Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
i
An-Najah National University
Faculty of Graduate Studies
Genetic Diversity within Ancient Olives (Olea europaea L.)
in Palestine
By
Mohammad Yousef Jaber
Supervisor
Dr. Hassan Abu Qaoud
Co- Supervisor
Dr. Rami Arafeh
This Thesis is Submitted in Partial Fulfillment of the Requirements for
the Degree of Master of Plant Production, Faculty of Graduate
Studies, An-Najah National University, Nablus, Palestine.
2013
iii
Dedication
This work is dedicated to my father, mother, wife, brother, sisters and
my friends; the completion of this work was not possible without their
support and help.
iv
Acknowledgments
I would like to express my deepest respect and most sincere
gratitude to my supervisor Dr. Hassan Abu Qaoud and Dr. Rami
Arafeh Co- Supervisor for his guidance and encouragement at all
stages of my work.
In addition I would like to thank my committee members, Dr.Aziz
Salameh and Dr.Heba El-fares.
Another word of special thanks goes for all members of the
Department of Plant Production at the Faculty of Agriculture at
An-Najah National University.
Last but not least my thanks and gratitude to my family, friends
and colleagues in my work for their help and support.
v
اإلقرار
:وقع أدناه مقدم الرسالة التي تحمل عنوان أنا الم
Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine
Declaration
The work provided in this thesis, unless otherwise referenced, is the
researcher’s own work, and has not been submitted elsewhere for any other
degree or qualification.
Student’s Name: إسم الطالب :
Signature: التوقيع :
Date: التاريخ :
vi
Table of Contents
Content Page
Dedication iii
Acknowledgment iv
Table of contents vi
List of figures vii
List of tables viii
List of abbreviations ix
Abstract x
Chapter One: Introduction 1
Introduction 1
Chapter Two: Literature review 7
The biology of olive 7
Studies on molecular markers in olive 8
Chapter Three: Materials and methods 15
Plant material 15
Isolation and quality measures of the total DNA 19
Microsatellite (SSR) analysis 19
Polymerase chain reaction (PCR) reagents and procedure 21
Visualization of PCR product 22
Microsatellite gel scoring, data collection and data analysis 23
Chapter Four: Results and discussion 25
Description of SSR data 25
SSR data analysis 27
Chapter Five: Conclusions and recommendations 34
References 36
Appendix 53
ب الملخص
vii
List of Figures
No. Figure Page
Figure (1)
A,B
Tow samples of ancient olive trees with
diameter more than 1.0 m. selected from ( A)
Assera elshamaliah and (B) bait leed.
16
Figure(2) Al-Badawi olive tree in the village Al-Walaja. 16
Figure(3) West Bank map and sample localities. 17
Figure(4)
(A) +(B) photos of gel electrophoresis for
microsatellite markers with( new England bio
laps DNA ladder Catalog #N3032S.
25
Figure(5) Two dimensional PCA plot of 101 individuals
and six SSR markers. Numbers represent the
proportion of variation represented on each axis.
28
Figure(6) Three dimensional PCA plot of 101 individuals
and six SSR markers. Numbers represent the
proportion of variation represented on each axis.
Numbers in the plot refer to groups; 1) core
ancient, 2) close to ancient, 3) Walaja and wild
individuals, 4) cultivated Nabali Mohassan, 5)
Souri cultivar.
28
Figure(7) A circle NJ tree of all individuals included
according to Saitou and Nei, 1987. Numbers
indicate bootstrap values after 500 replicates
29
Figure(8) PCA analysis of assigned populations based on
square root distance in FAMD software.
32
Figure (9) UPGMA dendogram Based on Nei’s (1978)
Genetic distance of ancient, cultivated and wild
olives
33
viii
List of Tables
No. Table Page
Table
(1)
Countries of olive production according to FAOSTAT
(2010).
2
Table
(2)
main genetic markers used in olive studies and their
use in this crop
11
Table
(3)
Localities, geographical coordinates and sample size
that were included in the study
18
Table
(4)
List of SSR tailed primers along with forward and
reverse sequences used in this study and the reference
of each pair
20
Table
(5)
The PCR program used for the amplification of SSR
primers
22
Table
(6)
Summary of Heterozygosity statistics for the six SSR
markers analyzed
27
ix
List of Abbreviations
Abbreviation Full Name
2D PCA plots Tow dimention plots
3D PCA plots Three dimention plots
AFLP Amplified fragment length polymorphism
cv. Cultivar
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dGTP deoxyguanosine triphosphate
DNA Deoxyribonucleic Acid
DNTPS Deoxynucleotide Triphosphates
dTTP deoxythymidine triphosphate
FAO Food and Agriculture Organization of the United Nations
GDP Gross domiestic product
Ha Hectare
ISSR Inter-simple sequence repeat
Ng Nanogram
NJ Neighbor Joining
PCA Principal component analysis
PCBS Palestinian central bureau of statistics
PCR Polymerase chain reaction
pMol Picomoles
(q/ha) Quantity per hectares (Ton/hectares)
RAPD Random amplification of polymorphic DNA
RFLP Restriction fragment length polymorphism
SE Standard error
SSR Simple Sequence Repeat
UPGMA
Unweighted pair group method with arithmetic mean
(capital letter)
UV Ultra violet
W Width
x
Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine
By
Mohammad Yousef Jaber
Supervised
Dr. Hassan Abu Qaoud
Co- Supervised
Dr. Rami Arafeh
Abstract
This study is conducted to explore the genetic variation using simple
sequence repeat (SSR) microsatellite marker within ancient olive “Roumi”
and some selected common cultivars across olive cultivation areas in
Palestine. Ninety two ancient olive samples in addition to four Nabali
Baladi, three Nabali Mohassan, one Souri, and one wild olive samples were
included in the study. The famous olive tree of Al-Walaja village that is
dated to 4500-5000 years was also included in the study (6 samples from
the tree drip line). In six SSR loci screened (23) polymorphic alleles were
observed. Cluster analyses by neighbour joining (NJ) and Principal
Coordinate Analysis (PCA) in 2D and 3D plots reflected high genetic
similarity within the group of ancient olive in addition to the “Nabali”. The
Nabali Mohassan and Souri were clustered in two separated groups. The
“Al-Walaja” and the wild samples clustered closely in one group. Both
individual and Population based analysis showed absence of geographical
pattern within the ancient populations in addition to a clear separation from
Nabali Mohassan and Souri from the remaining populations. The High
similarity between Roumi and Nabali Baladi, and also between the wild
and Al-Walaja tree was observed indicating common ancestral genetic
xi
pool. In conclusion, the Roumi ancient olives in Palestine have very narrow
genetic background suggesting that it was propagated from very similar
genetic material.
1
CHAPTER 1
Introduction:
Olive, Olea europaea L. is the most cultivated plant in the world (FAO,
2004). and its one of the oldest known cultivated plant for human
civilization in the region. Olive has shaped both the culture and the
landscape of the Mediterranean for thousands of years. (Green, 2002;
Bartolini et al., 2002).
In 2010 more than 9.4 million hectares were planted with olive trees,
which is more than twice the amount of devoted land of apples, bananas or
mangoes. Only coconut trees and oil palms command more space. (FAO,
2012). Cultivation area tripled from 2,600,000 to 7,950,000 hectares
(6,400,000 to 19,600,000 acres) between 1960 and 1998 and reached the
peak in 2008 with 10 million ha. The ten largest producing countries,
according to the Food and Agriculture Organization, are all located in the
Mediterranean region and produce 95% of the world's olives and olive oil
(Table 1).
2
Table 1. The Production, Area, and Yield of olive in the largest
Producing Countries in The World.
