Genetics - Shaw High Studentsshawhighstudents.org/biology_files/pdfs/Genetics.pdfcentury, Watson and Crick revealed the chemical basis of heredity with their discovery of the double

Gene tics

Genetics

What is DNAWhat is DNA??Understand the relationship of the structure and function of DNA to protein synthesis and the characteristics of an organism.

True or False?

1. Every cell in your body has roughly the same exact DNA. T / F 2. DNA is made up of the bases A, U, C and G. T / F 3. Codons are four bases in a row. T / F 4. Proteins are sequences of amino acids. T / F 5. mRNA turns into DNA in the process of transcription. T / F 6. One gene forms one protein. T / F

About DNA“It's in your genes!”Have you ever been told that you look just like your

mother, or that you act just like your brother or sister? You may not think it's true, but there's a good reason that people say that. It's because, in every cell in your body, you have (more or less) the same DNA. As you already know, you get one copy of your DNA from your mother and one from your father. Also, you know that the DNA is split up into strands called chromosomes, and that the ribosomes use the DNA in order to make proteins.

But what does it really mean that this DNA is in every single one of your cells? After considering this for a while,

many people ask themselves things like, “Why do the cells in my heart need to have the same information as the cells in my stomach?” It's true that all of the 100 trillion cells in your body have all of the genetic information to be or do anything that your body does. It's also true that your DNA is 3 billion “letters” long; in other words each one of those 100 trillion cells contains 3 billion pieces of information!

Each cell in your body only uses the information that it needs from the DNA; in other words, your heart cells only use the heart information, the stomach cells the stomach information. But the cells carry everything around in case they need to become something else, a power which scientists are just beginning to use for themselves!

2009 – 2010 2

Structure of DNA

RNA is made up of codons

What is DNA?

So, how does that DNA actually do anything? The trick is that DNA is turned into proteins, and it's the proteins that make a heart cell beat, a nerve cell send messages, and a lung cell take up air. You can think of the relationship between DNA and protein like this: the DNA is like a page of instructions to build a house and the proteins are the wood, steel, nails, screws and glass that actually make up the house. Clearly, to get from the instructions (DNA) to the building materials

(proteins), something needs to put it all together – so in steps the ribosomes to actually make the protein!

The instructions contained in DNA are made up of only four bases: the chemicals adenosine (A), thymine (T), cytosine (C) and guanine (G). Each base (or “letter”) has a pair: every A is paired with a T, every T with an A, every C with a G, and every G with a C. Different combinations of these chemicals make “words”, otherwise known as codons. Codons are made up of three letters in a row: ATG, GCC, ATC, etc. Ribosomes look at each codon and grab a different amino acid. The ribosomes keep adding amino acids until they get to the end of a gene. The string of amino acids that has been made is called a protein.

There is one step in the diagram which has not been mentioned yet. You may have already noticed that the DNA stays in the nucleus but the ribosomes stay outside the nucleus. So, how is it that the ribosomes make proteins from the DNA? There is a messenger that takes the instructions from the nucleus to the ribosomes: it's called messenger RNA (mRNA). As in our example from before, the

3 Shaw High School

A closer look at DNA

An overview of how DNA becomes proteins

Genetics

instructions are contained by the DNA and the actual building materials are the proteins. Often, just like building a house, the instructions cannot be read by simply anyone. It's the job of the mRNA to put the bases into a language that the ribosomes can understand, which is called transcription.

RNA, as we saw with viruses, is very similar to DNA. There is one major difference: where DNA has thiamine (T), RNA has uracil (U). This means that, if a DNA codon reads “ATA”, then the

same codon in RNA will be “AUA”.

In summary, DNA contains the instructions in sets called genes. One gene is converted to mRNA, which goes outside the nucleus of the cell. Outside of the nucleus, the ribosomes read the mRNA, attaching one amino acid for every three base pairs (codon). This sequence of acids is a protein. For every gene of DNA, there is one and exactly one protein.

True or False?

1. Every cell in your body has roughly the same exact DNA. T / F 2. DNA is made up of the bases A, U, C and G. T / F 3. Codons are four bases in a row. T / F 4. Proteins are sequences of amino acids. T / F 5. mRNA turns into DNA in the process of transcription. T / F 6. One gene forms one protein. T / F

QuestionsQuestions

Do you remember? 1. What are the four bases in DNA? What are they in RNA? 2. What takes the instructions in DNA from the nucleus to the ribosomes? 3. What is a gene?

Think about it!CTACGCCATATTCGGCGATAC

4. Convert the above DNA sequence into the opposite pair of each base. How many codons does it have?

5. Convert the above DNA sequence into RNA.

Do something! 6. Draw the following steps of how DNA becomes a protein in a Four Door foldable (page Error:

Reference source not found). The four doors should contain: a) A gene of DNA is transcribed into mRNA b) mRNA leaves the nucleus c) Ribosomes read the mRNA, adding amino acids

2009 – 2010 4

What is DNA?

d) The amino acids form a protein

Remember? 7. What are the five kingdoms of living things? 8. Differentiate prokaryotes and eukaryotes in three ways (from this chapter). 9. What are homologous chromosomes? 10.What is cell differentiation?

Human Human GenomeGenome Project ProjectImplications of the Genome Project for Medical ScienceBy Francis S. Collins, M.D., Ph.D., Victor A. McKusick, M.D., Karin Jegalian, Ph.D.

Virtually every human ailment, except perhaps trauma, has some genetic basis. In the past, doctors took genetics into consideration only in cases like birth defect syndromes and a limited set of illnesses - like cystic fibrosis, sickle cell anemia, and Huntington disease - that are caused by changes in single genes and are inherited according to predictable Mendelian rules.

Common diseases like diabetes, heart disease, cancer, and the major mental illnesses are not inherited in simple ways. But studies comparing disease risk among families show that heredity does influence who develops these conditions. As a result, many doctors are careful to ask patients about their family histories of such illnesses.

Now, with the genome project releasing a torrent of data about human DNA and promoting growing understanding of human genes, the role of genetics in medicine will change profoundly. Genetics will no longer be limited to guiding medical surveillance based on family histories, or classifying the numerous but relatively rare conditions that stem from changes in single genes.

It is true that for many of the most common illnesses, like heart disease, heredity is clearly only one of several factors that contribute to people's overall risk of developing that disease. The most common diseases in developed countries today generally arise from a complex interplay of causes, including diet, lifestyle, and environmental exposures, as well as heredity.

Genetics in the Twentieth CenturyThe twentieth century saw enormous, even revolutionary, development in the field of

genetics. In the spring of 1900, three different scientists brought Mendel's laws of inheritance to a wide audience. This marked the founding of genetics as a scientific discipline. In the middle of the century, Watson and Crick revealed the chemical basis of heredity with their discovery of the double helical structure of DNA. Over the next fifteen years, scientists began to understand the role of RNA as a messenger molecule copied from DNA, and they elucidated the genetic code that allows RNA to be translated to protein.

In 1980 scientists began mapping genes whose variants cause disease. In 1983, for example, mapping localized the Huntington disease gene to chromosome 4. But even after mapping them, finding the genes actually responsible for diseases remained an arduous task. Years of work were required to develop detailed maps over the regions containing long-sought genes, and then to search among the genes in these areas to find the ones specifically desired.

