Gene. 42 (1986) 225-229

Elsevier

225

GENE 1557

Genomic organization and nucleotide sequences of two corn histone H4 genes *

(Recombinant DNA; gene library; 2 vector; Zea ways)

Gabriel Philipps, Nicole Chaubet, Marie-Edith Chaboute, Martine Ehling and Claude Gigot **

Luboratoire de Virologie, lnstitut de Biologie Mokculaire et Cellulaire du CNRS, 15 rue Descartes, 67084 Strasbourg CPdex

(France) Tel. 88.61.02.02

(Received November 18th, 1985)

(Revision received January 8th, 1986)

(Accepted January lOth, 1986)

____

SUMMARY

The sea urchin histone H4 gene has been used as a probe to clone two corn histone H4 genes from a

1gt WES . J.B corngenomic library. The nucleotide (nt) sequences of both genes showed that the encoded amino

acid sequences were identical to that of the H4 of pea and one variant of wheat. The nt sequences of the coding

regions showed 92% homology. 5’- and 3’-flanking regions do not show extensive nt sequence analogies.

Southern blotting of the EcoRI digested genomic DNA suggests the existence of multiple H4 genes dispersed

throughout the genome.

INTRODUCTION

The genes encoding histones have been extensive-

ly studied in a wide variety of organisms (reviews by

Hentschel and Birnstiel, 1981; Maxson et al., 1983).

* On request, the authors will supply a detailed experimental

evidence for the conclusions reached in this short presentation.

** To whom all correspondence and reprint requests should be

addressed.

Abbreviations: aa, amino acid(s); bp, base pair(s); H41C7-

In the plant kingdom the structures and genomic

organizations of the genes encoding the histones H3

(Tabata et al., 1984) and two variants of H4 (Tabata

et al., 1983; Tabata and Iwabuchi, 1984) have re-

cently been analysed in wheat. It was shown that in

this plant the majority of the multiple copies of these

genes (80 to 100 and 100 to 125 copies of H3 and H4,

respectively) are dispersed in the genome. On the

other hand, it was reported that in rice at least one

set of the genes encoding H2A, H2B and H4 were

located on a cloned 6.64-kb DNA fragment (Tho-

mas and Padayatty, 1983). In higher plants no other

histone genes have been studied UD to now. H41C14, corn genomic DNA fragments cloned in IgtWES. IB

L

DNA; H4pUC7 and H4pUCl4, DNA fragments of H41C7 and In this communication we report the molecular

H41C14, respectively, containing the coding regions subcloned cloning and nt sequences of the coding regions and

in pUC9; H4C7-H4C14, sequenced regions of H4pLJC7 and the adjacent 5’- and 3’-flanking regions of two corn

H4pUC14, respectively; nt, nucleotide(s). histone H4 genes.

0378-l I19/86/$03.50 0 1986 Elsewer Science Publishers l&V. (Biomedical Division)

226

kXPERIMENT.4L.

(a) Cloning and sequencing

A Southern blot of EcoRI-digested corn (Zea

map, INRA 258) genomic DNA, purified by a tech-

nique derived from that of Zimmerman and Gold-

berg (1977) was hybridized with the “P-labelled

coding region of the sea urchin Psammechinus miliar-

is H4 gene. The complexity of the pattern (Fig. 1)

strongly suggests that the corn H4 genes are not (all)

organized in tandemly repeated units as in several

animal genomes (Hentschel and Birnstiel, 1981;

Maxson et al., 1983). Most probably the majority of

the copies of the H4 gene exist as dispersed elements

in the genome, as it was shown in the wheat genome

(Tabata et al., 1983). Nevertheless the existence of

clusters of H4 genes cannot be excluded.

A corn genomic library was constructed using the

EcoRI arms ofthe bacteriophage Jgt WES iB DNA

as vector and screened with the sea urchin H4 gene

mentioned above as probe. After three rounds of

kb

20 -

9

6.2 -

5

4.2 -

2.36 -

2

Fig. I Hybridization pattern of a Southern blot of 25 1~9 of

&oRI-digested corn genomic DNA electrophoresed on a 0.8”,,

agarose gel. The coding region from nt + 9 to + 286 of the

H4 gene of sea urchin was “P-labelled by nick-translation and

used as hybridization probe. The arrows indicate the DNA

fragments which were cloned and partially sequenced.

screening by the in situ hybridization technique of

Benton and Davis (1977). three positive clones were

plaque-purified, and two of them, H4iLC7 and

H41.C 14, were further characterized. The sizes of the

cloned DNA fragments H4iC7 and H4iC 14 arc 7.6

and 3.1 kb, respectively. The coding regions were

localized by hybridizing a Southern blot of the rc-

stricted DNA inserts with the “P-labelled sea urchin

H4 gene. Each insert was shown to contain only one

copy of the gene. The coding regions as ucll as the

5’ and 3’ flanking regions of the H4 genes present in

each insert were recloned in pUC9 and the complctc

nt sequences were determined by the technique of

Maxam and Gilbert (1980) using the sequencing

strategies shown in Figs. 2 and 3. The primary struc-

tures of the tuo genes are shown in Fig. 4.