Rank Country\Region Production
(in tons)
Cultivated area
(in hectares)
Yield
(q/ha)
01 Spain 6,940,230 2,330,400 2.9781
02 Italy 3,182,200 1,144,420 2.7806
03 Greece 2,000,000 850,000 2.3529
04 Turkey 1,750,000 798,493 2.1916
05 Morocco 1,364,690 597,513 2.2839
06 Syria 1,095,040 684,490 1.5997
07 Tunisia 863,000 1,779,950 0.4848
08 Egypt 459,650 52,668 8.7273
09 Portugal 443,800 343,200 1.2931
10 Algeria 420,000 295,000 1.4237
11 Argentina 170,000 62,498 2.72
12 Peru 160,914 12,962 12.4142
13 Libya 139,091 216,013 0.6439
14 Jordan 131,847 62,088 2.1235
15 Palestine 115,551 109,213 1.058
16 Australia 91,067 30,407 2.9949
— World 19,845,300 9,634,576 2.0598
FAOSTAT (2011).
In palestine, olive is the most important economic crop value. Olive
occupied about 45% of cultivated area in Palestine and in a good years can
contribute as much as 15-19% of agriculture output (PCBS,2004). Given
3
that agriculture accounts for nearly 25 percent of GDP, Olive sector is an
important element of the Palestinian economy and estimates suggest that
about 100,000 families depend to some extent upon the olive harvest for
their livelihoods (The World Bank, 2012). In Palestine, about 90- 95% of
the harvested olive fruits are used to produce olive oil, and the average of
olive oil production ranged between 20,000-25,000 tons in the last decade
,According to PCBS(2012) the production of olive oil exceed 22,951
tons.
They are several olive cultivars in Palestine but the most common are
Nabali Baladi, Nabali Mohassan and Souri. Ancient olive trees are with
centennial or even millennial ages that have being dated back to the
crusade time are known with the cultivar name “Roumi”. The Roumi
cultivar can be found in many olive orchards among Palestinians areas as
well as other eastern Mediterranean countries like Syria, Lebanon and
Jordan.
Until recent times, the discrimination between the olive cultivars is
difficult because of the high similarities in morphological characters. There
are more than 1250 cultivars that have been described for Olea europaea L
using morphologic analyses (Bartolini, 2008), Differences within and
between olive cultivars was determined by assessing differences in olive
tree, namely leaf shape and colour, and other morphological characters
regarding fruit shape. These measures based on phenotypic characters
revealed to be problematic, especially in early stages of tree
4
development, but they are readily available and does not require
sophisticated equipment and is the most direct measure of phenotypes.
However, these morphological and phonological markers have the
disadvantage of the small number of polymorphism detected and of being
environmentally dependent (Mohan et al., 1997; Tanksley & Orton, 1983).
Besides that, some of the morphological characteristics are available for
short period (e.g., olive fruits) or when the olive tree achieves a mature
stage, which may delay the correct identification. Due to the high genetic
diversity observed in olive germplasm and the presence of homonyms and
synonyms cases, efficient and rapid discriminatory methods are described
to identify cultivars and to determine the relationships between them.
(Fabbri et al. 2009).
The olive tree (Olea europaea var. europaea) is thought to have been
domesticated from the wild oleaster species Olea europaea var. sylvestris
at a minimum of nine different times. The earliest probably dates to the
Neolithic migration into the Mediterranean basin, about 6000 years ago.
Propagating olive trees is a vegetative process; that is to say, successful
trees are not grown from seeds, but rather from cut roots or branches buried
in the soil and allowed to root, or grafted onto other trees. Regular pruning
helps the grower keep access to the olives in the lower branches, and olive
trees are known to survive for centuries, some reportedly for as much as
2,000 years or more. The first domesticated olives are likely from the
eastern end of the Mediterranean Sea, although some debate persists about
5
its origins and spread. Archaeological evidence suggests that the
domestication of olive trees spread into the western Mediterranean and
North Africa by the Early Bronze Age, 4500 years ago. (Hirst, 2013).
A lot of ancient olive trees are found in Palestine and they have similar
morphological characteristics implying that cultivar identity based on
morphology is inefficient. but the characterization and conservation of the
ancient olive germplasm is a priority task because these trees are
progressively cut and used for their ornamental value, and to the
progressive transformation of traditional olive groves into new commercial
orchards or other crops (Muñoz-Diez, 2008; Rallo and Muñoz-Díez, 2010).
Additionally, the outstanding performance of ancient olives may also be
helpful in understanding history of olive domestication.
With the help of moluclar markers, the classification and characterization
of this large number of ancient olives in Palestine is possible and also
efficient method to identifiying possible unknown morphotypes in this
group.
The general objective of this study is to provide an insight into the genetic
diversity of olives in Palestine with high focus on ancient olives by using
microsatellite marker.
The specific objectives are:
1- to explore the genetic variation and relationships within and among
different ancient olive growing areas in Palestine.
6
2- To use microsatellite marker (SSR) for highlighting the relationship
between ancient, wild and some common cultivated olive cultivars in
Palestine.
7
CHAPTER 2
Literature review:
1- The biology of olive
Olive belongs to the Oleaceae family that includes 30 genera and 600
species (Cronquist 1981), olive is a diploid species having 46 chromosomes
(2n = 46) (Reale et al., 2006). within the genus Olea, there are 30 species
exist throughout the Mediterranean basin (Reale et al., 2006; Taamalli et
al., 2006) in which Olea europaea is only cultivated species. Wild olive or
oleaster (Olea europaea subsp. europaea var. sylvestris) and the cultivated
olive (Olea europaea subsp. europaea var. europaea) are the two forms of
the subspecies europaea exist (Green 2002).
The cultivated olive is an evergreen, out-crossing, vegetatively propagated
tree with a very wide genetic patrimony that is the result of both plant
longevity and the scarcity of genotype turnover through centuries of
cultivation (Bracci et al., 2011).
In another side The large number of cultivars, added to the many cases of
synonymous and homonymous name, makes the description and
classification of olive varieties is extremely difficult (Fabbri et al.
2009),The size of cultivated olive germplasm based on about 1,250
varieties, cultivated in 54 countries, conserved in over 100 collections,
were included in the FAO olive germplasm database. (Bartolini, 2008), but
8
the fact is certainly much more because the lack of information on many
local cultivars (Cantini et al., 1999).
Due to this richness of the germplasm, olive is an unusual case among
horticultural crops and its biodiversity can represent a rich source of
variability for the genetic improvement of this plant (Baldoni and Belaj,
2009).
2- Studies on molecular markers in olive:
Exploring the variation between olive cultivars has long history. Several
methods were implemented in the early studies questioned the genetic
variation indirectly such as isozyme analysis by Trujillo et al., (1995),
they studied the isozyme variation in 155 olive cultivars by analysing
pollen samples there results showed discrimination between 85% of the
studied cultivars. The remainder were separated into groups of two or three
cultivars that could be identified using morphological characteristics. No
intracultivar polymorphisms were observed.
DNA-based markers revealing polymorphisms at the DNA level are very
useful tools in genetic studies and in the improvement of crop plants, and
present numerous advantages over conventional phenotype based methods,
they can be applied to a variety of purposes including DNA fingerprinting,
genetic screening and chromosomal mapping (Bracci et al., 2011).
9
Molecular markers according to Kahl (2004) are any specific DNA
segment whose base sequence is polymorphic in different organisms. Such
markers can be visualized by hybridization-based techniques such as
restriction fragment length polymorphism (RFLP) or by polymerase chain
reaction (PCR)-based methods.
Several molecular markers have been recently used to characterize and
discriminate the olive cultivars such as chloroplast DNA RFLP (Besnard et
al., 2011), chloroplast DNA SSR (Baali-Cherif and Besnard, 2005), AFLP
(Hagidimitriou et al., 2005; Owen et al., 2005; Grati-Kamoun et al., 2006;
Ercisli et al., 2009), RAPD (Belaj et al., 2004; Soleimani et al., 2006; La
Mantia et al., 2006; Sesli and Yegenoglu, 2009; Durgac et al., 2010),
mitochondrial DNA RFLP (Besnard and Berville, 2000), mitochondrial
DNA AFLP and RAPD (de Caraffa et al., 2002), ISSR markers
(Terzopoulos et al., 2005; Essadki et al., 2006), chloroplast DNA SSR
(Mariotti et al., 2010), ISSR and SSR (Gomes et al., 2009), SSR and RAPD
(La Mantia, 2006), SSR (Díaz et al., 2006; Ganino et al., 2007; Muzzalupo
et al., 2009; Baldoni et al., 2009; Alba, et al., 2009; Roubos et al., 2010;
Mariotti et al., 2010).