The Human Genome ProjectThe Human Genome Project (HGP) plan included the decision to map and sequence the

genomes of other organisms that have been important to the study of biology: bacteria, yeast, roundworm, fruit fly, and mouse. In addition, the project sought to improve sequencing technology.

From its inception, the HGP has been an international effort. The United States has made the largest investment, but important contributions have come from many countries, including Britain, France, Germany, Japan, China, and Canada. When the project began, the complete human genome sequence was expected by the year 2005, though there was certainly very little reason to be confident then that this goal could be achieved. But one by one, the intermediate milestones were accomplished.

5 Shaw High School

Genetics

The HGP participants had agreed all along to release all maps and all DNA sequence data into public databases. With access to increasingly detailed maps of the genome, the research community began to identify genes involved in diseases more and more quickly. While less than 10 genes had been identified by the technique known as positional cloning in 1990, that number grew to more than 100 by 1997.

By 1996, with complete genome sequences obtained for several species of bacteria and for yeast, HGP participants decided to attempt sequencing human DNA, at least on a trial scale. The availability of new kinds of sequencing machines and the effort by a newly formed private company to sequence the human genome further spurred the effort. By 1999, confidence grew that HGP participants were ready to sequence the three billion base pairs of the human genome. In June 2000, both the private company and the Human Genome Project's international consortium announced the completion of "working drafts" of the human genome sequence.

Current Genomic ResearchThe human genome must be sequenced completely. Gaps that remain in the draft sequence

must be clarified. This finishing process had been accomplished for chromosomes 21 and 22 by the summer of 2000, and will be carried out for the rest of the genome by 2002.

Genome sequences will be obtained for other organisms. Comparing genome sequences from different species will be a great aid in revealing the genes, since the stretches of DNA that code for protein and the regions in genes that regulate their expression tend to be conserved among species. Large-scale sequencing of laboratory mouse DNA has already started. Projects to sequence rat and zebrafish DNA will not be far behind. Scientists in both the public and private sectors are seriously considering sequencing other large vertebrates' genomes, including those of the pig, dog, cow, and chimpanzee.

Genetics in the Medical MainstreamOver the next quarter century, the practice of medicine will increasingly depend on an

understanding of molecules and genetics.By the year 2010, predictive genetic tests are likely to be available for many common

conditions, allowing individuals who wish to know this information to learn what their individual susceptibilities are, and to take steps to reduce those risks for which interventions are available. The interventions could take the form of medical surveillance, life style modifications, changes in diet, or drug therapy. For example, those at highest risk for colon cancer could undergo frequent colonoscopies for screening, which would prevent many premature deaths. Predictive genetic tests are likely to be applied first in cases where individuals have a strong family history of a particular condition; in fact, such testing is already available for a few conditions, including breast cancer and colon cancer.

But with increasing genetic information available about common illnesses, this kind of genetic risk assessment will become more generally available. Many primary care providers will need to practice genomic medicine; they will need to explain complex statistical risk information to healthy patients who are seeking to maximize their chances of staying well. This will require substantial advances in the understanding of genetics by health care providers. Another crucial step is the passage of legislation that bans the use of genetic information that predicts future risk in decisions about health insurance and employment. Individuals should not have to forgo acquiring genetic information about themselves out of fear of discrimination. Although more than two dozen states have taken some action on the issues of genetic privacy and genetic discrimination, an effective Federal law would help eliminate the patchwork of different levels of protection across the U.S.

Respond 1. What does “genome” mean? 2. What is the purpose of the HGP? 3. Explain, in one paragraph, the role of heredity in developing diseases. 4. Why is it important that genomes be sequenced for other species than humans?

2009 – 2010 6

What is DNA?

5. What is the purpose of offering genetic tests to patients? 6. Predict three different things that might happen in your life if you tested positive for a

genetic disease that limited your ability to walk.

ActivitiesActivities

What a Difference an “A” MakesWhat a Difference an “A” Makes

In this activity, you will be creating a sequence of amino acids from a sequence of DNA. Then, you will investigate what happens when you make mutations (changes) to that sequence of DNA.

DNA DNA Replicates mRNA tRNA Amino Acids

T

A

C

A

C

C

C

G

A

A

T

A

A

T

T

1. Fill in the second column (DNA Replicates) with the complementary base pairs of DNA for the DNA in the first column.

2. Fill in the third column (mRNA) with the transcribed mRNA base pairs for the DNA in the first column.

3. Fill in the fourth column (tRNA) with the three-base codons from the mRNA using the chart below.

4. For the last column (Amino Acids), translate the codons into the amino acids that the tRNA adds using the chart below.

5. Assume that the base in position 6 of the original DNA strand mutates to an "A." How will the sequence of #1,2,3, and 4 be affected?

6. Suppose the base in position 2 gets shifted to position 16; how will the sequence of #1,2,3 and 4 (above) be affected?

7. If the base in position 12 is changed to a "T," how will the sequence of #1,2,3 and 4 (above) be affected?

8. Write a paragraph discussing what happened in #5, 6, and 7.

7 Shaw High School

Genetics

What a Difference an “A” MakesWhat a Difference an “A” Makes

Amino acid Associated codon(s)

Alanine GCA, GCC, GCG, GCU

Arginine AGA, AGG, CGA, CGC, CGG, CGU

Asparagine AAC, AAU, GAC, GAU

Cysteine UGC, UGU

Glutamic acid GAA, GAG

Glutamine CAA, CAG

Glycine GGA, GGC, GGG, GGU

Histidine CAC, CAU

Isoleucine AUA, AUC, AUU

Leucine UUA, UUG, CUA, CUC, CUG, CUU

Lysine AAA, AAG

Methionine (“Start”) AUG

Phenylalanine UUC, UUU

Proline CCA, CCC, CCG, CCU

Serine AGC, AGU, UCA, UCC, UCG, UCU

Threonine ACA, ACC, ACG, ACU

Tryptophan UGG

Valine GUA, GUC, GUG, GUU

"Stop" codon UAA, UAG, UGA

DNADNA from Kiwi Fruit from Kiwi Fruit

Materials: • One small Ziploc® bag• Jar or beaker that fits strainer or funnel • Funnel • A #6 coffee filter • Ice-water bath• Water • 25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water) • Kiwifruit, half a kiwi per group of students • Table salt• 1 – 20ml test tube per group, preferably with a cap • 1 – 10ml test tube per group, preferably with a cap • Ice cold rubbing alcohol stored in freezer or on ice until use Group Procedure:

1. Get six pieces of kiwi and put them in a Ziploc® bag.

2009 – 2010 8

What is DNA?

DNADNA from Kiwi Fruit from Kiwi Fruit

2. Add 20ml of shampoo solution to the Ziploc® bag. Make sure the bag is closed with extra air. (The shampoo solution breaks the cell membrane because the membrane is made of fats.)

