration of contaminants throughthe various layers of unsaturated sandstone to the regionalaquifer, located some 85 m below. Lateral migration ofdissolved contaminants is restricted by the limited extentof saturation and the topography. Aqueous concentrationsof TCE typically are in the mg l31 range whenevergroundwater is encountered.Two groundwater monitoring wells, W-834-D3 and W-

834-T5 (hereafter referred to as D3 and T5, respectively),were selected for this study (Fig. 1). D3 is located in anarea where both TCE and TKEBS were spilled to theground; no known potential carbon and energy sourcesother than TKEBS exist in this location. The well has adepth of 10 m and is screened in the conglomerate over-laying the initial clay layer (perching horizon). T5 is lo-cated 430 m to the south, outside of the TCE plume. Thiswell has a depth of 24 m and is also screened in the con-glomerate layer.

2.2. Chemical and geochemical site characterization

Groundwater samples, collected at the wellhead in cer-ti¢ed glass vials, were shipped on ice to B.C. Laboratories,Inc. (Bakers¢eld, CA, USA) and analyzed for volatile or-ganic compounds by purge and trap gas chromatography/mass spectrometry (GC/MS) using U.S. EPA method 601.Concentrations of dissolved gases were determined by Mi-croseeps, Inc. (Pittsburgh, PA, USA) via GC/MS analysisof headspace gas samples that were generated in the ¢eldusing the bubble strip method [19]. Concentrations ofTKEBS and its transformation products were determinedby liquid^liquid extraction and GC/MS analysis as de-scribed previously [17]. Values of pH, Eh, and dissolvedoxygen were measured in the ¢eld with parameter-speci¢celectrodes as described elsewhere [20]. Concentrations ofinorganic salts and sul¢de were determined spectrophoto-metrically in the ¢eld using CHEMetrics (Calverton, VA,USA) test kits per manufacturer’s directions. A databaseof regulatory compliance monitoring data was used forgenerating plume contour maps and for determining his-torical maximum concentrations. These analytical datawere produced by certi¢ed commercial laboratories usingstandard methods.

2.3. Collection of groundwater samples for microbialpro¢ling

Groundwater samples were collected on August 6, 1998

from wells T5 and D3. Four liters of groundwater, ob-tained from the wellhead, were passed through Sterivex-GP ¢lters (0.22 Wm pore size; Millipore Corp., Bedford,MA) and immediately placed on ice. The ¢lters wereshipped on dry ice and stored at 380‡C. To remove themicroorganisms, the ¢lters were agitated with a vortexovernight at 4‡C, and then back£ushed twice with dilutedphosphate bu¡er (1 part M9 bu¡er [21] plus 2 partswater).

2.4. Extraction of community DNA

A direct lysis procedure was adapted from [22]. Samples(9 300 Wl) were suspended in 500 Wl of bu¡er A (500 mMTris^HCl, pH 8.0, 100 mM NaCl, 1 mM sodium citrate).Next, 100 Wl of 10 mg ml31 lysozyme were added andsamples were incubated for 1 h at 37‡C. Following initialincubation, 100 Wl of 10 mg ml31 of activated proteinaseK were added and incubated for an additional 30 min.Next, 500 Wl of lysis bu¡er (200 mM Tris^HCl, pH8.0/100 mM NaCl, 4% (w/v) SDS/10% (w/v) amino-salicylic acid) were added. Three freeze/thaw cycles wereperformed using a dry ice^ethanol bath and a 65‡C waterbath. Finally, the community DNA was puri¢ed usingsaturated phenol, pH 7.9 (Ambion, Austin, TX, USA),followed by addition of a mixture of phenol, chloroformand isoamyl alcohol (24:24:1). Organic and DNA phaseswere separated by Phase Lock Gel (Eppendorf, Westbury,NY, USA). The genomic DNA was precipitated with3 M sodium acetate (0.1 of total volume) and 1 vol.of isopropanol. Pellet paint (Novagen, Madison, WI,USA) was added to the precipitate for easy pellet iden-ti¢cation. The pellet was then washed in 100% ethanol,vacuum-dried, and resuspended in 25 Wl sterile water.The concentration of puri¢ed DNA was estimated fromits optical density at 260 nm and 255 nm (pellet paintmaximum) using a Beckman DU640 spectrophotome-ter.

2.5. PCR ampli¢cations

To amplify the 16S rDNA gene, 1.0 Wl of extractedcommunity DNA 6 200 ng was added in a total reactionvolume of 100 Wl containing 2.5 U Amplitaq DNA poly-merase (Perkin-Elmer, Woburn, MA, USA), 1UGeneAmpPCR bu¡er; 200 WM each dNTP, 0.6 WM each bacterialprimer 8F (AGAGTTTGATCCTGGCTCAG) [23] and1492R (GGTTACCTTGTTACGACTT) [24]. The tubeswere placed in a thermal cycler equilibrated at 94‡C, fol-lowed by a 2-min denaturation step at 94‡C; 25 cycles ofdenaturation (30 s at 94‡C), annealing (45 s at 55‡C), andextension (60 s at 72‡C); and a ¢nal extension for 8 min at72‡C. A 1% agarose gel stained with ethidium bromideshowed a single band at V1500 bp. No band was visiblefor the negative control (reagents only; no DNA tem-plate).

FEMSEC 1354 23-5-02

M. Lowe et al. / FEMS Microbiology Ecology 40 (2002) 123^134 125

To amplify the ISR, 1 Wl of community DNA wasadded to a total reaction volume of 30 Wl containing2.5 U Taq (Fisher Biotech), 1UPCR bu¡er, 55 WM eachdNTP, 20 pmol primer R2 (5P-GGGWGAAGTCGTAA-CAAG-3P) and 20 pmol primer R5 (5P-TTAGCACGTC-CTTCATCGCC-3P). R2 overlaps 1492R by 13 bases. R5is located within the ¢rst 100 bases of the 23S rDNAcoding region. The thermal cycling protocol consisted ofa 5-min denaturation at 94‡C, followed by addition of Taq(hotstart) ; 35 cycles of denaturation (30 s at 94‡C), an-nealing (30 s at 50‡C), and extension (1.5 min at 72‡C);followed by a ¢nal extension for 5 min at 72‡C. Separationof the products on a 1% agarose gel showed a continuousrange of product lengths with prominent bands at 930,590, and 520 bp for D3, and weak bands at 500 and 450bp for T5. No band was visible for the negative controlcontaining no DNA template. Prior to cloning, all ampli-cons were puri¢ed using the Geneclean III Kit (Bio 101)according to the manufacturer’s protocol.

