19
Genomics is the study of an organism's genome and the function of the genes >>200 microbial genomes completely sequenced. Key question: How to use this rich source of information? Genomics

Genomics is the study of an organism's genome and the function of the genes >>200 microbial genomes completely sequenced. Key question: How to use this

  • View
    220

  • Download
    0

Embed Size (px)

Citation preview

Genomics is the study of an organism's genome and the function of the genes

>>200 microbial genomes completely sequenced.

Key question:

How to use this rich source of information?

Genomics

start stop

gene

W

IC

D

DNA code: A , G , C , T

GENOME

TRANSCRIPTOME

PROTEOME

METABOLOME

Organisation(HT-sequencing)

Expression(DNA-arrays)

Synthesis/Structure(2D gels -MS-NMR-Xray)

Flux(NMR-kinetics-model)

FUNCTION

DNA

RNA

PROTEIN

METABOLISM

Single genes All genes

Functional genomics

Reading the genome map

Steps1. Determine complete DNA sequence2. Predict genes 3. Translate genes to proteins4. Predict functions of proteins 5. Reconstruct metabolic pathways6. Predict regulatory elements7. Reconstruct regulatory networks

Next: experimental confirmation ! transciptomics, proteomics, metabolomics

Raw sequence data: Bacterial sequence of 2.000.000 to 5.000.000 nucleotides AAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCAC

A virtual cell:overview of predicted pathways

Genomics: from sequence to predicted function

What do we want to learn ?

Overview of• complete repertoire of genes and proteins

• complete metabolic network

• complete regulatory network

• diversity and evolution

Systems biology: understand how a whole cell works

total genes 2.000 6.300 19.000 14.000 30.000 ?

% genes

bacteria yeast worm fly man

Size (Mb) 2 12 97 137 3.500

Genome content

junk ?

Microbial genomes

Microbial genome sequencing 1995-2000: Mainly pathogenic bacteria

2000-present: Genomes of many food relevant micro-organisms - Lactic Acid Bacteria - Food Spoilage Bacteria

1997 2000 2003

Genome Sequencing Projects

2005:250 complete genomes 600 million bases600 thousand proteins

Microbial genomes

Archaea Bacteria

sequenced genomes 23 236

size range (Mb) 0.5-5.8 0.6-9.1

genes 540-4500 470-8300

% GC 31 - 68 22 - 72

Coding density is ~ 85-90%

Average of ~ 1 gene per 1 kb

Status Sept. 2004

Bacterial genomes

Chromosomes 1 circular 0.6 - 9 MbPlasmids 0-10 circular 1 - 250 kb

ExceptionsLinear chromosomes• Borrelia burgdorfei 0.91 Mb• Rickettsia typhi 1.11 Mb• Desulfotalea psychrophila 3.52 Mb• Streptomyces coelicolor 8.67 Mb

Two chromosomes• Ralstonia solanacearum 3.72 and 2.09 Mb• Agrobacterium tumefaciens 2.84 and 2.07 Mb• Vibrio cholerae 2.96 and 1.07 Mb• Brucella melitensis 2.12 and 1.18 Mb• Deinococcus radiodurans 2.65 and 0.41 Mb

Biological Databases

Database types: • sequence EMBL, GenBank• annotation SwissProt• enzyme Enzyme, Brenda• genome Entrez, EBI-Genome Reviews• structure PDB, SCOP• pathway KEGG, EcoCyc• organism FlyBase, WormBase• organizational Pfam, COG

Summarized each year in Nucleic Acids Res., January issue

Genome DatabasesMain databases

• NCBI Entrezwww.ncbi.nlm.nih.gov/genomes/lproks.cgi

• EBI Genome Reviewswww.ebi.ac.uk/genomes/bacteria.html

• TIGR Comprehensive Microbial Resource (CMR)www.tigr.org/tdb

• Integrated Genomics GOLDwww.genomesonline.org

• CBS Genome Altaswww.cbs.dtu.dk/services/GenomeAtlas

Genome Databases

Specialized databases

• Sanger Instituteown genomes, many pathogenic bacteria(UK) www.sanger.ac.uk/projects

• Pasteur Institute own genomes, many pathogenic bacteria(France) www.pasteur.fr/english.html

• MIPS PEDANT – all genomes(Germany) http://pedant.gsf.de/

• DOE-JGI own genomes, many microbial - environmental(USA) http://genome.jgi-psf.org/microbial/

Genome DatabasesOverviews of databases

• ABIM organism databases(France) www.up.univ-mrs.fr/~wabim/english/genome.html

Complete Genomes • COGENT (COmplete GENome Tracking : a flexible data environment for computational genomics) EBI (UK) • Complete genomes NCBI (Haemophilius influenza, E. Coli, Mycoplasma genitalium) • Completed Genomes at the EBI EBI (UK) • Completed microbial genomes InfoBioGen (France) • Completed microbial genomes TIGR • Completely sequenced genomes Rockfeller (USA) • EMGLib (completely sequenced bacterial genomes and the yeast genome) PBIL (France) • Fully Sequenced Genomes Present In The Public DataBases GOLD (USA) • Integr8 (integrated views of complete genomes and proteomes) EBI (UK) • PEDANT (Protein Extraction, Description, and Analysis Tool) MIPS (more 200 genomes) (Germany) • E. Coli : Wisconsin (USA), see also Entrez (NCBI) • Rfam (annotating non-coding RNAs in complete genomes) Saint Louis (USA), see also Sanger (UK) • SACSO (Systematic Analysis of Completely Sequenced Organisms) Pasteur (French) • TIGR : Genomes (USA) • Yeast Genome Project (Complete genome) MIPS (Germany), see also Genome Viewer, see also Comprehensive Yeast Genome Database •

Genome Databases

Comparative genomics databases

• ERGO Comparative genomics analysis • (USA) http://ergo.integratedgenomics.com/ERGO

Genome DatabasesComparative genomics databases

• STRING Search Tool for the Retrieval of Interacting Genes/Proteins(De) http://www.bork.embl-heidelberg.de/STRING

Genome DatabasesMetabolic pathway-genome databases (PGDB)

• KEGG Kyoto Encyclopedia of Genes and Genomes(Japan) http://www.genome.jp/kegg/kegg2.html

• EcoCyc E.coli metabolic pathways (highly curated)

(USA) http://www.ecocyc.org.

• BioCyc collection of PGDBshttp://www.biocyc.org

• modeling the components and their wiring (roadmap)

• modeling regulatory interactions (traffic lights)

• modeling fluxes and dynamics (traffic)

• predictive modeling: rational design (solve traffic jams)

• “genomics modeling”: provide biological interpretation of omics data

Modeling metabolic networks:what are the questions?

Genome sequence annotation