3. Mush the kiwi thoroughly but carefully so the bag doesn’t break, for about five minutes. 4. Cool the kiwi mixture in the ice bath for a minute. Then mush the kiwi more. Cool, then

mush. Repeat several times. 5. Filter the mixture through cheesecloth. All groups can combine their mixtures at this

point, to filter together. 6. Dispense approximately 3 ml of kiwi solution to each test tube, one for each student. 7. Being careful not to shake the tubes, add approximately 2 ml of cold 95% ethanol to each

tube. The cooling protects the DNA from being destroyed. In the nuclear membrane it is protected from the DNases in the cell membrane. DNases are in our cells to protect us from viruses.

DNADNA from Cheek Cells from Cheek Cells

Materials: • Clear Gatorade OR 0.9% salt water (approx. ½ teaspoon in 8 oz. water)• Small cups (4-8 oz) • 30-50 ml test tube or other small container (such as a clear film canister) • 25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water) • Ice cold rubbing alcohol stored in freezer or on ice until use • Teaspoons for measuring

Procedure: 1. Swish 2 teaspoons (10ml) of the Gatorade or salt water from the small cup in your mouth

vigorously for 30 seconds. Your goal is to slough off as many cheek cells as possible. Your teacher will time you to make sure you have swished long enough.

2. Spit the water with cheek cells back into the small cup. 3. Pour this solution into a tube containing 1 teaspoon (5ml) of soap solution. 4. Gently mix this solution for 2-3 minutes. Try to avoid creating too many bubbles. 5. The soap solution breaks the cell membranes that are made up of fats, just like the soap

breaks down the grease on your dishes. 6. Tilt the tube of soap solution/cells. Pour 2-3 teaspoons (10-15ml) of ice cold alcohol

(ETOH) down the side of the tube so that it forms a layer on top of your soapy solution. DO NOT MIX THIS.

7. Let the tube stand for 1-2 minutes. 8. Record your findings.

9 Shaw High School

Genetics

Codon BingoCodon Bingo

How to play: 1. Fill in your bingo card with amino acids, but don't repeat any of them. 2. When a DNA codon is read off, transcribe it to RNA, then translate it into the amino acid.

Place a marker on the square that corresponds to that amino acid.

2009 – 2010 10

What is on Our Genes?

What is on Our Genes?What is on Our Genes?A gene is a piece of information passed from parents to offspring, and genes often are in different forms called alleles. For example, the gene for pea plant height has two alleles, tall and short.

True or False?

1. A dominant allele dominates a recessive allele. T / F 2. Alleles come in forms called genes. T / F 3. Homozygous means that two things are different. T / F 4. A Punnett square shows exactly how each offspring will look. T / F

About GenesAs we saw in the previous chapter, every gene on a chromosome in our DNA makes a

different protein. There are 20,500 of these genes in every human. 99.9% of these genes are the same from person to person, which means that the vast majority of these genes contain information for our lungs, heart, liver, kidneys, bones, brain and more. There are only a handful of genes that contain information for the color of our skin, hair, eyes, and the shapes of our faces, hands and feet.

Allele from mother Allele from father Gene that turns into a protein

Dominant Dominant Dominant

Dominant Recessive Dominant

Recessive Dominant Dominant

Recessive Recessive Recessive

Since we have two copies of (almost) every gene in our body, we call these copies alleles. We get one allele from our father and one from our mother. Since only one of those alleles can turn into a protein, it is the more dominant allele that gets turned into a protein by our cells. If both alleles are dominant, then it is clear that the dominant protein is made. If one allele is

dominant, then the other trait, the recessive trait, is ignored and the dominant protein is made. Only if both alleles are recessive then the recessive protein is made.In order to try and figure out what the

chances are of having a child with a dominant or recessive trait for a particular gene, something can be done called a Punnett square. A Punnett square is used to predict the probabilities and possibilities of traits in offspring. Along the top of the Punnett square, the alleles that could come from the father are listed, and the alleles from the mother are listed along the side. In the middle of the Punnett square, the possibilities for offspring are listed. Each square represents a 25% chance of getting that type of offspring. If an offspring has two of the same allele, it is called homozygous. If it has two different

11 Shaw High School

A Punnett square showing a cross between two pea plants

Genetics

alleles, it is called heterozygous.

True or False?

1. A dominant allele dominates a recessive allele. T / F 2. Alleles come in forms called genes. T / F 3. Homozygous means that two things are different. T / F 4. A Punnett square shows exactly how each offspring will look. T / F

QuestionsQuestions

Do you remember? 1. What does dominant mean? Recessive? 2. Define, in your own words:

a) Homozygous: b) Heterozygous:

3. In terms of homozygous, heterozygous, dominant and recessive, label: a) HH – b) Mm – c) bb –

Think about it! 4. Give names and percentages for the following Punnett square:

R r

R RR Rr

r Rr rr

Genotype Homozygous or heterozygous ANDDominant or recessive

%

RR Homozygous dominantRrrr 25%

5. As you did above, complete the Punnett square and percentages for the following: a) Between homozygous dominant for round peas and heterozygous b) Between homozygous dominant for unattached earlobes and homozygous recessive for

attached earlobes c) Between homozygous recessive for green eyes and heterozygous

Do something! 6. With a partner, agree on a gene for making a Punnett square. Also, agree on the dominant

and recessive alleles. Independently, come up with the genotype of both parents (one of you should be the mother, the other the father), then create a Punnett square for the combination of the two parents. If these two parents have six children, what would be the most likely numbers of dominant and recessive traits in the children?

Remember? 7. What can radiometric dating tell scientists? 8. Identify one word for each phase of mitosis that will help you remember what happens in

2009 – 2010 12

What is on Our Genes?

that phase. 9. What is the difference between a cell that is haploid and a cell that is diploid? 10.What are the four bases in DNA? What are they in RNA?


AlleleAlleless

1. With the genetic model kit, put together a cell that has three pairs of homologous chromosomes. Each chromosome has three shapes on it, in three different colors: red, white and blue. Each one of those shapes represents one allele. When you join a chromosome with its partner, then the matching alleles form genes. Therefore, it takes two alleles (that can be dominant or recessive) to get one gene.

2. How many alleles does this cell have? How many genes does it have? How many total chromosomes does it have?

3. Describe the relationship between genes, alleles and chromosomes, in your own words. 4. Design your own bacteria:

a) What is it called? b) What does it do? c) Choose one of the pairs of chromosomes. For each gene, make up a characteristic

that this gene represents – this is the dominant trait. For each gene, also specify the recessive trait.

Karyotype PuzzleKaryotype Puzzle

Errors can occur during meiosis as an organism creates gametes. Sometimes, extra chromosomes are copied and other times they are deleted. This means that the organism can have too many or too few chromosomes and usually will not make it to birth. Other times, the organism is born with physical or mental differences. In this activity, you will be given the chromosomes of an individual and it is up to you to discover what the genetic disorder is.

1. Get a packet of chromosomes and a karyotype reference sheet. Order the chromosomes by size, remembering that the Y chromosome (if present) is smaller than the X chromosome.

2. Once you have a complete karyotype that matches one of the karyotypes in the reference sheet, identify the karyotype and call the teacher over.

3. What effects do you think that this disorder has on the individual? Make a hypothesis based on what you know about genetics and chromosomes.

4. Use the reference materials available to research the disorder. What effects does this disorder have on the individual?