2.6. Cloning

Cloning was accomplished with the TOPO-TA cloningkit (Invitrogen version J and earlier) according to themanufacturer’s instructions using 4 Wl of puri¢ed PCRproduct, 1 Wl of pCR2.1-TOPO plasmid vector, andchemically competent TOP10FP One Shot Escherichiacoli. Clones were picked at random and grown overnightin Luria^Bertani (LB) broth containing 150 Wg ml31 am-picillin. For long-term storage, 0.05 ml dimethylsulfonatewas added to 0.45 ml of the liquid culture, and the mixturewas incubated at room temperature for 30 min prior tostorage at 380‡C. Alternatively, the cells were stored in anLB broth/glycerol mixture (85:15) at 380‡C.

2.7. Isolation of plasmid DNA

Plasmid DNA was extracted and puri¢ed using a QIA-prep Spin Miniprep kit (Qiagen, Valencia, CA, USA) ac-cording to the manufacturer’s protocol. The optional col-umn wash was performed. Plasmid DNA was eluted with50 Wl of sterile water. The presence of an insert was de-termined by running a restriction digest using EcoRI(Promega, Madison, WI, USA) and 1 Wl of puri¢edpDNA on a 1% agarose gel.

2.8. Sequencing

All plasmid DNA samples (0.5^1.0 Wg) were sequencedwith a Perkin-Elmer ABI 373 using primer T7 (5P-TAA-TACGACTCACTTAGGG-3P). A subset was also se-quenced with universal M13 Reverse Primer (5P-CAGGA-AACAGCTATGAC) or 338F (5P-TCCTACGGGAGGC-AGC) [23].

2.9. Sequence analysis

A set of C++ software utilities was developed to processthe sequences rapidly. All sequences were placed on thepositive strand and contained at least one of the PCRprimers. Vector sequences were removed. After editing,each sequence was typically 700^800 bp in length, span-ning approximately half of the 16S rDNA and often theentire ISR. Full-length 16S sequences were constructedeither by hand or by use of the CAP2 contig assemblysoftware (http://hercules.tigem.it/ASSEMBLY/assemble.html). The software was set to optimize reads s 450 bpwith a threshold for sequence assembly of 80% identityand the feature to remove ‘bad’ 5P and 3P ends. All se-quences for each well were placed in a FASTA-format ¢leand analyzed by BLAST in September 2000 using theWin32 version of the NIH Blastcl3 network client (ftp://ncbi.nlm.nih.gov/blast/network/netblast/). The Blastn pro-gram utilized the nr database and reported output inhypertext format. The quality of the microbial identi¢ca-tion was determined from the bit score, percent identity,and segment length. Sequences of 16S rDNA which didnot meet the identi¢cation criteria described in Section 3were tested with CHIMERA_CHECK Version 2.7 (http://www.cme.msu.edu/RDP/html/analyses.html) ; no chimericsequences were found. In addition, 16S and ISR sequencesfrom Well T5 were compared with the corresponding se-quences from Well D3 using Standalone Blast and the‘formatdb’ and ‘blastall’ commands.Alignments and dendrograms were generated using the

program PileUp from the Wisconsin Package (GeneticsComputer Group, Madison, WI, USA). Input ¢les con-sisted of all sequences containing the ¢rst half of the 16SrRNA gene. Complete 16S rDNA sequences were trun-cated in the middle. For the ISR sequences, the input ¢lesconsisted of all complete and incomplete sequences. Thegap creation and extension penalties were 4 and 0, respec-tively. The branch lengths in the dendrograms (Figs. 2 and3) are linearly proportional to the distances between se-quences with the maximum normalized distance of 1 at theroot (left) and 0 at the right.Reference sequences for the 16S and ISR regions were

obtained from the Institute of Genomic Research (TIGR,http://www.tigr.org) or GenBank. From TIGR, onlyE. coli K-12 was ¢nished. The un¢nished sequences, asof July/August 2000, were Geobacter sulfurreducens, Desul-fovibrio vulgaris, and D. ethenogenes. All other referencestrains were obtained from GenBank. All sequences weretrimmed to have the closest approximation to the primerpairs 8F/1492R and R2/R5 at the terminal ends. If a prim-er could not be found, then no trimming occurred.

2.10. Nucleotide sequence accession numbers

The ISR and 16S rRNA gene sequences appear in Gen-

FEMSEC 1354 23-5-02


Bank under accession Nos. AF422492 to AF422528(ISR, T5), AF422529 to AF422538 and AF422540 toAF422575 (ISR, D3), AF422576 to AF422620 (16S, T5),and AF422621 to AF422689 (16S, D3).

2.11. Diversity measures

The clone coverage [23,25] is given by c= [13(S/N)]U100%, where S is the number of species and N is

the number of individuals (i.e., clones). Other indices in-cluded: Shannon^Weaver (H= (C/N)(N log10 N34 ni

log10 ni)) and Evenness (e=H/log S), where C=2.3, andni is the number of individuals in the ith species [26^28].

3. Results

Geochemical analyses conducted on well waters gath-

Fig. 2. Dendrogram of 16S rDNA sequences from pristine groundwater (Well T5; boldface type and pre¢x ‘t’) and from TCE-contaminated ground-water (Well D3; plain type and pre¢x ‘d’). Reference strains (ref) provide a network for examining the lineage of isolated clones. Reference sequencesobtained from GenBank have accession numbers, whereas those obtained from TIGR do not. Tentative taxonomic a⁄liation was assigned to cloned se-quences matching GenBank entries (see text for criteria).