A Two inter-simple sequence repeat (ISSR) markers were effeciently used
for the differentiation among 31 Olea europaea L. cultivars grown in
Greece (Terzopoulos et al., 2005). A wide intra-varietal genetic variability
among 120 clones of the Portuguese olive ‘Cobrançosa’ cultivar was
observed using RAPD and ISSR techniques (Martins-Lopes et al., 2009).
10
Using AFLP analysis, significant genetic diversity was revealed among the
main Italian olive cultivars (Sensi et al., 2003). RAPD analysis of
Eighty-four olive accessions in Tunisia indicated coefficient of smiliraty
ranges between 0.98 and 0.40 estimated by simple matching algorithm
(Zitoun et al., 2008 ). Belaj et al. (2003) compared the usefulness of
RAPD, AFLP, and SSR markers for identification and genetic
differentiation of 32 Spanish and Italian olive cultivars. They concluded
that SSR markers, due to their co-dominant nature, high levels of
polymorphism and reproducibility, have a higher discriminating power for
cultivar identification, and are ideal for olive genome mapping and genetic
studies. A description of the main genetic markers used in olive studies and
their use in this crop is presented below and summarized in table 2.
The choice and selection of an adequate molecular marker systems depends
upon the type of study to be undertaken and whether it will fulfil at least a
few of the mentioned criteria like: (a) highly polymorphic between two
organisms, inherited co-dominantly, (b) evenly distributed throughout the
genome and easily visualized, (c) occurs frequently in the genomes, (d)
stable over generations, (e) simple, quick and inexpensive technique, (f)
small amounts of DNA samples required, and(g) no prior information about
the sample’s genome is required (Agarwal et al., 2008; Hatzopoulos et al.,
2002).
11
Table (2) - main genetic markers used in olive studies and their use in this crop. RFLP RAPD SSR AFLP ISSR
Developers Botstein et al.
(1980)
Williams et al.
(1990)
Morgante and
Olivieri (1993)
Vos et al. (1995) Zietkiewicz et al.
(1994)
Application in Olea
europea L.
-Phylogenetic studies.
(Baldoni et al. 2009)
-Male sterility analysis.
(Besnard et al. 2000)
-DNA fingerprinting of cultivars
(Fabbri et al. 1995),
-Genetic correspondence of plant
material from nursery(Belaj et al. 1999)
-Detection of intra-cultivar variability
(Belaj et al. 2004)
-Construction of linkage map
(De la Rosa et al. 2004)
-Cultivar traceability in olive oil
(Martins-Lopes et al. 2008)
-Phylogenetic studies (Hess et al. 2000),
-DNA fingerprinting
of cultivars.
(Baldoni et al. 2009)
-Construction of linkage map.
(De la Rosa et al. 2003)
-Paternity analysis.
( De la Rosa et al. 2004)
-DNA fingerprinting of
cultivars.
( Angiolillo et al. 1999)
-Detection of intra-cultivar
variability.
(Belaj et al. 2004)
-Phylogenetic studies.
(Baldoni et al. 2006)
-Cultivar traceability in olive
oil.
(Busconi et al. 2003)
-Construction of linkage map.
( De la Rosa et al. 2003)
-Phylogenetic studies.
(Hess et al. 2000),
-Detection of intra-
cultivar variability.
(Gemas et al. 2004)
-Cultivar traceability in
olive oil.
(Martins-Lopes et al.
2008)
Principle Southern blotting of
restricted fragments
PCR of random mprimers PCR of Microsatellite Detection of DNA
Restriction fragments by
PCR
PCR of inter simple
Sequence repeats
Level of polymorphism Medium Medium Very high Medium Medium
Codominance
of alleles
Codominant Dominant Codominant Dominant Dominant
Number of loci
analyzed per assay
1-2 3-15 1 04-150 3-12
DNA required per
assay
2-10 µg 10-20 ng 20-50 ng 20-500ng 10-20ng
12
Prior
sequence
information
Yes No Yes No No
Developmental cost High Low High Medium Low
Running costs per
assay
Medium Low Medium Medium Low
Repeatability Very high Fair Very high Very high Medium-high
Ease of use Labour intensive Easy Easy Difficult initially Low
13
Microsatellites (Simple Sequence Repeats -SSRs), consists of short, (1-6
base pairs long), with tandem repeated sequences mono-,di-,tri-,tetra-or
penta-nucleotide units occurring in the genomes of many higher organisms
(Rafalski &Tingey,1993; Wu & Tanksley, 1993), SSR is co-dominant and
hyperallelic. The number of repetitions of these nucleotide units generates a
polymorphism among genotypes, and they are widely used in plant genetic
research for diversity studies; namely in olive tree because of their high
polymorphism, reproducibility, and ideal for genetic map development,
linkage analysis, marker-assisted selection and fingerprinting studies
(Bracci et al., 2009; Cipriani et al., 2002; De la Rosa el al., 2004; Gomes et
al., 2009; Karp et al., 1996; Muzzalupo et al., 2009; Rallo et al., 2002; Sefc
et al., 2000).
When compared with RAPD or AFLP markers, the SSR have the
advantage of their co-dominant nature, as two alleles may be identified at
each locus. The main constrain of SSR markers is the development requires
previous DNA sequencing for primer designing. Many authors have
reported on SSR development in olive and several of them are currently
available for DNA analysis (Sefc et al. 2000; Cipriani et al. 2002; De la
Rosa et al. 2002; Sabino Gil et al. 2006; Sefc et al., 2000; Bandelj et al.,
2004).
These markers have been used for different applications such as cultivar
discrimination (Sarri et al. 2006; Fendri et al., 2010), study of relationships
between wild and cultivated olive tree (Belaj et al., 2007), construction of
14
association maps (De la Rosa et al., 2003), paternity analysis (Mookerjee et
al., 2005) and identification of olive oil varietal composition (Alba et al.
2009;Ayed et al. 2009). Doveri et al. (2008) and Baldoni et al. (2009) have
listed SSR markers and protocols for olive genotyping aimed at developing
a robust method for accurate and precise olive genotyping.
15
CHAPTER 3
Materials and methods
1- Plant material:
Ninety six olive trees were selected from different geographical regions of
the West Bank area from north to south. Geographical coordinated and
sample size of each locality is presented in Table (3).
Since this study is focusing more on the genetic construction of ancient
olives, the size age relationship appears to be the most suitable methods to
identify the age of trees and only trees with diameter more than 1.0 m
(circumference about 3.0 m) were selected (figure 1) for taking leaf
samples (Rozas, 2003; 2004).
The diameter of 96 ancient olives was measured at 1.0 m height from the
ground surface. Trees with seriously damaged trunks were excluded from
this analysis. The diameter of the ancient olives ranged between 1m to 6 m.
long.
16
Figure 1. A photograph of tow ancient olive trees with diameter more than 1.0 m
sampled from (left) Assera Al-Shamaliah and (right) Bait Leed.
An olive tree in the village of “Al-Walaja” between Jerusalem and
Bethlehem, called “Al-Badawi” tree, figure (2) was given a special
attention in this study. It is a mass of trunks with a total diameter around
6.0 meters. The tree was aged between 4000-5000 years old. (ARIJ, 2010).
Six DNA samples from this tree were included in the study collected from
the circumference of the tree’s drip line.
Figure (2). Al-Badawi olive tree in Al-Walaja village. The tree is about 6.0 meters
diameter with many trunks. From (ARIJ,. 2010).
17
In total, 101 sample of fresh leaf material were collected then dried with
silica gel beads to use for DNA extraction. Within the samples, eight olive
trees were also included from cultivated Nabali Baladi(4 trees), Nabali
muhassan(3 trees) and souri(1 tree). A map for all localities sampled is
shown in figure (3).