Making Making GeneGeness

1. Ask a friend or family member for a genetic trait that they are familiar with. Write this trait down as the dominant trait. Also, figure out what the opposite (recessive) trait would be and write it down.

2. Make a gene of DNA that is five codons long. Label each codon. This is the dominant trait.

3. Change one of the bases of DNA from the dominant trait. Label each codon. This is the recessive trait.

4. Combine someone who is homozygous recessive for this trait with someone who is heterozygous. Show the Punnett square.

5. Show the probabilities and percentages for each of the genotypes that result. Also, write down the mRNA that results for each offspring.

13 Shaw High School

Genetics

How do We Pass on Our Genes?How do We Pass on Our Genes?Use the concepts of Mendelian and non-Mendelian genetics to explain inheritance. For example, incomplete dominance, independent assortment, sex-linked traits and linkage.

True or False?

1. Mendel studied pea plant inheritance in order to come up with a theory about genes. T / F

2. Mendel found that he could breed short plants from two tall plants. T / F 3. The F2 generation is the offspring of the F1 generation. T / F 4. Mendel theorized that genes are inherited independent of other genes in offspring.

T / F 5. Linkage is when two genes are inherited together more often than Mendel thought.

T / F 6. Sex-linked traits are more commonly found in men than in women. T / F

About InheritanceOnce upon a time there was a monk named

Gregor Mendel. He was born in 1822 in (what is now) the Czech Republic, in Europe. He came from a farming family and was very interested in not only the family business, but also in beekeeping. When he joined a monastery in order to become a monk, he was sent to college to learn more science.

While he was at the University of Vienna, he was inspired to perform a few experiments on pea plants. He was particularly interested in how it was that some pea plants were different from one another.

Mendel had a lot of time on his hands – and peas. So he separated the pea plants that he had into several groups. Two of these groups were tall pea plants and short (dwarf) pea plants. The tall ones were actually taller than him, about 6 feet tall! The short ones were only about a foot tall, so it was easy to tell which was which. The interesting thing that he had noticed, though, was that there were no pea plants that were in between one and six feet tall. This is part of what told Mendel that there had to be something else going on inside the pea plant.

Remember, at this point in time, nobody knew anything about DNA, genes or chromosomes. So, Mendel took his two groups of pea plants, the tall plants and the short plants, and separated them completely. From his work in beekeeping, he knew that bees could carry the pollen from one plant to another, so he made sure there was no way the tall plants could breed with the short plants. After a few generations, there was nothing but tall plants in the one group and nothing but short plants in the second group.

After this, he started a third group. He bred the two groups together in this third group, making sure that every new plant was a combination of a tall and a short plant. What surprised him was that every single one of the resulting pea plants was tall! What was going on here?

Mendel needed to know more. So he called these new tall plants the F1 generation (after

2009 – 2010 14

Mendel in his garden

How do We Pass on Our Genes?

the Latin for the first children). He wanted more information: specifically, he wanted to know what would happen when these tall plants were bred. Would they have all tall offspring? Was the shortness of the one parent completely lost?

Mendel then combined the F1 generation (the tall plants) with each other. The results were incredible: 75% of the offspring were tall, and 25% of them were dwarfs! Somehow, these plants had “remembered” their short grandparents – but how? So Mendel made a hypothesis that traits are carried from generation to generation in genes. Each individual has one copy from each of their parents, and the trait can either be dominant or recessive. In this case, he thought that the trait for being tall (for a pea plant) was the dominant trait and being short was recessive. But here's the tricky part of what he figured out.

Mendel figured that each plant in the F1 generation got one tall trait from one parent and one short trait from the other parent. Since the tall trait (or allele) was dominant, then it hid the

15 Shaw High School

A diagram of Mendel's pea plant experiments

Genetics

recessive trait for being short. All the F1 plants were tall because of the dominant allele. But then when the F1 plants had offspring, called the F2 generation, these plants had gotten either a tall or a short allele from each of their parents. Even though he didn't use a Punnett square, he figured out that the cross between the two F1 plants went like this (T = tall, t = short):

T t

T TT Tt

t Tt tt

He repeated this experiment with many more traits and many more plants, coming up with roughly the same results each time.

Mendel looked at a total of seven traits. One of the other traits was whether the seed of the pea was smooth or wrinkled. He observed that when he did the same experiment with this trait, the results were the same. So he decided to take the experiment one step further. He then combined the two traits: he took tall plants that made smooth seeds, tall plants that made wrinkled seeds, short plants that made smooth seeds, and short plants that made wrinkled seeds. He combined them in every way that he could think, but he found that no matter what he did, when he combined purely smooth seeds with purely wrinkled seeds, the offspring were all smooth. It didn't matter if they were tall or short at all. After trying this with several more traits, he found a pattern. One trait didn't affect any of the others. This came to be called the Law of Independent Assortment. All of the genes seemed to mix themselves up completely independently.

Later scientists came to find that things weren't so simple. They actually saw that there were some traits that did depend on other traits. For instance, plants with yellow flowers were usually tall and plants with blue flowers were usually short. They explained this by saying that when genes are close together on a chromosome, they can sometimes show linkage. This means that some genes are “linked” together and are not independent.

There's another type of linkage, called sex-linked traits, that Mendel did not describe. These traits are not necessarily traits that have anything to do with sex organs or sex cells. Traits that are sex-linked are on the sex chromosomes. It's important to understand that male humans and female humans have one major difference in their chromosomes: the 23rd and final pair of chromosomes is “XX” in females and “XY” in

2009 – 2010 16Actual X and Y chromosomes side-by-side

A karyotype of a male human showing all of the chromosomes


males. The “Y” in males is actually just a small chromosome (see picture on this page) and contains much less information than the “X” chromosome. Because of this, there are alleles on the X chromosome that are not on the Y chromosome. For the alleles that are on the X chromosome but not the Y, they will always show up, dominant or recessive! Examples of sex-linked traits include hemophilia and color blindness. These traits, since they can be dominated in a female but not a male, often show up much more often in males than in females.

Well after Mendel passed, other scientists looked at his work and figured out that it fit in with their theories of inheritance. In fact, it wasn't until the 1930's that Mendel was recognized for his efforts and people began to accept that genes could be responsible for evolution! But Mendel's work still didn't explain quite a few things about genetics.

True or False?

1. Mendel studied pea plant inheritance in order to come up with a theory about genes. T / F

2. Mendel found that he could breed short plants from two tall plants. T / F 3. The F2 generation is the offspring of the F1 generation. T / F 4. Mendel theorized that genes are inherited independent of other genes in offspring.

T / F 5. Linkage is when two genes are inherited together more often than Mendel thought.

T / F 6. Sex-linked traits are more commonly found in men than in women. T / F

QuestionsQuestions

Do you remember? 1. Why did the F2 generation of pea plants include short plants? 2. Define a sex-linked trait in your own words. 3. List all of the possible crosses among plants in the F2 generation.

Think about it! 4. Paraphrase the main experiment that Mendel performed in one paragraph. 5. Compare and contrast the Law of Independent Assortment and linkage in at least two ways.

Do something! 6. Ask two thoughtful (not just factual) questions about Mendel's life to three other people.