FEMSEC 1354 23-5-02


ered from inside and outside the TCE-contaminated areaof the study site (Table 1) provided clear evidence forintrinsic in situ reductive dechlorination of chloroethenes.TCE and the co-contaminating silicon-based oil, TKEBS,were present in Well D3, but not in Well T5. Also, withinthe contaminated zone, undetectable levels of oxygen anda negative Eh value indicated highly reducing conditions.In contrast, oxygen and Eh readings in the pristine WellT5 indicated oxidizing conditions. Depletion of nitrate andsulfate in D3 relative to T5 also was consistent with alk-oxysilane-induced anaerobiosis. Furthermore, the presenceof 2-ethylbutanol and 2-ethylbutyrate ^ both representingtransformation products of TKEBS previously observed incontrolled laboratory experiments [15,17] ^ and the accu-mulation of acetate in D3 suggested that the microorgan-isms native to this subsurface habitat had adapted to thepresence of TCE and were performing fermentative reac-tions including anaerobic transformation of the tetraalk-oxysilane compound.The key observation indicating in situ reductive dechlo-

rination within the contaminated zone was the detection ofTCE daughter products that serve as signature compoundsfor anaerobic bioattenuation, most importantly cis-DCE,ethene and ethane (Table 1). The latter two were at verylow concentrations. None of these three compounds werereleased during site operations; rather, their likely origin isvia in situ microbial metabolism, driven indirectly byTKEBS hydrolysis [17] as observed earlier in laboratory

studies [15]. Fig. 1 depicts the spatial distribution of con-taminants at the site. The TCE plume has extended in asouthwesterly direction approximately 400 m beyond theinitial point of release. The plume of cis-DCE ^ the ¢rstdaughter product in the reductive dechlorination sequence^ has not migrated as extensively as the TCE, presumablydue to its relatively greater susceptibility to both anaerobicand aerobic [17] biological breakdown processes. Increasesin chloride concentrations can serve as an additional in-dicator of in situ reductive dechlorination. However, thechloride concentration in D3 was not elevated relative toT5 (data not shown), probably because of site heterogene-ity and patchy releases of chloride salts throughout theLLNL complex.Given the clear geochemical evidence for in situ reduc-

tive dechlorination, we undertook a non-culture-based sur-vey of nucleic acid sequences re£ecting the microbial com-munity composition in the two wells. Particular attentionwas directed toward: (i) contrasts between communitiesresiding in contaminated versus non-contaminated zones;(ii) links between phylotypes previously shown to be activein reductive dechlorination and related anaerobic micro-bial processes, and (iii) insights that might develop bycomparing data sets based on 16S rDNA and ISR. Se-quencing was accomplished for a total of 45 and 61 16SrDNA inserts from T5 and D3, respectively, and for 26and 35 ISR inserts from the two respective locations. Allof these were used in diversity calculations (see below).

Table 1Chemistry and geochemistry of perched groundwater from two monitoring wells located inside and outside of the TCE-contaminated zonea

Analyte Unit Contaminated Well W-834-D3 Control Well W-834-T5

Primary contaminants and metabolitesTCE mg l31 56 X 13 BD(historical maximum, February 9, 1993) 800cis-1,2-DCE mg l31 16 X 11 BD(historical maximum, September 25, 1997) 390Vinyl chloride mg l31 BD BDEthene ND ND(historical maximum, May 9, 2000) mg l31 0.0013Ethane ND BD(historical maximum, May 9, 2000) mg l31 0.0004Secondary contaminants and metabolitesTKEBS mg l31 11 X 8 BD(historical maximum, December 21, 1995) 7300 (LNAPL)2-Ethylbutanol mg l31 7 X 9 BD2-Ethylbutyrate mg l31 94 X 141 BDAcetate mg l31 21 X 32 BDHydrogen ND ND(historical maximum, May 9, 2000) nM 7.4Geochemical indicatorspH 7.2 X 0.1 7.7 X 0.2Eh mV 3121X 87 178X 46Dissolved oxygen mg l31 6 2 6.3X 0.4Nitrate mg l31 6 5 137X 6Nitrite mg l31 6 0.5 6 0.5Sulfate mg l31 13 X 5 30X 2Sul¢de mg l31 6 1 6 1

aUnless otherwise noted, reported values represent average concentrations ( X 1 S.D.) of three measurements made between July 28 and September 23,1998. BD, below detection; ND, not determined; LNAPL, light non-aqueous phase liquid.

FEMSEC 1354 23-5-02


The dendrograms shown in Figs. 2 and 3 depict therelationships among 16S rDNA and ISR sequences fromuncontaminated and contaminated well waters. Sixteenreference strains (designated by ‘ref’) were selected to (i)represent common bacteria, (ii) correspond to clones withhigh BLAST scores, and (iii) represent cultured bacteriaknown to carry out reductive dechlorination, i.e., D. multi-vorans, D. restrictus, Desul¢tobacterium sp., D. etheno-genes, Dehalococcoides sp. strain CBDB1, Desulfuromonaschloroethenica, and D. vulgaris [10^12]. ISR sequenceswere available for only 10 of the 16 selected referencestrains.In the 16S rDNA tree (Fig. 2), a tentative taxonomic

a⁄liation was made if the BLAST raw alignment scorewas v 400 and the percent similarity was v 90%. In prac-

tice, this resulted in segment lengths v 346 bases. For theISR tree (Fig. 3), a percentage of v 90% and a segmentlength of v 150 bp were used. For cases where severalorganisms could meet the identi¢cation criteria, only theorganism with the highest score is indicated. Also shownin Figs. 2 and 3 is an additional BLAST statistic of theform n/m= p%, where m is the segment length (i.e., lengthof the aligned region), n is the number of exact matcheswithin the segment, and p is the percentage of identicalmatches.Fig. 2 portrays 16S rDNA sequences of 19 clones from