(b) The coding regions

The aa sequences of the two histone H4 proteins

deduced from the nt sequences of the coding regions

are identical. Both ofthem differ from the histone H4

of calf thymus by two aa substitutions commonly

found in histone H4 from plants: the valine in po-

sition 60 is replaced by isoleucine and the lysine in

position 77 by arginine. Among the 306 nt of the two

DNA coding regions 25 substitutions were found.

The two regions thus show an nt homology of 92”,,

The homology with the nt sequences of two variant

wheat histonc H4 genes is of the satnc order.

although one of these variants differs by one aa (Ta-

bata et al., 1983; Tabata and Iwabuchi, 1984).

(c) The 5’ flanking regions

The classical TATA box-like sequences are locat-

ed in both genes approx. 110 nt upstream from the

start codon (Fig. 4). Immediately upstream from

these canonical consensus sequences, pentamers

similar to the 5’-GATCC-3’ box can be detected:

the pentamer 5’-GCTCC-3’ is found at position

-136 in H4C7, 24 nt upstream from the TATA box.

In H4C14. two identical sequences 5’-GCCTC-3’

are located at positions -174 and - 136, that is, 12

and 24 nt upstream from the TATA box. Most of the

histone genes studied up to now, including the wheat

H3 and H4 genes, were shown to carry one or t\co

copies of similar sequences located at approximately

the same positions (Hentschcl and Birnsticl, 19X 1).

221

1 Kb _. ES A

Act I I I I I _

Ava I II b Bgl II I

Dde I I I I I I

Fig. 2. Restriction maps and sequencing strategy of the cloned genomic DNA fragment H42C7. (a) Restriction map of H41C7. The

2.0-kb fragment EcoRI-PsrI was further recloned in pUC9. A, AvaI; B, BarnHI; Bg, BglII; E, EcoRI; H, HindIII; P, PstI; S, SalI. The

black boxes indicate the position of the H4 coding region, and the arrow head indicates the 5’-3’ orientation. (b) Restriction maps of

H4pUC7. Only those restriction sites used in the sequencing experiments (after 32P 5’-end labelling) are shown. (c) Sequencing strategy.

The arrows indicate the direction of sequencing.

No typical CCAAT sequences are present. A

5’-CCATC-3’ motif was found in H4C7 at position

-164 and twice in H4Cl4 at nt -144 and -192.

Whether or not these sequences play the role of a

typical “CCAAT-box” remains to be determined.

Sequence homologies between the 5’ flanking

regions of the two genes are restricted to three small

stretches located between the “TATA-box” and the

initiation codon (see Fig. 4).

-- - .4 t_

c- . --

c- )___f

Fig. 3. Restriction maps and sequencing strategy of the cloned

genomic DNA fragment H41C14. (see Fig. 2 for details and

symbols). (a) Restriction map of H42C14. The 1.2-kb fragment

P.~rl-Sal1 was further recloned in pUC9; (b) restriction maps of

H4pUC14; (c) sequencing strategy.

(d) The 3’ flanking regions

No significant sequence homologies were found in

this region. In most of the animal histone genes there

are two sequences involved in the 3’ RNA process-

ing: a G + C-rich T-hyphenated dyad symmetry mo-

tif followed by a FAAAGA “core” (Birnstiel et al.,

1985). In corn H4 as well as in the wheat H3 and

H4 genes this typical inverted repeat is absent.

Nevertheless, in both corn H4 genes there exist

inverted repeats approx. 20 nt after the terminal

codon. These structures are followed by short

A + G-rich sequences: AGAAG at nt + 39 in H4C7

and AGGGGA at nt + 33 in H4C14.

ACKNOWLEDGEMENTS

We wish to thank Prof. L. Hirth for his constant

interest in this work. We also thank

Prof. M.L. Birnstiel for the gift of the plasmid

pHae 18 1 containing the coding region of the histone

H4 gene of sea urchin.

228

H4C7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

-350

. . . . . . . . . . . . . . . . ..*.................. . . . . . . . ..GAATfCGAAGTITC'BGCCCAGCGGTCCACCC

-300 -250

CCRAA~~CACGCG~~CACACRGCA~~CCGCACCAC~ACCGCC~C~C~~CC~CG&G~CC ~AGTCrC~CGGTCG~~TCGACACACGTCCGTCGGTCCCCTCC

ACGCGGAtiGTWCCCATkACG~C:ACTTCG"c?"CT AACGGCGCAGAGTCGCAGACTGGCI'CCGCACCCCACCACACGCCG

-50

ATCCAATCCI;TCAGTACCCAATCTf TACACCAG~G~~nrcCG~A~TC~CCGCG C!TCGTCTCATCTCTKCATACGACC CCCTACCTCC~~CCCRATi’GTC~C~~C~CAGAG~CGAG~ACC

+50

An: TCT GGG CCC GGC AAG G&C GGC AAG GG;. CTG GGC AAG 6GC GGC GCG AiG CCC CAC CC;; I.. ..G . . . . . . ..A . . . . . . ..G .._ ..G . . . . . . . . . 1.. . . . . . . . . . . . T . . . ..C Met Ser Gly Arg Gly Lys Gly Gly Lys Cly Leu Gly Lys Gly Gly Ala LYS Arq His Arg

AAG GTG CiX CCC GAC RAC A+C CAG GGC AT;‘ ACC AAG CCC ;;CG ATC CGG AkG CTG GCf A& c .., . . . .‘. ,.. . . . . . . . . . . . T ..G . . . ._. . . . . . . . . . . . . .._ ..G ..A . . . . .