Record your results and underline your most difficult question.

Remember? 7. Differentiate (tell the difference between) a cell and a virus in two ways. 8. Identify five organ systems and the problems that they solve. 9. What takes the instructions in DNA from the nucleus to the ribosomes? 10.What does dominant mean? Recessive?

17 Shaw High School

Genetics


Dragon Dragon GeneGeneticstics

In this activity you will study the patterns of inheritance of multiple genes in (imaginary) dragons. These dragons have two pairs of homologous chromosomes in each cell. You will see that, since genes are carried on chromosomes, the patterns of inheritance are determined by the behavior of chromosomes during meiosis and fertilization. For this activity, we will only consider one gene on each chromosome. These genes are described in the following table.

Dominant Alleles Recessive AllelesChromosome 1 W = has wings w = no wingsChromosome 2 H = big horns h = small horns

The mother dragon is heterozygous for the wing gene (Ww) and the horn gene (Hh). The father is homozygous recessive for the wing gene (ww) and the horn gene (hh).

1. What phenotypic traits will each parent have? Phenotypic traits are the observable bodily characteristics.

2. Draw the appropriate characteristics for each parent below in your book:Mother Father

3. On average, what percentage of the baby dragons will have big horns? _______

To predict the inheritance of the wing and horn genes, you first need to determine the genotypes of the eggs produced by the heterozygous (WwHh) mother dragon and the sperm produced by the homozygous (wwhh) father dragon. Use the figure below to answer the next questions:

2009 – 2010 18



4. Considering both the wing and horn genes, what different genotypes of eggs could the heterozygous mother dragon produce?

5. What genotypes or genotype of sperm can the homozygous (wwhh) father dragon produce?

The next step in predicting the inheritance of the wing and horn genes is to predict the outcome of fertilization between these eggs and sperm. In the following chart, label the gene on each chromosome in each type of zygote that could be produced by a mating between this mother and father. Then, fill in the genotypes of the baby dragons that result from each zygote and sketch in the characteristics of each baby dragon to show the phenotype for each genotype.

This type of mating involving two different genes is more typically shown as a Punnett square with four rows and four columns (see below). Notice that, because the father is homozygous for both genes, all his sperm have the same genotype, so all four rows are identical.

Mother (WwHh)wh wH Wh WH

Father (wwhh)

wh wwhh wwHh Wwhh WwHhwh wwhh wwHh Wwhh WwHhwh wwhh wwHh Wwhh WwHhwh wwhh wwHh Wwhh WwHh

6. Considering only the baby dragons with wings, what fraction do you expect to have big horns? (To answer this question, it may be helpful to begin by shading in the two columns of the above Punnett square that include all the baby dragons with wings.)

7. Considering only the baby dragons without wings, what fraction do you expect to have big horns?

8. Do you expect that baby dragons with wings and without wings will be equally likely to have big horns?

19 Shaw High School

Genetics


Procedure to Test Inheritance of Two Genes on Different ChromosomesTo test whether baby dragons with wings and baby dragons without wings will be equally likely to have big horns, you will carry out a simulation of the simultaneous inheritance of the genes for wings and horns. Since the father is homozygous (wwhh), you know that all of the father's sperm will be wh. Therefore, to determine the genetic makeup of each baby dragon produced in your simulation, you will only need to determine the genetic makeup of the egg which is fertilized to become the zygote that develops into the baby dragon. During meiosis, each egg randomly receives one from each pair of homologous chromosomes. Your simulation will mimic this process. For this simulation, each of the mother's pairs of homologous chromosomes will be represented by a popsicle stick with the genes of one chromosome shown on one side and the genes of the other homologous chromosome shown on the other side. Since the mother dragon is heterozygous for both genes (WwHh), you will have one Popsicle stick representing a pair of homologous chromosomes which are heterozygous for the wing gene (Ww) and another Popsicle stick representing a pair of homologous chromosomes which are heterozygous for the horn gene (Hh).

9. Hold one Popsicle stick in each hand about 6 inches above the desk. Hold each Popsicle stick horizontally with one side facing toward you and the other facing away (with one edge of the Popsicle stick on the bottom and the other edge on the top). The two Popsicle sticks should be lined up end-to-end, simulating the way pairs of homologous chromosomes line up in the center of the cell during the first meiotic division. Simultaneously drop both Popsicle sticks on the desk. The side of each Popsicle stick that is up represents the chromosome that is contained in the egg. This indicates which alleles are passed on to the baby dragon. Put a I in the appropriate box in the chart below to record the genotype of the resulting baby dragon.


Fatherwwhh

wh

Genotype of baby = wwhh

Number of babies with this genotype =____

Genotype of baby = wwHh


Genotype of baby = Wwhh


Genotype of baby = WwHh


10. Repeat step 1 three times to make and record three more baby dragons.

Summary and Interpretation of Data 11.Compile the data for the baby dragons produced by all students in the following chart.

2009 – 2010 20




Fatherwwhh

wh

Genotype of baby =________

Number of babies with this genotype =___

Phenotype:Wings __ or no wings __Horns big __ or small __










12.Do any of the baby dragons with wings have small horns? 13.Does either parent have the combination of wings and small horns? 14.Considering only the baby dragons with wings, what fraction has big horns? 15.Considering only the baby dragons without wings, what fraction has big horns? 16.Are baby dragons with wings and without wings about equally likely to have big horns? 17.Explain these results, based on what happens during meiosis and fertilization.

21 Shaw High School

Genetics

Why do We Look Different?Why do We Look Different?Changes in DNA are mutations which create variation between different organisms. When mutations happen in sex cells (sperm and eggs), they may be passed on to future generations; mutations that occur in body cells may affect the cell or the entire organism. Mutations influence natural selection and other ways that evolution works (e.g. genetic drift, immigration, emigration).

True or False?

1. A mutation is an increase in natural selection. T / F 2. Substitutions are mutations where one base takes the place of another. T / F 3. Insertions are mutations where bases are removed from DNA. T / F 4. Genetic drift happens when genes move from one chromosome to another. T / F

About Mutations and Natural SelectionDNA doesn't always stay the same. Often, there are changes that happen to the DNA inside

of a cell because of asbestos, cigarette smoking, ultraviolet radiation, or just random chance. These changes to DNA are called mutations. Some mutations in DNA are harmless and cause no problems for the organism or its offspring. Many mutations are harmful and can cause cancers in the organism or birth defects in offspring. Even other mutations cause the death of the cell because it can't survive any more.There are three main types of mutations: substitutions, insertions and deletions. Substitutions are mutations where one base is substituted for another, such as G for

A. These can often be harmless because the protein that the gene ends up producing can be exactly the same.

If a gene suffers from an insertion mutation, then the entire gene can be affected or even destroyed. An insertion is when one or more bases are inserted into the gene and it shifts all of the codons

down by one or more bases.Lastly, a deletion

mutation is when one or more bases are removed from the gene. This again can destroy

the entire gene because it can shift all of the codons up by one or more bases.

When any of these mutations happen in a body cell, they only affect the organism itself. However, when these mutations happen in a sex cell, they can affect the offspring. This is one of the key concepts behind natural selection – yes, back to evolution! See, if it weren't for mutations, there would be no new genes, and all life would look just like the first, simple one-celled bacteria.