the uncontaminated well (T5; sequences in boldface type)and 47 clones from the TCE-contaminated well (D3; plaintype) along with 16 reference strains. Isolated sequenceswere distributed across three divisions of the Bacteria:Low G+C Gram-positive bacteria, Proteobacteria, andcandidate phylum OP11. Key characteristics of the 16SrDNA tree include: (i) a ¢rst clade containing two greennon-sulfur reference strains but no isolated clones, therebyindicating the absence in both sampling locations of se-quences related to the dehalorespiring organism Dehalo-coccoides spp.; (ii) a second clade (bracketed by referencestrain Clostridium botulinum and d162) indicating the pres-ence ^ in contaminated groundwater only ^ of three clones(d025, d154, and d011) that resembled (by BLAST) theuncultured clone SJA-19 and its close relative, PCE-de-chlorinating bacterium D. restrictus, all clustered withfour other Low G+C Gram-positive reference strainsand an unidenti¢ed clone (d162); (iii) a third clade com-posed of 13 clones (bracketed by d021 and d040) that wereobtained exclusively from contaminated groundwater;these had no close relatives, but resembled (by BLAST-similarity score) endosymbiont sequences reported byRavenschlag et al. [23] ; (iv) a fourth clade containingtwo K proteobacterial clones (t008 and t009), both origi-nating in the uncontaminated location, and one being re-lated to Agrobacterium sanguineum (t008); (v) a ¢fth cladecomposed of eight clones obtained exclusively from con-taminated groundwater (bracketed by d028 and d064),several of which had high similarity to Zoogloea and Agro-bacterium (aerobic K and L Proteobacteria) ; (vi) a sixthclade containing three unidenti¢ed clones obtained fromthe uncontaminated location (t022, t041, t051) plus two Q

proteobacterial reference strains (E. coli K-12 and Pseudo-monas stutzeri) ; (vii) a seventh clade (bracketed by d085and Thiobacillus cuprinus) consisting of two referencestrains and 16 clones that were obtained from either un-contaminated or contaminated groundwater ^ 12 of theseclones originated in well D3 and grouped loosely with theMTBE-degrading reference strain; (viii) a single clone(t043) of uncertain lineage obtained from uncontaminatedgroundwater; (ix) a single clone (d076) of uncertain line-age obtained from contaminated groundwater; (x) adeeply branched, heterogeneous clade of 11 sequences(bracketed by t019 and t015) consisting of ¢ve clonesfrom uncontaminated groundwater, three clones from con-

Fig. 3. Dendrogram of 16S^23S rDNA ISR sequences from pristinegroundwater (Well T5; boldface type and pre¢x ‘t’) and from TCE-con-taminated groundwater (Well D3; plain type and pre¢x ‘d’). Referencestrains (ref) provide a network for examining the lineage of isolatedclones.

FEMSEC 1354 23-5-02


taminated groundwater, and three N proteobacterial refer-ence strains (D. vulgaris, G. sulfurreducens and D. chloro-ethenica) ; (xi) a lack of sequences related to the PCE/TCE-dechlorinating reference strain D. multivorans ; (xii) a het-erogeneous clade (bracketed by t030 and t046) consistingof four clones of uncertain lineage, three originating inuncontaminated groundwater and one in contaminatedwell water (d071; related to Bacteroides sp.) ; (xii) anotherheterogeneous clade (bracketed by d010 and d073) repre-senting the candidate phylum OP11, consisting of ¢veclones obtained from both uncontaminated and contami-nated groundwater; and lastly (xiii) an absence of sequen-ces belonging to the Archaea group represented by theMethanosarcina reference strain.Overall, the 16S rDNA dendrogram reveals the presence

of two distinct microbial communities in the two samplinglocations. BLAST comparison of sequences also showedno overlap in the form of identical matches. Species diver-sity indices for the two sampling locations, summarized inthe top half of Table 2, indicate reduced species diversityand reduced uniformity in the contaminated location rel-ative to the background.While use of the 16S rDNA gene has become wide-

spread in ecological investigations (e.g. [29,30]), few stud-ies have explored the value of ISR sequence analysis.Therefore, the DNA extracts used for the 16S rDNA anal-ysis were also used to clone ISRs. The resulting dendro-gram (Fig. 3) contains 26 clones from T5 and 35 clonesfrom D3 along with 10 reference sequences. Few databaseentries matched our cloned sequences using BLAST, be-cause of (i) the speci¢city of ISR sequences, (ii) the cur-rently relatively small size of the database, and (iii) thelimited availability of ISR sequences for the selected refer-ence strains. Dendrogram associations probably have lim-ited taxonomic signi¢cance although high BLAST scoresshould provide taxonomic insights. A striking feature ofthe ISR tree is the clustering of T5 and D3 clones inseparate areas of the dendrogram. The top three smallclades (bracketed by t1018 and t1019; t1017 and t1031;t1011 and d4008) are composed almost exclusively of T5clones, with the one exception (d4008) appearing on aseparate, remote branch. The ¢rst large clade contains19 clones from the contaminated well (bracketed by

d0413 and d4048) plus the reference strain D. ethenogenes,that occurs on a separate branch indicating limited simi-larity. The second large clade (bracketed by d4033 andd4042) contains 14 clones from the contaminated location.Nine of these have 90+% similarity to the MTBE-degrad-ing reference strain. The third large clade (bracketed byt1026 and E. coli K-12) contains nine clones from theuncontaminated site, six of them being similar to theP. stutzeri reference strain. On the bottom of the ISRtree, a ¢nal clade (bracketed by t1003 and reference strainMethanosarcina frisius) combines four clones obtainedfrom uncontaminated groundwater and, on a separate dis-tant branch, the Archaea reference strain. Thus, the stron-gest clue to the identity of bacteria, as determined by ISRsequence analysis, is the dominance of Pseudomonads inWell T5 (six of 26 clones or 23% total) whereas the iden-tity of frequent clones in Well D3 (bracketed by d4013 andd4048; 19 of 35 clones; 54% total) is unknown. The sep-arate clustering of T5 and D3 clones in the ISR dendro-gram strongly suggests the presence of two distinct micro-bial communities. Species diversity indices (Table 2,bottom half) support this conclusion, indicating reduceddiversity and diminished uniformity in the contaminatedsite relative to the background.