Lys Val Leu Arq Asp Asn lie Gin Gly Ile Thr Lys Pro Ala Ile Arg Arg Leu Ala Arg

+150

ACG GGT GGC kG AAG CGC A+C TCG GGG CTC ATC TAC GAG CAC ACC CGC GGC GTG CTC AA; . . . . . c *.. . . . . . . ,.. . . . . . . .,. I.. . . . . . . .., ..* . . . . . . . . . . . . . . . Arg Gly Gly Val Lys Arg Xle Ser Gly Leu Ile Tyr Glu Glu Thr Arg Gly Val Leu Ly+

+200

An: 'ITT CTC ;;AG AAC GTC ATC CGC GAC GCC GTC ACC TAC k(I GAG CAC CCC CGC CCC AA& . . . ..C . . . . . . ..T . . . ..T . . . .__ ..T 1.. .._ _.. ..G . . . . . . ..C . . . ..T . . . Ile Phe Leu Glu Am Val Ile Arg Asp Ala Val Thr Tyr 'Rx Glu His Ala Arg Arg Lys

+zso +300

ACC GTG ACC CCC AT(; GAC G+C GTC TAC CCC m MG CGC GAG xc cGc AEC mc TAC G& . . . ..c . . . . . . . . . . . . . . . ,.. . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . ..A Thr Val Thr Ale Met Asp Val Val Tyr Ala Leu Lys Ar9 Gln Gly Arg Thr Leu Tyr Gly

+350

TIC GGA GGG TAGGCTAGGCGCC~~T~CAT~G~~~AG~G~CA~~~~A~~~~ ..T ..C ..C .GAGGGGTCAGGGGTGTCCG~"IGClG~TCGn;GCAGAAGTC'MGGGTCGCGGTCACGAAA Phe Gly Gly End

+400 +450

+!ioo

+650

TCAG~CCM~A~A~A~A~M~~CGAC . . . . . . . . . . . . . ..s......................... . . . . . . . . . .

Fig. 4. Comparison of the nt sequences of the two histone H4 genes H4C7 and H4C14. The nt of the 5’-flanking region are numbered

(negatively) from the start codon (the C preceding ATG is -1). The TATA sequence is boxed and significant sequence homologies are

overlined and/or underlined. Putative GATCC-like boxes are marked with horizontal brackets. Horizontal arrows indicate inverted

DNA repeats. Dots in the coding region of H4C7 indicate nt identities with H4C14. Dotted lines in the 5’- and 3’-flanking regions indicate

that the nt sequence was not established.

229

REFERENCES

Benton, W.D. and Davis, R.W.: Screening Igt recombinant

clones by hybridization to single plaques “in situ”. Science

196 (1977) 180-182.

Birnstiel. M.L., Busslinger, M. and Strub, K.: Transcription ter-

mination and 3’ processing: the end is in site. Cell 41 (1985)

349-359.

Hentschel, C. and Birnstiel, M.L.: The organization and expres-

sion of histone gene families. Cell 25 (1981) 301-313.

Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA

with base-specific chemical cleavage. Methods Enzymol. 65

(1980) 499-560.

Maxson, R., Cohn, R., Kedes, L. and Mohun, T.: Expression and

organization of histone genes. Annu. Rev. Genet. 17 (1983)

239-277.

Tabata, T. and Iwabuchi, M.: Molecular cloning and nucleotide

sequence of a variant wheat histone H4 gene. Gene 3 I (1984)

285-289.

Tabata, T., Sasaki, K. and Iwabuchi, M.: The structural organi-

zation and DNA sequence of a wheat histone H4 gene. Nucl.

Acids Res. I1 (1983) 5865-5875.

Tabata, T., Fukasawa, M. and Iwabuchi, M.: The structural

organization and DNA sequence of a wheat histone H4 gene.

Mol. Gen. Genet. 196 (1984) 397-400.

Thomas, G. and Padayatty, J.D.: Organization and bidirectional

transcription of H2A. H2B and H4 histone genes in rice

embryos. Nature 306 (1983) 82-84.

Zimmerman, J.L. and Goldberg. R.B.: DNA sequence organi-

zation in the genome of Nicoticrnc~ tubacum. Chromosoma 59

(1977) 227-252.

Communicated by J.-P. Lecocq