Mutations are the source of new

2009 – 2010 22

Substitution

Insertion

Deletion

Different eye colors

Why do We Look Different?

genes: it's thought that all humans started off having brown eyes. A mutation in the gene for eye color caused some humans to have blue eyes. In the bright sun of Africa, it made no sense to have blue eyes, which are more sensitive to light. But when humans immigrated into Europe, which receives less direct sunlight, individuals with blue eyes were more fit and survived to reproduce more than the brown-eyed individuals. In fact, the emigration from Africa would have been impossible without mutations to the genes for skin color, hair type, digestion of different foods, and more!

However, the only way that these mutations were passed on from generation to generation is that the initial mutation happened in either a sperm or egg cell. If the gene for eye color had changed in a body cell, that only would have affected the individual – not its offspring!

Even though most mutations result in offspring that don't survive to reproduce, the “good” mutations more than make up for the “bad” ones. These mutations that take hold in a population cause the genes of the population to change. To continue our example, when Africans first immigrated to Europe, the percentage of individuals with blue eyes was around 0%, and these individuals were limited to the southernmost areas of the continent. However, as time went on and the mutation for blue eyes spread through the population, the percentage went up; in some areas in northern Europe, 100% of the population had blue eyes. This change over time in the percentage of a particular gene in a population is called genetic drift. As you can see, peoples' genes “drifted” from brown to blue eyes over time.

True or False?

1. A mutation is an increase in natural selection. T / F 2. Substitutions are mutations where one base takes the place of another. T / F 3. Insertions are mutations where bases are removed from DNA. T / F 4. Genetic drift happens when genes move from one chromosome to another. T / F

QuestionsQuestions

Do you remember? 1. How can you avoid mutations that can cause cancer? 2. Describe genetic drift in your own words. 3. Differentiate a substitution, insertion and deletion.

Think about it!

4. Summarize the relationship between mutations and natural selection. 5. Why is it that mutations in body cells do not affect offspring?

Do something! 6. Predict a mutation in humans that will spread through the population over the next fifty

years. What is the mutation? Where did it start? How is it advantageous?

Remember? 7. Differentiate prokaryotes and eukaryotes in three ways. 8. What is a gene? 9. Define, in your own words:

a) Homozygous: b) Heterozygous:

10.Define a sex-linked trait in your own words.

23 Shaw High School

Genetics


MutationMutationss and and Punnett SquarePunnett Squaress

1. Come up with a dominant human trait, give it a letter 2. Complete a Punnett's square for two homozygous dominant people 3. There's a nuclear accident and radioactive spiders bite 10 people. This causes a mutation

and one allele becomes recessive for these people. 4. What's the name of this recessive trait? 5. Complete a Punnett’s square between normal and mutant - what are the chances of a

mutant? 6. Do Punnett’s square between two mutants

a) What are the chances that they'll show the mutation? b) What are the chances that they'll carry the mutant allele?

PedigreePedigreess

1. This is a pedigree to the left. It shows males (squares), females (circles), and the individuals who have the trait that we’re studying are shaded in.

a) How many males? Females? b) How many have the trait? How many

do not? 2. To the right is a pedigree for a recessive

trait. This means that the individual who is shaded in shows the recessive trait.

a) Using the letters “A” and “a”, write the possible genotypes of each individual next to their shape. You will notice that for the male child, there is more than one possibility! Hint: Start with what you know for sure!

b) Show the Punnett’s square for the two parents, with percentages.

3. In this pedigree to the left, two generations have been skipped by the recessive trait. With a pen or pencil, trace the path of the recessive allele from the 1st generation to the fourth.

a) What does this line tell you about the genotypes of these individuals?

b) What can you conclude about recessive traits skipping generations?

2009 – 2010 24

Pedigree 2

Pedigree 3

Pedigree 1

Why do We Look Different?

Blood TypingBlood Typing

For this activity, you will be determining the possible blood types of individuals. What you need to know about blood types is that there are four major types, A, B, AB and O. Alleles A and B are co-dominant, meaning that they are equally dominant. The recessive allele is O. The chart below shows the possible genotypes and phenotypes for the ABO blood groups:

Genotype Phenotype

AAA

AO

BBB

BO

AB AB

OO O

1. Identify the genotypes of the individuals above: a) John b) Harry c) Howie d) Len

2. Complete a Punnett square between Bob and Melanie. What must their genotypes be in order to have Howie, who has blood type O? You may have to try different genotypes for Bob (who could be AA or AO) and Melanie (who could be BB or BO).

3. Use the same process that you used in #2 to figure out what Claire's genotype must be. 4. What are the genotypic and phenotypic possibilities for Ron? 5. What is the probability that Bob and Melanie have a child who has AB blood?

25 Shaw High School

Genetics

Can We Change our Genes?Can We Change our Genes?Analyze and investigate emerging scientific issues. For example, genetically modified food, stem cell research, genetic research and cloning.

True or False?

1. It's important to know about genetic issues because you will be tested on it. T / F 2. Cloning is the copying of organisms. T / F 3. Stem cells can be used to make new organs. T / F 4. Genetically modified food is always bad for you. T / F 5. Genetic research could result in people being discriminated against. T / F

About Genetic IssuesGenetics is a relatively new field of scientific study,

only having been around for about the last 60 years. With new technology, scientists are able to do more and more to help improve our lives, but they are often controversial. Cloning can result in new organs, stem cells can be used to do research on many diseases, the DNA of our food can be changed so that it grows better, and genetic research can tell us what diseases we or our offspring might develop.

It is important to stay informed of these issues because they will form many of the political and ethical issues of the future, if not the present! Many people take a side on these issues based on fear and misinformation; if you understand what these issues are actually about, you can make more informed decisions that could ultimately lead to a better life for you and your children.

Cloning is not all about making copies of oneself. Scary movies and sci-fi television series would have us believe that scientists would like to make armies of super-intelligent humans that could dominate the entire world. However, that's completely untrue! Cloning is mainly the use of DNA to make organs that can be used to treat diseases and to replace organs that have failed. If someone has a heart attack and needs a new heart, their own DNA could be used to create that new organ!

2009 – 2010 26

Dolly, the sheep, and her clone

Can We Change our Genes?

As we have previously seen, a zygote starts dividing and the cells differentiate. This power to divide into any other cell of the body is used by scientists in stem cell research. Stem cells can be taken from aborted embryos, but can also be taken from adult cells through often complicated and painful procedures through the bone marrow. Stem cells can be used to create organs, like cloning, that can replace failed or diseased organs in a patient. Stem cells can also be used to research human diseases, as they do not harm living humans, instead of performing those experiments on mice.

Genetically modified food (GM) is food that has been genetically changed so that it will be resistant to pests, will grow bigger, taller or otherwise be more healthy and more valuable when it is sold. In a way, GM has been happening for thousands of years, as farmers choose the most healthy crops to plant for the next year. GM food is a more technical, and less understood, way of making changes to crops so that farmers can get the most out of their land.