4. Discussion

Geochemical and molecular biological analyses ofgroundwater from LLNL Site 300 revealed the presenceof a microbial community that is tolerant of high levels oftoxic chloroethenes (as illustrated by TCE and cis-DCEconcentrations of 800 and 250 mg l31, respectively; bothdetected on February 9, 1993) and that ferments an un-usual co-contaminant linked to in situ reductive dechlori-nation reactions. The presence of cis-DCE ^ with histor-ical concentrations as high as 390 mg l31 ^ providesirrefutable evidence that intrinsic in situ reductive dechlo-rination is a major degradative pathway governing the fateof TCE at this national priority site. The occurrence andrelevance of further reductive dechlorination of cis-DCEto vinyl chloride and ethene/ethane is of lesser certainty,however. Concentrations of vinyl chloride never exceeded

Table 2Microbial species diversity indices for pristine groundwater (Well W-834-T5) and TCE-contaminated groundwater (Well W-834-D3), calculated from16S rDNA and 16S^23S rDNA ISR sequence data

Monitoring well Clone coverage (c) Shannon^Weaver index (H) Evenness (e)

16S rDNAT5 18% 3.59 2.29D3 61% 2.40 1.70

ISRT5 35% 2.68 2.18D3 83% 1.20 1.54

FEMSEC 1354 23-5-02


the detection limit of 5 Wg l31 and levels of ethene andethane, although detectable in the contaminated area, his-torically have remained four to six orders of magnitudebelow those of the primary contaminant TCE (Table 1).Given these concentration di¡erences, we conclude thatmicrobial reductive dechlorination of TCE at the site islargely limited to a single dechlorination step yieldingcis-DCE. As discussed below, this conclusion was sup-ported by the results of DNA pro¢ling of contaminatedgroundwater.

4.1. Sequences potentially linked to bioremediationprocesses

A comprehensive census of the microbial populations inthe two study locations was not attempted. Rather, con-trasts between the communities, as re£ected by retrievednucleic acid sequences, were sought. The signi¢cance ofDNA sequence-pro¢ling data strongly depends on proce-dural and analytical approaches taken. Potential sourcesof bias in molecular biological studies include sample ma-trix (groundwater vs. sediment), sample collection, DNAextraction protocols, primer selection, PCR, and dataanalysis tools [25,29,31]. In an attempt to minimize proce-dural bias, we standardized both the 16S rDNA and theISR assay as much as possible by processing identicalsamples, using the same computational procedures, andthe same data analysis techniques (BLAST and PileUp).A major advantage of the multiple alignment programPileUp is that, by default, terminal gaps are not penalized;therefore, sequences of very di¡erent lengths (e.g., ISRsand incomplete sequences) can be aligned. This approachdi¡ers from the Clustal alignment algorithm adopted ina recently updated version of the ARB software package([32]; http://ubik.microbiol.washington.edu/ClustalW/clustalv.html; Genetics Computer Group, personal com-munication). Important limitations of PileUp are that itdoes not provide a rigorous phylogenetic analysis, andthat the lack of scale bars complicates direct comparisonamong multiple dendrograms. However, in this study Pile-Up was a valuable tool allowing for (i) rapid visualizationof microbial diversity, (ii) comparison of sequences thatvaried in length, and (iii) comparison of two di¡erentpro¢ling techniques.Certain 16S rDNA sequences retrieved from D3 are

particularly noteworthy with respect to anaerobiosis, re-ductive dechlorination, and dehalorespiration. Several 16SrDNA clones showed strong sequence similarity to knownrepresentatives of anaerobic bacteria (e.g., G. sulfurredu-cens, Desulfovibrio). Three out of 61 clones (d025, d154,and d011; 5%) matched closely to GenBank sequenceSJA-19, which has been hypothesized to represent yetuncultivated members of the genus Dehalobacter [33]. Pro-viding a de¢nitive mechanistic link between microbialcommunity structure and metabolic functions is very chal-lenging and has been achieved only in a few exceptional

studies [34,35]. However, the close relationship of the threeSJA-19-related clones to the reference strain D. restrictusis of particular interest, because the occurrence and rela-tive abundance of these sequences may be interpreted as alink between geochemical ¢eld data and the physiology ofa known microorganism. D. restrictus is a strict anaerobethat exclusively uses hydrogen as an electron donor whendehalorespiring PCE and TCE to the dead-end productcis-DCE [36,37]. The responsible enzyme is a PCE reduc-tive dehalogenase that recently has been puri¢ed [11].Thus, predictions based on this type of metabolism matchthe groundwater chemistry observed in the contaminatedsampling location. Three additional sequences (d010,d153, d073) fell into the candidate division OP11, whichhas been hypothesized to play a signi¢cant role in thebioremediation of an aquifer contaminated with hydrocar-bons and chlorinated solvents [24]. However, the pristinewell also contained two sequences (t010 and t037) relatedto OP11.Given the accumulation of cis-DCE in anaerobic site

groundwater, it is also interesting to note that the nucleicacid survey failed to detect D. ethenogenes and relatedsequences. This dehalorespiring, ethene-producing bacte-rium ([7] and references cited therein) either is not presentat the site, or it may occur at levels that are insu⁄cient toa¡ect site chemistry; or it may not be detectable with thenon-speci¢c cloning approach taken in this study. In arecent survey that used a more selective nested-PCR ap-proach for detection of D. ethenogenes, one chloroethene-contaminated location and three pristine freshwater sedi-ments tested positive for the target organism [38].Physiological traits associated with additional 16S