Figure (3) localities were the leaves samples of ancient olive trees where collected.
18
Table (3). Localities, geographical coordinates and sample size that
were included in the study.
# of
samples
# of
Trees
E N District Location No.
6 6 35 23 33 43 32 20 32 82 Tubas Tayaser-
Tobas 1
6 6 35 15 06 60 32 27 55 85 Jenin Berqeen 2
3 3 35 24 09 30 32 29 36 49 Jenin Faqouaa 3
6 6 35 10 35 64 32 30 21 03 jenin Anin 4
6 6 35 01 34 29 32 07 50 41 Qalqilia Bait Amin 5
6 6 35 08 28 87 32 12 53 85 Qalqilia Kufrqadom 1 6
6 6 35 21 51 86 32 08 40 90 Nablus Aqraba Yanon 7
6 6 35 15 55 12 32 15 06 81 Nablus Assera
elshamaliah 8
6 6 35 10 17 03 32 04 43 84 Salfeet Salfeet 9
6 6 35 04 09 83 32 06 35 86 Salfeet Bedya 10
6 6 35 08 40 84 32 14 55 36 Tulkarem Bait leed 11
6 6 35 14 11 11 31 46 42 31 Jerusalem Jerusalem 12
6 1 35 09 04 66 31 44 03 43 Baitlahem Walajah 13
12 12 35 05 47 86 31 31 40 52 Hebron Hebron 14
5 5 35 02 47 67 31 32 12 51 Hebron Tafouh 15
8 8 (0) Nabali Baladi ,(3)
Nabali Mohassan, (1) Souri
Qalqilia Kufrqadom 16
1 1 wild olive trees Nablus Al-Junaidi
nursery 17
101 96 Total
19
2- Isolation and quality measures of the total DNA:
Leaves samples were grinded into a powder using mortar and pestle with
sterile sea sand. DNA extraction and purification was carried out with
Qiagen, DNeasy total genomic extraction kit following manufacturer’s
instructions.
DNA quality and concentration were measured with DNA
spectrophotometer (Eppendorf A.G., Hamburg, Germany). Another test for
DNA quality and concentration was conducted with agarose gel
electrophoresis. Samples with poor quality DNA were excluded and the
extraction was repeated. Concentration and quality of the used DNA are
listed in table 1. in the appendix. For each SSR reaction, DNA
concentration was adjusted at around 50.0 ng/µl.
3- Microsatellite (SSR) analysis
A set of six microsatellite (SSR) primer pairs were used to explore the
polymorphism in 101 ancient and some cultivated olive samples (Table 0).
20
Table (4). List of (SSR) primers along with forward and reverse
sequences used in this study and the reference of each pair.
No Marker Forward and reverse primer pair Reference
1 U99-35 5’ AATTTAATGGTCACACACAC 3’
3’ ATTGCGAAATAGATCTACGA 5’
(Cipriani et al., 2002)
2 U99-28 5’ CTGCAGCTTCTGCCCATAC 3’
3’ GCAGCTCATCATTTGGCACT 5’
Capriani et al (2002)
3 GAPu-
103
5’ TGAATTTAACTTTAAACCCACACA 3’
3’ GCATCGCTCGATTTTATCC 5’
(Cipriani et al., 2002)
4 DCA9 5’ AATCAAAGTCTTCCTTCTCATTTCG 3’
3’ GATCCTTCCAAAAGTATAACCTCTC 5’
Sefc et al., 2000;
Bandelj et al., (2004)
5 DCA16 5’TTAGGTGGGATTCTGTAGATGGTTG 3’
3’ TTTTAGGTGAGTTCATAGAATTAGC 5’
Sefc et al., 2000;
Bandelj et al.,( 2004)
6 DCA3 5’ CCCAAGCGGAGGTGTATATTGTTAC 3’
3’ TGCTTTTGTCGTGTTTGAGATGTTG 5’
Sefc et al., 2000;
Bandelj et al., (2004)
21
4- Polymerase chain reaction (PCR) reagents and procedure:
Amplifications were performed in polymerase chain reactions (PCRs) tubes
with total volume of 25.0 μl containing 1.0 μl of genomic DNA template
(30-60 ng), 22.0 μl of master mix containing (H2O; 15.0 μl, 10X buffer; 2.5
μl; MgCl2 (25 mM) 2.5 μl; dNTPS (5mM)1.0 μl; and 1.0 μl of Taq
polymerase enzyme produces in Biotechnology Research Center BRC at
Palestine Polytechnic University. PCR-PPU master mix contained 1.25 unit
of Thermoprime Plus DNA Polymerase, 75 mM Tris-HCl, 20 mM
(NH4)2SO4, 3.0 mM MgCl2, 0.01% (V/V) Tween® 20 and 0.2 mM each of
dATP, dCTP, dGTP and dTTP respectively. PCR PPU- Master mix also
contains dye to facilitate the electrophoresis. Forward and reverse primers
were added at 1.0 μl of each (15 pmol/μl). The PCR reactions were setup in
0.2 ml PCR tubes. The PCR was carried out in the thermal cycler from
Applied Biosystems.
Thermocycler details used for SSR amplifications are listed in table (5).
22
Table (5). The PCR program used for the amplification of SSR
primers.
PCR profile for SSR analysis Process
Step -1 94oC for 5 minutes Initial Denaturation
Step -2 94oC for 1 minute Denaturation
Step -3 55oC for 1 minute Annealing
Step -4 72oC for 2 minutes Extension
Step -5 35 times repeated 35 Cycles
Step -6 72oC for 7 minutes Final extension
Step -7 4oC for ever End
5- Visualization of PCR product:
The PCR product (25.0 μl) of each sample was loaded in 2.0% w/v agarose
gel dissolved in 1X TBE buffer. Ten microliters of ethedium bromide at a
concentration of 10.0 μg/μl was mixed with the gel solution after being
dissolved. The samples were loaded into gel pockets for electrophoresis at
(100-110) volt for about 1.5 hours. A hundred basepair ladder was added in
every gel to facilitate the scoring procedure. After electrophoresis, the gels
were photographed with a digital camera provided with UV filter.
23
6- Microsatellite gel scoring, data collection and data analysis:
Microsatellite amplicons were scored as a co-dominant marker on the
number of alleles (11, 22,… NN for homozygous and 12 for
heterozygous..etc) and according to the amplicon’s size in base pairs as
viewed on agarose gel. Furthermore, allelic data was transformed into a
binary (0/1) matrix to carry out other dominant marker based analysis
including Neighbour Joining (NJ) clustering and population PCA analysis.
Principal Component Analysis (PCA) was carried out to explore the
individual genetic grouping in 2D and 3D PCA plots. Genetix v 4.05
software (Belkhir et al. 2004) was used to generate 2D and 3D plots for
individuals. A population based PCA analysis was also carried out with
FAMD software (Schlueter and Harris, 2006) according to the Square root
distance method between populations. The PCA analyzes a data table
representing observations described by several dependent variables, which
are, in general, inter-correlated. Its goal is to extract the important
information from the data table and to express this information as a set of
new orthogonal variables called principal components (Abdi and Williams
2010).
The SSR data were analyzed using several genetic parameters such as
number of alleles per locus; observed heterozygosity (Ho, calculated as the
number of heterozygotes per locus divided by the number of individual
typed). Expected heterozygosity (He) or gene diversity (Nei 1987).
24
Neighbor Joining (NJ) phenogram (Saitou and Nei, 1987) was generated
using the software MEGA v.5.1 in order to examine the clustering of
individuals. Bootstrap statistical support was calculated from 500
replicates. Heterozygosity measures were carried out with Popgene v.1.32
software (He and Genetic diversity). Samples from each location were
treated as one populations and a population dendogram was generated in
TFPGA software according to Nei and Li (1979) population distance.
In other approach, the banding pattern was read as dominant marker in a
(0) absent to (1) present to generate the similarity matric according to
standard Jaccard Coefficient with FAMD.