In general, genetic research that is done on humans allows us to see inside ourselves and truly figure out who and what we are. Many people argue that this information can be misused; for example, an insurance company may

deny health insurance to someone who has a certain genetic disease that they will only suffer from in 20 years. On the other hand, if we know what diseases we may get, we can start treatment for those diseases before it even becomes an issue.

True or False?

1. It's important to know about genetic issues because you will be tested on it. T / F 2. Cloning is the copying of organisms. T / F 3. Stem cells can be used to make new organs. T / F 4. Genetically modified food is always bad for you. T / F 5. Genetic research could result in people being discriminated against. T / F

QuestionsQuestions

Do you remember? 1. What is genetic research? 2. Are stem cells differentiated? How do you know? 3. Why could GM food be bad for you?

Think about it!

4. Choose one of the issues and make a one paragraph argument in support of it. 5. Choose one of the issues and make a one paragraph argument against it.

Do something! 6. Watch the Franken Foods! Video. Take the viewpoint of a company that wants to patent a

new tomato that doesn't ever go rotten. Write a two paragraph complaint to the people who made this video about how they should remove this video from their web site.

Remember?

27 Shaw High School

Scientists have raised concerns over the dangers of GM food: the mouse

on the right was fed GM food

Genetics

7. Identify one word for each phase of mitosis that will help you remember what happens in that phase.

8. In terms of homozygous, heterozygous, dominant and recessive, label: a) HH – b) Mm – c) bb –

9. Compare and contrast the Law of Independent Assortment and linkage in at least two ways. 10.Describe genetic drift in your own words.

The Controversy Over Genetically Engineered FoodThe Controversy Over Genetically Engineered FoodAdapted from an article by Rick Weiss

On a recent day in the English countryside, a handful of people dressed in white decontamination suits trudged to the center of a brilliant green plot of canola plants. Working methodically, knowing the police would soon arrive, the team members cordoned off part of the plot with plastic tape. They opened large bags bearing biohazard symbols and, to the cheering of friends and supporters around the field’s perimeter, began uprooting the lush plants. The plants were engineered by the Monsanto Company, a giant biotechnology firm based in St. Louis, Missouri, to contain a gene from a soil bacterium. That gene protects the plants from a popular weed killer made by Monsanto. Within minutes on that morning in July 1998, more than two dozen constables arrived at the scene. A police helicopter hovered overhead. The protesters were ordered to stop their destructive act. “We can’t,” one explained. “We have work to do.” “Arrest Monsanto!” another exclaimed. “They’re causing criminal damage to other farmers’ crops through genetic pollution!”

The arrests took just 20 minutes, but the group had made its point. Other activists would soon follow in their muddy steps, convinced that a new generation of genetically altered plants being studied on scattered test plots constitute a serious threat to human health and the environment.

Human efforts to modify food crops are not new. In the first 10,000 years or so that people planted and harvested crops, they steadily cultivated hardier varieties by saving and replanting seeds from their best plants. Selective breeding, in use by about 5000 BC, gave farmers another tool to improve their crops. Improvements came slowly but were eventually substantial. The scientific revolution ushered in by the Renaissance encouraged experimentation in selective breeding and quickened the pace of change. Many of the world’s global food staples have changed so much that they would not be recognizable to ancient tillers of the soil.

In the new world of agricultural biotechnology, scientists are no longer constrained by barriers between species. They can take genes from entirely unrelated organisms—viruses, bacteria, even fish and other animals—and splice them directly into plants. In doing so, they are redefining the very nature of the crops upon which humanity has long depended.

Supporters of genetically engineered food have put forward a bold vision for the new agricultural biotechnology. They see a world in which key food crops will be genetically altered to offer better nutrition, repel pests, and flourish in hostile environments—a world in which food is plentiful and hunger scarce. This vision, however, is not universally shared. Some farmers, consumers, environmentalists, and governments have expressed concern that genetically engineered crops pose substantial risks to human health, the environment, and rural economies.

The first genetically engineered field crop to be marketed for human consumption in the United States was the Flavr Savr tomato, which was endowed with genes that delayed ripening. The tomato was approved by the Food and Drug Administration (FDA) in 1994 after years of development by Calgene, a California biotechnology company. The tomato failed commercially, however, in part because of its high retail price. Later that year, Asgrow Seed Company’s virus-resistant squash became the second genetically engineered crop to gain approval in the United States.

2009 – 2010 28


Agricultural biotechnology received a major boost in late 1996, when researchers at Monsanto began marketing a new kind of soybean. The soybean was engineered to contain a bacterial gene that allows the soybean plants to withstand the toxins in Monsanto’s popular herbicide, Roundup. Until then, many farmers had relied on hand tilling to control weeds in soybean fields—a tedious, expensive, and time-consuming task. The new variety, known as Roundup Ready soybeans, enabled farmers to spray the weed killer as needed without worrying about killing their crop. The modified soybeans were an instant hit. By 2000 more than 14 million hectares (35 million acres) of Roundup Ready soybeans had been planted in the United States, accounting for more than 55 percent of the nation’s total soybean plantings.

Scientists have also added nutritional genes to crops to increase levels of healthy fats, oils, key vitamins, and other nutrients. In one development with vast medical potential, researchers developed a strain of rice with three extra genes that allow the rice to make beta carotene, which the body converts to vitamin A. Vitamin A deficiency affects 250 million children globally and is the world’s leading cause of blindness.

The agricultural biotechnology revolution is not limited to food crops. Researchers have used gene transfer techniques to make plants that can decontaminate environmental pollutants, such as poisons in the soil around old munitions sites. For example, tobacco plants were given bacteria genes that allowed them to break down TNT, an explosive, into nontoxic byproducts. Researchers have even engineered plants to produce human antibodies or polymer plastics in their cells—advances that could someday revolutionize medicine and industry.

One issue voiced by opponents concerned the possible human health risks of genetically modified food. A 1996 study published in the New England Journal of Medicine, for example, found that a soybean engineered to contain a gene from the Brazil nut to boost the bean’s nutritional value could trigger harmful reactions in people allergic to Brazil nuts. This finding raised the specter of consumers eating potentially life-threatening ingredients in their genetically altered food without knowing about it until it was too late.

Another concern among opponents was that crops engineered for herbicide resistance, such as the Roundup Ready soybean, might create “superweeds” by cross-pollinating with wild, weedy relatives growing nearby. Cross-pollination could give those weeds unprecedented resistance to the very weed killers that farmers were counting on to control pest plants. This type of gene transfer was evident in Canadian canola plants in 1999, when farmers in the province of Saskatchewan discovered that multiple applications of Roundup failed to kill wild canola plants growing along roadsides. Experts continue to disagree about the extent of the problem and the environmental impact. The discovery, however, has served as a potent reminder that herbicide-resistant genes can spread to pest plants.

Scientists Reprogram Human Skin Cells Into Stem CellsScientists Reprogram Human Skin Cells Into Stem CellsU.S. scientists say they've reprogrammed human skin cells into ones with the same blank-

slate properties as embryonic stem cells, a breakthrough that could aid in treating many diseases while sidestepping controversy.