rDNA sequences depict a community composition consis-tent with site biogeochemical reactions. The large clade inFig. 2 (bracketed by d022 and reference strain PM1), con-sisting of 11 unidenti¢ed clones loosely a⁄liated with anMTBE-degrading bacterium, showed close similarity toZ93960, a sequence found in activated sludge from a largemunicipal wastewater treatment plant [39]. The authorsnoted that the most dominant group in this sludge samplewas the L1 group of Proteobacteria. This group encom-passes Acidovorax and other genera well known for theutilization of a wide range of carbon sources. Similarly,in the ISR data (Fig. 3), at least nine sequences, obtainedfrom the contaminated well, also were closely related tothe MTBE-degrading bacterium that recently was reportedto occur at leaking underground storage tank (LUST) siteswith MTBE bioattenuation potential [40]. Consistent de-tection of sequences related to an MTBE-metabolizingbacterium was unexpected because MTBE was not amongthe contaminants. Extensive extrapolation from 16SrDNA similarity to potential metabolic function of uncul-tured microorganisms is unwise because signi¢cant dispar-ities may exist between predicted microbial functions andthe actual role uncultured microorganisms play in naturalenvironments [30,41].

FEMSEC 1354 23-5-02


4.2. Interpretation of 16S rDNA and ISR dendrograms

One goal of this study’s sequencing e¡orts was to com-pare the utility of 16S rDNA and ISR sequences in assess-ing the impact of organic contaminants on the microbialcommunity of the site. Given the moderate number of 16SrDNA and ISR sequences obtained in this study (106 and61, respectively), it was not surprising to see values forclone coverage ranging from a mere 18% (16S rDNA as-say for T5) to 83% (ISR for D3; Table 2). In addition,most of the ISR sequences were inexact matches to Gen-Bank accessions and thus may represent novel species.However, such interpretations must be tentative, due tothe small number of ISR sequences in the database. Anexpanded ISR database containing environmentally rele-vant sequences is currently being assembled [42], andshould make ISR analysis increasingly useful in the future.Sequences obtained in this study may contribute to achiev-ing this goal.In support of the geochemical information compiled in

Table 1, the microbial data suggest that distinct selectivepressures were present in the pristine and contaminatedareas. No overlap was evident between microbial com-munities in D3 and T5. This is consistent with a similarstudy in which electrophoresis was used to analyze ISRsequences ampli¢ed from microbial communities nativeto two adjacent soils from the Amazon region [43]. De-spite their close proximity, selective pressure resultingfrom agricultural use at one of the locations appeared tohave triggered the development of two distinct populations[43]. Studies using directly ampli¢ed ISR sequences havealso proven to be e¡ective in di¡erentiating closely relatedpure cultures of Archaea and Bacteria recently isolatedfrom environmental samples [44,45]. In this study, resultsof 16S rDNA and ISR analyses were in good agreement,as both indicated greater diversity and more evenness inthe pristine well relative to the contaminated one. Thisalteration of the microbial composition in D3 must beattributed to the selective e¡ect of both solvent-inducedtoxicity and improved availability of carbon/energy sour-ces and electron acceptors.Consistency between 16S rDNA and ISR data under-

scores the potential usefulness of ISR analysis for pur-poses of microbial community pro¢ling. In addition, theshort length of ISRs provides more e⁄cient PCR ampli¢-cation and typically allows for accurate sequencing ofmost ISRs in two reads. Thus, ISR analysis may o¡erseveral advantages that can make it a valuable additionto conventional 16S rDNA techniques.

4.3. Signi¢cance of tetrakis(2-ethylbutoxy)silane

Hydrolysis of the tetraalkoxysilane co-contaminant canoccur either abiotically or biotically, and may result in therelease of up to four 2-ethylbutanol moieties per trans-formed molecule [17]. Laboratory experiments with micro-

cosms constructed from anaerobic Site-300 groundwatershowed that fermentation of the released 2-ethylbutanolcan result in the formation of 2-ethylbutyrate, acetateand hydrogen [15,18]. From data collected in the present¢eld study, it is evident that these reactions also occur insitu and that they are of environmental relevance. Concen-trations of 2-ethylbutyrate and acetate £uctuated consid-erably but, overall, had high average values of 94 and21 mg l31, respectively, for three sampling events thatoccurred within a 2-month period (Table 1). Hydrogenconcentrations, ¢rst determined in the spring of 2000,were in the low nM range indicating conditions favorablefor sulfate reduction and methanogenesis [19]. These ob-servations strongly suggest that the tetraalkoxysilane com-pound is a key factor determining the fate of TCE at thesite; a forthcoming study containing data from seasonal¢eld samples and anaerobic groundwater microcosms pro-vides additional evidence strengthening this claim [18]. It isremarkable that some 15^45 years after the accidental re-lease of the silicon-based lubricant, fermentation of thiscompound continues in the subsurface and apparentlyprovides a source of hydrogen for a microbial communitywhose intrinsic bioremediation activity previously hasbeen observed only in a laboratory setting [15].In summary, this study provided insights into the micro-

bial activity and bacterial diversity at LLNL Site 300. Thedocumentation of intrinsic in situ bioremediation at thesite, achieved by using a combination of geochemicaland molecular biological analyses, lends credibility to theproposed application [15,46] of TKEBS and similar tet-raalkoxysilanes as long-term slow-release compounds [15]facilitating in situ reductive dechlorination of chloro-ethenes over periods of years or even decades. An addi-tional bene¢t of these compounds ^ that could not be ex-plored in this work ^ is their potential for triggeringaerobic cometabolism of chloroethenes [17]. Tetraalkoxy-silanes and their respective hydrolysis products have beenshown to serve as the primary substrates of aerobic enrich-ment cultures capable of co-oxidizing TCE and cis-DCE[17].

Acknowledgements

This work was supported by funds from DOE EM-40under contract W-7405-Eng-48, DOE’s Accelerated SiteTechnology Deployment Program, Loyola matching fundsfor students pertaining to DOE NABIR grant DE-FG02-99ER62868, DOE grant DE-FG07-96ER62320, and NSFgrant CTS-9253633. We would like to thank L. Semprini,S. Vancheeswaran, S. Yu, and M-Y. Chu for quantifyingtetraalkoxysilanes and their transformation products. Wealso would like to thank S. Gregory and V. Madrid forassisting in groundwater sampling and plume contouring,and D. Brown for assisting in DNA extraction and pro-cessing. We acknowledge the assistance of L. Petersen, K.