Jaccard’s similarity coefficient for a pair of individuals i and j is defined as
Sij= p / p+q+r
where:
S: similarity.
p: is the number of variables that are positive for both ith and jth.
q: is the number of variables that are positive for the i and negative for the jth object.
r: is the number of variables that is negative for the ith and positive for the jth.
So the Jaccard’s distance (d=1-Sij).
25
CHAPTER 4
Results and discussion:
1- Description of SSR data:
The six SSR primers used in this study produced in total 23 polymorphic
SSR loci. The sizes of amplicons ranged from 120 base pair in the primer
pair SSR-DC16 and the largest amplicon was 620 base pair in the primer
SSR-DCA3.
Figure (4) A: GAPu-103 microsatellite markers with( new England bio laps DNA
ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the
study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali
Muhassan,RA8= souri).
26
Figure (4) B: SSR-UA99-28 microsatellite markers with( new England bio laps DNA
ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the
study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali
Muhassan,RA8= souri, BD= bidya,WA= walajah).
Heterozygosity statistics are presented in table (6). The average observed
heterozygosity equals to 0.63± 0.49 St. Dev.
27
Table (6). Summary of Heterozygosity statistics for the six SSR
markers analyzed.
2- SSR data analysis
The PCA analyses of the 101 individuals with the 6 SSR markers are
presented in 2D and 3D plots (figure 5, 6). In the 3D plot, the first three
principal coordinates accounted for 27.44%, 16.68% and 14.30% of the
total variation respectively. Most (81 accession) of the ancient olives in
addition to the Nabali Baladi were found in one close group (number 1). It
is noted that ancient accessions group show no geographical structure. The
genetic distance among the ancient individuals ranges from 0.0 – 0.1. Few
individuals positioned close to the large ancient group (2) include samples
JE3, JE4, HE6, HE11, TU5. Another group (3) consisted of the wild
individual and the Al-Walaja samples (6 samples) in addition to KQ3,
KQ4, KQ5, and BD6. Accessions, RA5, RA6 and RA7 (group 4) which
represent the Nabali Mohassan variety are grouped together. Interestingly,
the cultivar Souri (group 5) is located distantly from all the groups
described.
28
Figure 5. Two dimensional PCA plot of 101 individuals and six SSR markers. Numbers
represent the proportion of variation represented on each axis. Numbers in the plot refer
to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals, 4)
cultivated Nabali Mohassan, 5) Souri cultivar.
Figure 6. Three dimensional PCA plot of 101 individuals and six SSR markers.
Numbers represent the proportion of variation represented on each axis. Numbers in the
plot refer to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals,
4) cultivated Nabali Mohassan, 5) Souri cultivar.
29
The two dimensional (2D) PCA plot confirms the same finding revealed by
the 3D PCA plot. The main principle coordinates in the 2D plot accounted
for 27.44% and 16.7% from the total variation respectively (figure 5).
Neighbor joining (NJ) analysis of the 101 accessions is shown in figure (7).
The pattern shows a clear large cluster of individuals of ancient and Nabali
Baladi accessions, the other clear clusters of individuals of Nabali
Mohassan ,
souri , walaja and wild , some of closed individuals to Nabali Baladi and
ancient group was clustered also.
Figure 7. A NJ phenogram of all included individuals according to Saitou and Nei,
(1987). Numbers above the branches indicate bootstrap values after 500 replicates.
30
There is a huge mass of literature addressed the genetic diversity in olives
and because of the wide distribution of this crop and the huge number of
cultivars studied, part of the studies focused on exploring the genetic
relationships in accessions within a restricted area. Perhaps the study that is
very similar to this one was conducted by (Wiesman et al.,1998) focused
on molecular characterization of the traditional and introduced olive
cultivars in Israel and three locations in the West Bank area planted with
Nabali cultivar. They also included accessions from Souri cultivar in the
study. A high similarity among Souri accessions was , and to lesser extent
among Nabali. On the other hand, the Jaccard’s similarity coefficient was
calculated between Nabali and Souri ranged from 0.635 to 0.738. These
results are in agreement with the findings in this study despite using
different marker system. A clear discrimination between Souri and Nabali
Mohassan acessions was observed in the 2D, 3D and NJ analysis. Genetic
distance between Souri and Nabali Mohassan accessions ranged from 0.538
to 0.824 (table 2, Appendix).
Olive trees have been grown either for oil or table olive production in the
Mediterranean basin since ancient time. There is enormous number of olive
cultivars distributed in its cultivation range. The genetic diversity of them
is also abundant and characterized by a huge number of locally cultivated
and propagated germplasm by farmers. In a large scale study conducted by
(Bartolini et al., 1993), more than 1,208 cultivars from 52 countries,
conserved in 94 collections were addressed. However, the number of
31
cultivars is probably much higher bearing in mind the lack of information
on minor cultivars in different olive growing regions.
Cultivar surveys have been initiated in many olive growing countries in
order to describe existing cultivars, thus obtaining information for
germplasm preservation, description of cultivars of specific growing
regions and for breeding purposes. For the description and management of
the existing genetic diversity in olives, molecular markers have been found
to be particularly valuable because of such characteristics as high genetic
informativeness, environmental independence, relatively easy use and the
possibility of accumulating large amount of data.
Olive cultivars were further genotyped for identification purposes or for
assessment of genetic diversity on international (world germplasm
collections), national (Spain, Italy, Tunis, Morocco, Turkey, Greece,
Croatia, Slovenia, Portugal, Lebanon, Alger) and regional scales (olive
growing region with characteristic variety structure). There have been
numerous publications from these studies and we present here only a few
examples. Sarri et al. (2006) genotyped 118 olive cultivars from several
Mediterranean countries by use of twelve SSR markers showing high
discrimination power among the included samples.
The present study provided insight into the genetic variation in the ancient
“Roumi”olive that is cultivated in Palestine with centennial or even
millennial age. Microsatellites analysis indicated high genetic similarity
32
within ancient olives regardless of their geographic location from where
they collected (Jaccard coofeccient 0.0 – 0.1). As revealed by the
population based PCA, population from distant locations like Hebron in the
South and Faquo’a in the North, Tubas in the East and Salfeet in the West
grouped close to each other, figure (8).
Figure 8. PCA analysis of assigned populations based on square root distance in FAMD
software.
The same result can be visualized in the UPGMA dendogram regarding
these populations in figure 9. The tree has three clusters of ancient olives in
addition to another cluster of wild and Al-Walaja tree and the last cluster
with the Souri and Nabali Mohassan. Interestingly, the common cultivated
varieties the Nabali Mohassan and Souri fell in the same cluster apart from
the ancient and wild material. Wild olive and Al-walaja olive share similar
subcluster.
33
Figure 9. UPGMA dendogram based on Nei's (1978) genetic distance of ancient,
cultivated and wild olives treated as populations.
This study also provides vital information about similarity between the
wild olive Olea oleaster and Al-Walaja tree (0.200 -0.455 Jaccard
distance). Being clustered close to each other and distant from common
cultivated and ancient cultivars indicates common ancestry and relatedness
to the same genetic pool.
34
CHAPTER 5
Conclusions:
Molecular characterization of native germplasm followed by clear cultivar
identification in olives is important to confirm true-to-type denominated
cultivars and solve problems relating to synonyms, homonyms and
mislabelled planting material. This is, to the best of my knowledge, the first
study that addressed, in a comprehensive sampling approach, ancient olives
across their geographical distribution in Palestine as a part of the eastern
Mediterranean region.
One of the main concluding remarks in this study is the high genetic
similarity within the “Roumi” or ancient olives that are grown in Palestine
since centuries and the newly cultivated Nabali Baladi cultivar. Being one
close group implies formulating easier conservation strategy as well as
easier treatment for future breeding programs.
The high similarity between wild olive and Al-Walaja tree is noteworthy. It
was always believed that the ancient tree of Al-Walaja belongs to the
ancient Roumi cultivar. This study showed clearly the close relationship
between the wild and Al-Walaja tree. A closer look into the botanical and
horticultural characteristics of this tree in needed.