Human embryonic stem cells have the ability to become every cell type found in the human body. Being able to create these cells en masse and without using human eggs or embryos could generate a potentially limitless source of immune-compatible cells for tissue engineering and transplantation medicine, said the scientists, from the University of California, Los Angeles.

The researchers genetically altered human skin cells using four regulator genes, according to findings published online in the Feb. 11 edition of the journal Proceedings of the National Academy of the Sciences.

The result produced cells called induced pluripotent stem cells, or iPS cells, that are almost identical to human embryonic stem cells in function and biological structure. The reprogrammed cells also expressed the same genes and could be coaxed into giving rise to the same cell types as human embryonic stem cells, the researchers said.

"Our reprogrammed human skin cells were virtually indistinguishable from human embryonic stem cells," lead author Kathrin Plath, an assistant professor of biological chemistry and

29 Shaw High School

Genetics

a researcher with the Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, said in a prepared statement. "Our findings are an important step towards manipulating differentiated human cells to generate an unlimited supply of patient specific pluripotent stem cells. We are very excited about the potential implications."

The UCLA findings confirm similar work first reported in late November by researcher Shinya Yamanaka at Kyoto University and James Thompson at the University of Wisconsin. Together, the studies demonstrate that human iPS cells can be easily created by different laboratories and are likely to mark a milestone in stem cell-based regenerative medicine, Plath said.

Reprogramming adult stem cells into embryonic stem cells has significant implications for disease treatment. A patient's skin cells, for example, could be reprogrammed into embryonic stem cells that could be prodded into becoming beta islet cells to treat diabetes, hematopoetic cells to create a new blood supply for a leukemia patient, or motor neuron cells to treat Parkinson's disease, the researchers said.

These new techniques to develop stem cells could potentially replace a controversial method to reprogram cells called somatic cell nuclear transfer (SCNT), sometimes referred to as therapeutic cloning. To date, therapeutic cloning has not been successful in humans.

"Reprogramming normal human cells into cells with identical properties to those in embryonic stem cells without SCNT may have important therapeutic ramifications and provide us with another valuable method to develop human stem cell lines," study first author William Lowry, an assistant professor of molecular, cell and developmental biology, said in a prepared statement. "It is important to remember that our research does not eliminate the need for embryo-based human embryonic stem cell research, but rather provides another avenue of worthwhile investigation."

However, top stem cell scientists worldwide stress further research comparing reprogrammed cells with stem cells derived from embryos -- considered the gold standard -- is necessary.

Human Cloning ControversyHuman Cloning ControversyYesterday's announcement of the successful creation of a human embryo using a cloning

technique in the United States has refuelled debate about the regulation of stem cell research.The technique, undertaken by Advanced Cell Technology (ACT) in Massachusetts, paves the

way to produce human embryonic stem cells that exactly match a particular patient, eliminating the risk of an immune response.

Advanced Cell Technology's research, which is published in the online journal E-biomed: the Journal of Regenerative Medicine, is privately funded. Publicly-funded research into human cloning has been outlawed in America.

But the Australian Academy of Science is supportive of such work, with certain restrictions."We do believe this sort of research should be done, but under strictly regulated conditions,"

said Professor John White, the Academy's spokesman on cloning matters."We believe that it is a debate that has to be had in public."The researchers at Advanced Cell Technology successfully replaced the DNA in a human egg

with that removed from the nucleus of an adult skin cell, a process called somatic cell nuclear transfer.

The egg began dividing as if it had been fertilised by a sperm, to become a ball of cells."The contentious matter is the use of a human egg and the transfer of human DNA into that

egg," said Professor White. "That is new."After several days, the ball of cells grows to a stage at which stem cells can be obtained."That's the stage where there are totally potent cells which can become any cell in the

body."Advanced Cell Technology has been at pains to point out that their research is for

'therapeutic cloning' — that is, for medical purposes — rather than 'reproductive cloning', which would aim to develop a new individual.

The distinction between the two is in the treatment of the embryo once somatic nuclear

2009 – 2010 30


transfer has occurred.Therapeutic cloning destroys the embryo in the process of deriving stem cells. With

reproductive cloning, the embryo would be implanted into a womb for gestation into a baby.Stem cells can be kept in culture and continually replenished."The whole purpose of doing this [research] would be to add to the cell lines that presently

exist," explained Professor White."At the moment stem cell lines already exist that are being continued in culture in many

countries."Stem cells are a type of cell that can be transformed into virtually any of the 200 kinds of

cell in the human body. This means that, in theory at least, they can be grown 'to order' to help people suffering from degenerative diseases.

In a treatment situation, the DNA from the patient would be injected into a woman's egg that had had its DNA extracted.

"The egg is grown to the stage where in the blastocyst you could harvest and then grow up in culture, some of those stem cells which would be useful for you personally," explained Professor White. "That is the hope."

Stems cells can also be harvested from adults."There are many places where stem cells must be present because bone and other tissues

regenerate," said Professor White."But whether those cells are totally potent — that is, they can become any other cell — is

not in my view proven."A House of Representatives report tabled earlier this year in Australia did not support the

creation of embryos for experimentation.Currently, embryos being used for stem cell research are from miscarriages or abortions, or

left over from in-vitro fertilization.But there was an escape clause in the report, said Professor White."It didn't rule out the cell nuclear transfer technique at all, but said it should be held over

for three years to see if something else came up in the meantime.""I think that things are moving so quickly there may be a case for looking at that three-year

moratorium, but that is a matter for discussion."

OGT ReviewOGT Review 1. Color blindness is a sex-linked trait that is carried on the X chromosome. If a boy is born

color-blind, what would have to be true?

a) His father had normal vision. b) His grandmother was color-blind. c) His mother carried at least one gene for color blindness. d) His grandfather passed on the color-blind trait to his father.

2. The pedigree below shows the inheritance pattern of a recessive allele (z) that results in a genetic disease.

31 Shaw High School

Genetics

Based on the inheritance pattern, what are all the possible genotypes for individual 6?

a) Zz b) ZZ and zz c) ZZ and Zz d) ZZ, Zz and zz

3. Significant progress has been made in the development of oxygen-carrying solutions that may replace whole blood. Describe two reasons why researchers are so interested in developing artificial blood to replace the use of whole blood.

Respond in the space provided in your Answer Document. (2 points)

4. A student takes a herbicide-resistant weed from plot 3 and a herbicide-resistant weed from plot 4. He determines that both plants have dominant mutations in the gene that is responsible for herbicide resistance (H). The genotype of each plant is indicated below.

In a cross between these two weeds, what percentage of the offspring would be resistant to the herbicide?

a) 0% b) 25% c) 50% d) 100%

5. Geneticists have determined that the majority of individuals in an isolated island population have blood type B. Type A blood is found to be more common in the mainland population from which the island was settled.

How could a geneticist best explain the dominance of blood type B in the island population?

a) Random mutations have occurred in the island population. b) Genetic drift has reduced the frequency of type A individuals. c) Natural selection has only occurred in the mainland population. d) Environmental conditions on the island are less favorable for type B individuals.

2009 – 2010 32

Documents

Genetics - Shaw High Studentsshawhighstudents.org/biology_files/pdfs/Genetics.pdfcentury, Watson and Crick revealed the chemical basis of heredity with their discovery of the double