FEMSEC 1354 23-5-02


Sorensen and R. Starr in converting the Building 834Study Area at LLNL Site 300 into an ASTD deploymentsite for monitored natural attenuation and in situ biore-mediation. Finally, we would like to thank the Institute ofGenomic Research (TIGR) for sequence data.

References

[1] National Research Council (2000) Natural Attenuation for Ground-water Remediation. National Academy Press, Washington, DC.

[2] Ellis, D.E., Lutz, D.J., Odom, J.M., Buchanan, R.J., Bartlett, C.L.,Lee, M.D., Harkness, M. and DeWeerd, K.A. (2000) Bioaugmenta-tion for accelerated in situ anaerobic bioremediation. Environ. Sci.Technol. 34, 2254^2260.

[3] Wackett, L.P. and Hershberger, D.C. (2001) Biocatalysis and Biodeg-radation. ASM Press, Washington, DC.

[4] Pieper, D.H. and Reineke, W. (2000) Engineering bacteria for biore-mediation. Curr. Opin. Biotechnol. 11, 2626.

[5] Morse, J.J., Alleman, B.C., Gossett, J.M., Zinder, S.H., Fennell,D.E., Sewell, G.W. and Vogel, C.M. (1998) A treatability test forevaluating the potential applicability of the reductive anaerobic bio-logical in situ treatment technology (RABITT) to remediate chloro-ethenes. Draft Technical Protocol. Environmental Security Technol-ogy Certi¢cation Program, Department of Defense. http://www.estcp.org/documents/techdocs/Rabbitt_Protocol.pdf.

[6] DeBruin, W.P., Kotterman, M.J.J., Posthumus, M.A., Schraa, G.and Zehnder, A.J.B. (1992) Complete biological reductive transfor-mation of tetrachloroethene to ethane. Appl. Environ. Microbiol. 58,1996^2000.

[7] Maymo-Gatell, X., Anguish, T. and Zinder, S.H. (1999) Reductivedechlorination of chlorinated ethenes and 1,2-dichloroethane by De-halococcoides ethenogenes 195. Appl. Environ. Microbiol. 65, 3108^3113.

[8] van Eekert, M.H.A. and Schraa, G. (2001) The potential of anaerobicbacteria to degrade chlorinated compounds. Water Sci. Technol. 44,49^56.

[9] El Fantroussi, S., Naveau, H. and Agathos, S.N. (1998) Anaerobicdechlorinating bacteria. Biotechnol. Prog. 14, 167^188.

[10] Adrian, L., Szewzyk, U., Wecke, J. and Gorisch, H. (2000) Bacterialdehalorespiration with chlorinated benzenes. Nature 408, 580^583.

[11] Holliger, C., Wohlfarth, G. and Diekert, G. (1999) Reductive dechlo-rination in the energy metabolism of anaerobic bacteria. FEMS Mi-crobiol. Rev. 22, 383^398.

[12] Zinder, S.H. (2002) in: Encyclopedia of Environmental Microbiol-ogy, Vol. 1:507^516 (Bitton, G., Ed.). John Wiley, New York.

[13] Hohnstock-Ashe, A.M., Plummer, S.M., Yager, R.M., Baveye, P.and Madsen, E.L. (2001) Further biogeochemical characterizationof a trichloroethene-contaminated fractured dolomite aquifer: elec-tron source and microbial communities involved in reductive dechlo-rination. Environ. Sci. Technol. 35, 4449^4456.

[14] Boving, T.B. and Brusseau, M.L. (2000) Solubilization and removalof residual trichloroethene from porous media: comparison of severalsolubilization agents. J. Contam. Hydrol. 42, 51^67.

[15] Semprini, L., Vancheeswaran, S., Yu, S.H., Chu, M.Y. and Halden,R.U. (2000) Tetraalkoxysilanes as slow release substrates to promoteaerobic and anaerobic dehalogenation reactions in the subsurface.Abstr. Pap. Am. Chem. Soc. 220, 125-ENVR Part 1.

[16] Vancheeswaran, S. (1998) Abiotic and biological transformation ofTBOS and TKEBS, and their role in the biological transformation ofTCE and c-DCE. Master’s Thesis. Department of Civil Engineering,Construction, and Environmental Engineering, Oregon State Univer-sity, Corvallis, OR.

[17] Vancheeswaran, S., Halden, R.U., Williamson, K.J., Jr., J.D.I. andSemprini, L. (1999) Abiotic and biological transformation of tetra-

alkoxysilanes and tetrachloroethene/cis-dichloroethene cometabolismdriven by tetrabutoxysilane-degrading microorganisms. Environ.Sci. Technol. 33, 1077^1085.

[18] Vancheeswaran, S., Yu, S., Daley, P., Halden, R.U., Williamson,K.J., Ingle, J.D., Jr. and Semprini, L. (2002) Anaerobic biotransfor-mation of trichloroethene driven by tetraalkoxysilanes at Site 300,Lawrence Livermore National Laboratory, CA, submitted for pub-lication.

[19] Chapelle, F.H., Vroblesky, D.A., Woodward, J.C. and Lovley, D.R.(1997) Practical considerations for measuring hydrogen concentra-tions in groundwater. Environ. Sci. Technol. 31, 2873^2877.

[20] Lawrence Livermore National Library. (2000) LLNL Livermore Siteand Site 300 Environmental Restoration Project Standard OperatingProcedures (SOPs). Lawrence Livermore National Laboratory, Liver-more, CA.

[21] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Clon-ing: a Laboratory Manual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

[22] Barns, S.M., Fundyga, R.E., Je¡ries, M.W. and Pace, N.R. (1994)Remarkable archaeal diversity detected in a Yellowstone NationalPark hot spring environment. Proc. Natl. Acad. Sci. USA 91,1609^1613.