Relationships could also be established regarding common cultivated
varieties, Nabali, Nabali Mohassan and Souri.
35
Finally, SSR marker is a useful molecular tool for screening genetic
polymorphism and highlighting relationships within the olive material in
Palestine. Adopting variable SSRs that can be visualized and scored easily
would help to identify other cultivars which are propagated in Palestine.
36
References
Abdi H, Williams LJ. Jackknife. In: Salkind NJ, ed. Encyclopedia of
Research Design. Thousand Oaks: Sage Publications; 2010.
Agarwal, M.; Shrivastava, N. & Padh H. (2008). Advances in
molecular marker techniques and their applications in plant sciences.
Plant Cell Reports, Vol.27, pp. 617–631.
Alba, V., Montemurro, C., Sabetta, W., Pasqualone, A. & Blanco, A.
(2009a). SSR-based identification key of cultivars of Olea europaea L.
diffused in Southern-Italy. Scientia Horticulturae, No. 123, pp. 11–16.
ARIJ. 2010. Al Walaja Village Profile. Palestinian Localities Study.
Bethlehem governorate. http://proxy.arij.org/vprofile
Angiolillo A, Mencuccini M, Baldoni L. Olive genetic diversity
assessed using amplified fragment length polymorphisms. Theoretical
and Applied Genetics. 1999;98:411–421.
Ayed, R.B.; Grati-Kamoun, N.; Moreau, F. & Rebaï, A. (2009).
Comparative study of microsatellite proWles of DNA from oil and
leaves of two Tunisian olive cultivars, Eur Food Res Technol. Vol. 229,
pp. 757–762.
Baali-Cherif, D. and G. Besnard. 2005. High genetic diversity and
clonal growth in relict populations of Olea europaea sub sp. laperrinei
(Oleaceae) from Hoggae, Algeria. Annals of Botany, 96: 823-830.
37
Baldoni, L. & Belaj, A. (2009). Olive, In: Vollmann J, Rajean I (eds) Oil
crops. Handbook of plant breeding, vol 4. Springer Science Business
Media, New York, pp. 397–421. doi 10.1007/978-0-387-77594-4_13
Baldoni, L.; Nicolò, G.C.; Mariotti, R.; Ricciolini, C.; Arcioni, S.;
Vendramin, G.V.; Buonamici, A.; Porceddu, A.; Sarri, V.; Ojeda, M.A.;
Trujillo, I.; Rallo, L.; Belaj, A.; Perri, E.; Salimonti, A.; Muzzalupo, I.;
Casagrande, A.; Lain, O.; Messina, R. & Testolin, R. (2009). A consensus
list of microsatellite markers for olive genotyping. Molecular Breeding,
Vol.24, pp. 213–231.
Bandelj, D., Jakse, J., Javornik, B. 2004. Assessment of genetic
variability of olive varieties by microsatellite and AFLP markers.
Euphytica, 136: 93–102. Olive germplasm (Olea europaea L.) 2008.
Available at: http://www.oleadb.it/olivodb.html.
Bartolini, G. and Petruccelli, R. (2002) Classification, Origin,
Diffusion and History of the Olive. Food and Agriculture Organization of
the United Nations, Rome.
Bartolini, G., Messeri, C. and Prevost, G. 1993. Acta Horticulturae, 356:
116-118.
Belaj, A., Satovic, Z., Cipriani, G., Baldoni, L., Testolin, R. and Rallo,
L. 2003. Comparative study of the discriminating capacity of RAPD,
AFLP and SSR markers and of their effectiveness in establishing
38
genetic relationships in olive. Theoretical and Applied Genetics, 107:
736–744.
Belaj A, Muñoz-Díez C, Baldoni L, Porceddu A, Barranco D, SatovicZ.
Genetic diversity and population structure of wild olives from the
north-western Mediterranean assessed by SSR markers. Annals of
Botany 2007;100:449-458.
Belaj A, Rallo L, Trujillo I, Baldoni L. Using RAPD and AFLP
markers to distinguish individuals obtained by clonal selection of
‘Arbequina’ and ‘Manzanilla de Sevilla’ olive. Hortscience.
2004;39:1566–1570.
Belaj A, Trujillo I, De la Rosa R. and Rallo L.1999. Marcadores de
ADN para identificacion de variedades de olivo. Agricultura 799:166–
167.
Belkhir, K.; V. Castric and F. Bonhomme. 2002. IDENTIX, a software
to test for relatedness in a population using permutation methods.
Molecular Ecology Notes 2(4): 611-614
Bronzini de Caraffa, V., Maury, J., Gambotti, C., Breton, C., Berville´,
A.,Giannettini, J., 2002. Mitochondrial DNA variation and RAPD mark
oleasters, olive and feral olive from Western and Eastern
Mediterranean.Theor. Appl. Genet. 104, 1209–1216.
39
Besnard, G.; Khadari, B.; Villemur, P. & Bervillé, A. .2000. A
cytoplasmic male sterility in olive cultivars (Olea europaea L.):
phenotypic, genetic and molecular approaches.Theoretical and Applied
Genetics, Vol.100, pp.1018–1024.
Besnard, G., & Berville, A. (2000). Multiple origins for
Mediterranean olive (Olea europaea L. ssp europaea) based upon
mitochondrial DNA polymorphisms. CR Acad Sci Paris Sci de la Vie,
323, 173-181.
Besnard G, Hernandez P, Khadari B, Dorado G, Savolainen V (2011)
Genomic profiling of plastid DNA variation in the Mediterranean olive
tree. BMC Plant Biol. 2011 May 10;11:80. doi: 10.1186/1471-2229-11-80.
Botstein, D., R.L. White, M. Skolnick, and R.W. Davis. 1980.
Construction of genetic linkage map in man using restriction fragment
length polymorphism. Amer. J. Hum. Genet. 32:314–331.
Bracci, T.; Sebastiani, L.; Busconi, M.; Fogher, C.; Belaj, A. & Trujillo,
I. (2009). SSR markers reveal the uniqueness of olive cultivars from the
Italian region of Liguria. Scientia Horticulturae, Vol.122, pp. 209-215.
Burley AL, Phillips S, Ooi MKJ . Can age be predicted from diameter
for the obligate seeder Allocasuarina littoralis (Casuarinaceae) by
using dendrochronological techniques? Australian Journal of Botany
2007;55:433-438.
40
Busconi M, Foroni C, Corradi M, Bongiorni C, Cattapan F, Fogher C
(2003) DNA extraction from olive oil and its use in the identification of
the production cultivar. Food Chem 83:127–134
Cantini, C., Cimato, A. and Sani, G. 1999. Morphological evaluation
of olive germplasm present in Tuscany region. Euphytica, 109: 173–181.
Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., Testolin, R.
2002. Microsatellite markers isolated in olive (Olea europaea L.) are
suitable for individual fingerprinting and reveal polymorphism within
ancient cultivars. Theoretical and Applied Genetics,104: 223-228.
Corpas, F. J., Ferna´ndez-Ocan˜a, A., Carreras, A., Valderrama, R.,
Luque, F., Esteban, F. J.,Rodrı´guez-Serrano, M., Chaki, M., Pedrajas, J.
R., Sandalio, L. M., del Rı´o, L. A., and Barroso, J. B. (2006). The
expression of different superoxide dismutase forms is cell-type
dependent in olive (Olea europaea L.) leaves. Plant Cell Physiol. 47,
984–994.
Cronquist,A., 1981. An integrated system of classification of
flowering plants.Columbia Univ. press.New York, USA.
De la Rosa R, Angiolillo A, Guerrero M, Pellegrini M, Rallo L, Besnard
G, Berville´ A, Martin A, Baldoni L (2003) A first linkage map of olive
(Olea europaea L.) cultivars using RAPD, AFLP, RFLP and SSR
markers. Theor Appl Genet 106:1273–1282
41
De la Rosa R, James CM, Tobutt KH (2004) Using microsatellites for
paternity testing in olive progenies. HortScience 39:351–354
De la Rosa R, James CM, Tobutt KR (2002) Isolation and
characterisation of polymorphic microsatellites in olive (Olea europaea
L.) and their transferability to other genera in the Oleaceae. Mol Ecol
2:265–267.