[23] Ravenschlag, K., Sahm, K., Pernthaler, J. and Amann, R. (1999)High bacterial diversity in permanently cold marine sediments.Appl. Environ. Microbiol. 65, 3982^3989.

[24] Dojka, M.A., Hugenholtz, P., Haack, S.K. and Pace, N.R. (1998)Microbial diversity in a hydrocarbon- and chlorinated-solvent-con-taminated aquifer undergoing intrinsic bioremediation. Appl. Envi-ron. Microbiol. 64, 3869^3877.

[25] Giovannoni, S.J., Mullins, T.D. and Field, K.G. (1995) in: MolecularEcology of Aquatic Microbes (Joint, I., Ed.), pp. 217^248. Springer-Verlag, Berlin.

[26] Atlas, R. and Bartha, R. (1993) Microbial Ecology. Benjamin/Cum-mings Publishing Company, Redwood City, CA.

[27] Marilley, L., Vogt, G., Blanc, M. and Aragno, M. (1998) Bacterialdiversity in the bulk soil and rhizosphere fractions of Lolium perenneand Trifolium repens as revealed by PCR restriction analysis of 16SrDNA. Plant Soil 198, 219^224.

[28] Nubel, U., Garcia-Pichel, F., Kuhl, M. and Muyzer, G. (1999) Quan-tifying microbial diversity: morphotypes, 16S rRNA genes, and ca-rotenoids of oxygenic phototrophs in microbial mats. Appl. Environ.Microbiol. 65, 422^430.

[29] Amann, R., Ludwig, W. and Schleifer, K.-H. (1995) Phylogeneticidenti¢cation and in situ detection of individual microbial cells with-out cultivation. Microbiol. Rev. 59, 143^169.

[30] Pace, N.R. (1997) A molecular view of microbial diversity and thebiosphere. Science 276, 734^740.

[31] Suzuki, M.T. and Giovannoni, S.J. (1996) Bias caused by templateannealing in the ampli¢cation of mixtures of 16S rRNA genes byPCR. Appl. Environ. Microbiol. 62, 625^630.

[32] Thompson, J.D., Plewnlak, F. and Poch, O. (1999) A comprehensivecomparison of multiple sequence alignment programs. Nucleic AcidsRes. 27, 2682^2690.

[33] Wintzingerode, F.v., Selent, B., Hegemann, W. and Gobel, U.B.(1999) Phylogenetic analysis of an anaerobic, trichlorobenzene-trans-forming microbial consortium. Appl. Environ. Microbiol. 65, 283^286.

[34] Orphan, V.J., House, C.H., Hinrichs, K.U., McKeegan, K.D. andDeLong, E.F. (2001) Methane-consuming archaea revealed by di-rectly coupled isotopic and phylogenetic analysis. Science 293, 484^487.

[35] Boetius, A. et al. (2000) A marine microbial consortium apparentlymediating anaerobic oxidation of methane. Nature 407, 623^626.

[36] Holliger, C., Schraa, G., Stams, A.J.M. and Zehnder, A.J.B. (1993) Ahighly puri¢ed enrichment culture couples the reductive dechlori-nation of tetrachloroethene to growth. Appl. Environ. Microbiol.59, 2991^2997.

FEMSEC 1354 23-5-02


[37] Holliger, C. et al. (1998) Dehalobacter restrictus gen. Nov. and sp.Nov., a strictly anaerobic bacterium that reductively dechlorinatestetra- and trichloroethene in an anaerobic respiration. Arch. Micro-biol. 169, 313^321.

[38] Lo«¥er, F.E., Sun, Q., Li, J. and Tiedje, J.M. (2000) 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonasand Dehalococcoides species. Appl. Environ. Microbiol. 66, 1369^1374.

[39] Snaidr, J., Amann, R., Huber, I., Ludwig, W. and Schleifer, K.-H.(1997) Phylogenetic analysis and in situ identi¢cation of bacteria inactivated sludge. Appl. Environ. Microbiol. 63, 2884^2896.

[40] Kane, S.R., Beller, H.R., Legler, T.C., Koester, C.J., Pinkart, H.C.,Halden, R.U. and Happel, A.M. (2001) Aerobic biodegradation ofmethyl tert-butyl ether by aquifer bacteria from leaking undergroundstorage tank sites. Appl. Environ. Microbiol. 67, 5824^5829.

[41] Achenbach, L.A. and Coates, J.D. (2000) Disparity between bacterialphylogeny and physiology. ASM News 66, 714^715.

[42] Garcia-Martinez, J., Bescos, I., Rodriguez-Sala, J. and Rodriguez-

Valera, F. (2001) RISSC: a novel database for ribosomal 16S-23SRNA gene spacer regions. Nucleic Acids Res. 29, 178^180.

[43] Borneman, J. and Triplett, E.W. (1997) Molecular microbial diversityin soils from Eastern Amazonia: evidence for unusual microorgan-isms and microbial population shifts associated with deforestation.Appl. Environ. Microbiol. 63, 2647^2653.

[44] Baudart, J., Lemarchand, K., Brisabois, A. and Lebaron, P. (2000)Diversity of Salmonella strains isolated from the aquatic environmentas determined by serotyping and ampli¢cation of the ribosomal DNAspacer regions. Appl. Environ. Microbiol. 66, 1544^1552.

[45] DiRuggiero, J., Tuttle, J.H. and Robb, F.T. (1995) Rapid di¡eren-tiation of hyperthermophilic Archaea by restriction mapping of theintergenic spacer regions of the ribosomal-RNA operons. Mol. Mar.Biol. Biotechnol. 4, 123^127.

[46] Yang, Y. and McCarty, P.L. (2000) Biomass, oleate, and other pos-sible substrates for chloroethene reductive dechlorination. Bioremed.J. 4, 125^133.

FEMSEC 1354 23-5-02


Documents

Geochemistry and microbial diversity of a trichloroethene-contaminated Superfund site undergoing intrinsic in situ reductive dechlorination