Díaz, A., Martín, A., Rallo, P., Barranco, D., De la Rosa, R. (2006) Self-
incompatibility of ‘Arbequina’ and ‘Picual’ olive assessed by SSR markers.
J. Amer. Soc. Hort. Sci. 131:250–255.
Durgac, C., Kiyga, Y., Ulas, M., 2010: Comparative molecular
analysisof old olive (Olea europaea L.) genotypes from Eastern
Mediterranean region of Turkey. Afr. J. Biotechnol. 9, 428-433.
Doveri S, Sabino Gil F, Diaz A, Reale S, Busconi M, da Camara
Machado A, Martin A, Fogher C, Donini P, Lee D (2008).
Standardization of a set of microsatellite markers for use in cultivar
identification studies in olive (Olea europaea L.). Sci. Hortic.
(Amsterdam) 116: 367-373.
Essadki M, Ouazzani N, Lumaret R, Moumni M (2006). ISSR variation
in olive-tree cultivars from Morocco and other western countries of the
Mediterranean Basin. Genet. Resour. Crop. Evol. 53(3): 475-482.
42
Ercisli S and Barut EA (2009). Molecular characterization of olive
cultivars using amplified fragment length polymorphism markers.
Genet. Mol. Res., 8(2): 414-419.
Fabbri A, Lambardi M, Ozden-Tokatli Y. (2009). Olive Breeding.
In:Breeding Plantation Tree Crops: Tropical Species, Springer
Science+Business Media, LLC. Cp.12, p.423-465.
Fabbri, A., Hormaza, J.I. and V.S. Polito. 1995. Random amplified
polymorphic DNA analysis of olive (Olea europaea L.) cultivars.
J. Am. Soc. Hortic. Sci., 120: 538-542
Fendri M, Trujillo I, Trigui A and Rodriguez-Garcia IM (2010). Simple
sequence repeat identification and endocarp characterization of olive
tree accessions in a Tusinian germplasm collection. HortScience 45:
1429-1436.
Food and Agriculture Organization of the United Nations
,Faostat.fao.org (2012-02-23). Retrieved on 2012-07-08
Food and Agriculture Organization of the United Nations ,Seed and
Plant Genetic Resources Service – AGPS,OLIVE GERMPLASM
cultivars and world-wide collections,Edition 2005.
http://apps3.fao.org/wiews/olive/intro.jsp.
43
Ganino, T., Beghe` , D., Valenti, S., Nisi, R., Fabbri, A., 2007. RAPD
and SSR markers for characterization and identification of ancient
cultivars of Olea europaea L. in the Emilia region, Northern Italy.
Genet. Resour. Crop Evol. 54, 1531–1540.
Gemas VJ, Almadanim MC, Tenreiro R, Martins A, Fevereiro P (2004)
Genetic diversity in the Olive tree (Olea europaea L. subsp. europaea)
cultivated in Portugal revealed by RAPD and ISSR markers. Genet
Resour Crop Evol 51:501–511
Gomes, S.; Martins-Lopes, P.; Lopes, L. & Guedes-Pinto, H. (2009).
Assessing genetic diversity in Olea europaea L. using ISSR and SSR
markers. Plant Molecular Biology Reports, Vol.123, pp. 82-89.
Grati-Kamoun, N., Mahmoud, F., Rebaï, A. and Gargouri, A. 2006.
Genetic diversity of Tunisian Olive Tree (Olea europaea L.) cultivars
assessed by AFLP markers. Genet. Resour. Crop Evol., 53: 265-275.
Green, P.S. (2002) A revision of Olea L. (Oleaceae). Kew Bulletin,
57(1): 91-140.
Hagidimitriou M, Katsiotis A, Menexes G, Pontikis C, Loukas M
(2005). Genetic diversity of major Greek olive cultivars using
molecular (AFLPs and RAPDs) markers and morphological traits. J.
Am. Soc. Hort. Sci. 130: 211-217.
44
Hatzopoulos, P.; Banilas, G.; Giannoulia, K.; Gazis, F.; Nikoloudakis,
N.; Milioni, D. & Haralampidis, K. (2002). Breeding molecular markers
and molecular biology of the olive tree. European Journal of Lipid
Science and Technology, Vol.104, pp. 574-586.
Hess J, Kadereit W, Vargas P (2000) The colonization history of Olea
europea L. in Macaronesia based on internal transcribed spacer 1
(ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD)
and intersimple sequence repeats (ISSR). Mol Ecol 9:857–868
Hirst, K K.. 2013. Olive history: domistication of Olea europea L.
http://archaeology.about.com/od/oterms/qt/Olive-History.htm
Kahl, G. (2004). The dictionary of gene technologies. Genomics,
transcriptomics, proteomics.3rd Edition. Volume 1 and 2 Wiley – VCH
Verlag, Gmb H &Co. KGaA, Weinheim.
Karp, A.; Seberg, O. & Buiatti, M. (1996). Molecular techniques in the
assessment of botanical diversity. Annals of Botany, Vol.78, pp. 143-149.
La Mantia M, Lain O, Caruso T, Testolin R (2005) SSR-based DNA
fingerprints reveal the genetic diversity of Sicilian olive (Olea europaea
L.) germplasm. J Hortic Sci Biotech 80:628–632.
M. Morgante, A. M. Olivieri, Plant J. 3 (1993) 175– 182.
45
Martins-Lopes P, Gomes S, Santos E, Guedes-Pinto H (2008). DNA
markers for Portuguese olive oil fingerprinting. J Agric Food Chem
56:11786–11791.
Mariotti R, Cultrera NG, Díez CM, Baldoni L and Rubini A.(2010).
Identification of new polymorphic regions and differentiation of
cultivated olives (Olea europaea L.) through plastome sequence
comparison. BMC Plant Biol. 2010 Sep 24;10:211. doi: 10.1186/1471-
2229-10-211.
Mohan, M.; Nair, S.; Bhagwat, A.; Krishna, T.G.; Yano, M.; Bhatia,
C.R. & Sasaki, T. (1997). Genome mapping, molecular markers and
markers-assisted selection in crop plants. Molecular Breeding, Vol.3, pp.
87-103.
Mookerjee, S., Guerin, J., Collins, G., Ford, C., Sedgley, M. (2005).
Paternity analysis using microsatellite markers to identify pollen
donors in an olive grove. Theor. Appl. Genet. 111:1174–1182.
Muñoz-Díez C. Spain; 2008. Prospección, diversidad genética y
conservación de ejemplares monumentales y poblaciones silvestres de
olivo (Olea europaea L.). PhD Thesis, University of Cordoba.
Muzzalupo, I., Stefanizzi, F., Salimonti, A., Falabella, R. and Perri, E.
2009. Microsatellite markers for identification of a group of Italian
olive accessions. Sci Agric (Piracicaba, Braz), 66: 685- 690.
46
Nei M. (1978) Estimation of average heterozygosity and genetic
distance from a small number of individuals. Genetics 89:583-590
Nei M. (1987) Molecular Evolutionary Genetics. Columbia University
Press, New York, NY, USA.
Owen CA, Bita EC, Banilas G, Hajjar SE, Sellianakis V, Aksoy U, et al..
2005. AFLP reveals structural details of genetic diversity within
cultivated olive germplasm from the Eastern Mediterranean. Theor.
Appl. Genet. 110: 1169-1176.
Ozkaya, M.T., Cakir, E., Gokbayrak, Z., Ercan, H. and Taskin, N. 2006.
Morphological and molecular characterization of Derik Halhali olive
(Olea europaea L.) accessions grown in Derik–Mardin province of
Turkey. Scientia Horticulturae, 108: 205–209.
Palestinian Central Bureau of Statistics (PCBS), The Statistical Report
about the Olive Presses Survey 2012.
Pelestinian Central Bureau of Statistics, (2004) Agricultural statisitical
data. Palestine.
Pontikis, C.A., M. Loukas, and G. Kousounis. 1980. The use of
biochemical markers to distinguish olive cultivars. J. Hort. Sci.
55(4):333-343.
47
Rafalski, J.A. & Tingey, S.V. (1993). Genetic diagnostics in plant
breeding: RAPD, microsatellites and machines. Trends in Genetics,
Vol.9, pp. 275-279.
Rallo L, Muñoz-Díez C. Olive growing in a time of change. In:
Verheye H, editor. Soils, plant growth and crop production. 2010. In:
Encyclopedia of life support systems (EOLSS), developed under the
auspices of the UNESCO. Oxford: Eolss Publishers. http://www.eolss.net.
(accessed 8 February 2011
Rallo, P.; Dorado, G. & Martin, A. (2002). Application of
Microsatellite Markers in olive Breeding. Acta Horticulturae, Vol.586,
pp. 69-71.
Reale, S., S. Doveri, A. Dı´az, A. Angiolillo, L. Lucentini, F. Pilla, A.
Martı´n, P. Donini, and D. Lee. 2006. SNP-based markers for
discriminating olive (Olea europaea L.) cultivars. Genome 49:1193–
1205.
Roubos, K., Moustakas, M., Aravanopoulos, F.A., 2010: Molecular
identifi cation of Greek olive (Olea europaea) cultivars based on
microsatellite loci. Genet. Mol. Res. 9, 1865-1876.
Rozas V. A dendroecological reconstruction of age structure and
past management in an old-growth pollarded parkland in northern
Spain. Forest Ecology and Management 2004;195:205-219.
48
Rozas V. Tree age estimates in Fagus sylvatica and Quercus robur:
testing previous and improved methods. Plant Ecology 2003;167:193-
212.
Rugini, E. & Lavee, S. (1992). Olive. In: F.A. Hammerschlag and R.E.
Litz (eds.).Biotechnology of perennial fruit crops. CAB Intl., Wallingford,
U.K. pp. 371-382.
Sabino Gil, F., Busconi, M., Da Camara Machado, A., Fogher, C., 2006.
Development and characterization of microsatellite loci from Olea
europaea. Mol. Ecol. Notes 6, 1275–1277.
Saitou N and Nei M (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-
425.
Sarri, V., Baldoni, L., Porceddu, A. and Cultrera, N.G. 2006 .
Microsatellite markers are powerful tools for discriminating among
olive cultivars and assigning them to geographically defined
populations. Genome 49: 1606-1615.
Sarri, V., Baldoni, L., Porceddu, A., Cultrera, N.G.M., Contento, A.,
Frediani, M., Belaj, A., Trujillo, I., Cionini, P.G., 2006. Microsatellite
markers are powerful tools for discriminating among olive cultivars
and assigning them to geographically defined populations. Genome 49,
1606–1615.
49
Schlüter, P. M. & Harris, S. A., 2006. Analysis of multilocus
fingerprinting data sets containing missing data. Mol. Ecol. Notes: 6:
569-572.
Sensi, E., Vignani R, Scali, M. and Masi, E. 2003. DNA fingerprinting
and genetic relatedness among cultivated varieties of Olea europaea L.
estimated by AFLP analysis. Sci. Hort., 97: 379-388.
Sefc, K.M., Lopes, M.S., Mendonc¸ D., Rodrigues, D., Santos, M.,
Laimer, M. and Machado, A. 2000. Identification of microsatellite loci in
olive (Olea europaea) and their characterization in Italian and Iberian
olive trees. Molecular Ecology, 9: 1171–1173.
Soleimani, A., Zamani, Z., Talaei, A. R. and Naghavi, M. R. 2006.
Molecular Characterization of Unknown Potentially Salt Tolerant
Olive Genotypes Using RAPDMarkers. J. Sci. Islamic Rep. Iran, 17:
107-112.
Taamalli, W., Geuna, F., Bassi, D., Daoud, D. and Zarrouk, M. 2008.
SSR marker based DNA fingerprinting of Tunisian olive (Olea
europaea L.) varieties. Journal of agronomy, 7: 176-181.
Tanksley, S.D. & Orton, T.J. (1983). Isozymes in plant genetics and
breeding. Elsevier, Amsterdam.
50
Terzopoulos, P.J., Kolano, B., Bebeli, P.J. and Kaltsikes, P.J. 2005.
Identification of (Olea europaea L.) cultivars using inter simple
sequence repeat markers. Scientia Hortic., 105: 45-51.
Trujillo, I, L. Rallo And Arús, Pere (1995). Identifying Olive Cultivars
by Isozyme Analysis. J. AM ER. SOC. HO RT. SCI. 120(2):318–324.
Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; van de Lee, T.; Hornes,
M.; Friters, A.; Pot, J.; Paleman, J.; Kuiper, M. & Zabeau, M. (1995).
AFLP: a new technique for DNA fingerprinting. Nucleic Acids
Research, Vol.21, pp. 4407-4414.
Wiesman, Z., N. Avidan, S. Lavee, and B. Quebedeaux. 1998.
Molecular characterization of common olive cultivars in Israel and the
West Bank using randomly amplified polymorphic DNA (RAPD)
markers. J.Amer. Soc. Hort. Sci. 123:837–841.
Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, and S.V.
Tingey. 1990. DNA polymorphism amplified by arbitrary primers are
useful as genetic markers. Nucleic Acids Res. 18:6531–6535.
World bank, Brief Overview of the Olive and the Olive Oil Sector in
the Palestinian Territories.2012.http://go.worldbank.org/MBK9GU1TD0
Wu, K.S. & Tanksley, S.D. (1993). Abundance, polymorphism and
genetic mapping of microsatellites in rice. Molecular General Genetics,
Vol. 241, pp. 225-235.
52
Zitoun B, Bronzini de Caraffa V, Giannettini J, Breton C. 2008. Genetic
diversity in Tunisian olive accessions and their relatedness with other
Mediterranean olive genotypes. Sci. Hortic. 115: 416-419.
Zohary, D. (1994). The wild genetic resources of the cultivated olive.
Acta Horticulturae,Vol.356, pp. 62-65.
Zohary, D., and Spiegel-Roy, P. (1975). Beginning of fruit growing in
the world. Science 187, 319–327.
53
Appendix
Table (1): Concentration and quality of the used DNA:
# Sample
Concentration
ng/µl Purity
V. DNA Stock
(µl)
V. TE buffer
(µl)
1 FQ3 77.8 1.93 64.26735219 35.73264781
2 FQ2 78 2.21 64.1025641 35.8974359
3 FQ1 84 2.4 59.52380952 40.47619048
4 TF1 77.9 1.94 64.18485237 35.81514763
5 TF2 58.8 1.67 85.03401361 14.96598639
6 TF3 180.9 1.73 27.63957988 72.36042012
7 TF4 131.3 2.2 38.08073115 61.91926885
8 TF5 35 3.46 142.8571429 -42.85714286
9 RA1 73.4 1.83 68.11989101 31.88010899
10 RA2 45 2.23 111.1111111 -11.11111111
11 RA3 149.5 1.8 33.44481605 66.55518395
12 RA4 83.1 1.84 60.16847172 39.83152828
13 RA5 74 1.64 67.56756757 32.43243243
14 RA6 71.1 2.82 70.32348805 29.67651195
15 RA7 72.7 1.81 68.77579092 31.22420908
16 RA8 58.3 1.93 85.76329331 14.23670669
17 HE11 141.5 1.42 35.33568905 64.66431095
18 HE10 165.3 1.51 30.24803388 69.75196612
19 HE9 166.3 1.73 30.06614552 69.93385448
20 HE8 83.9 1.54 59.59475566 40.40524434
21 HE1 59.5 2.95 84.03361345 15.96638655
22 HE12 80.3 2.28 62.26650062 37.73349938
23 HE7 326.6 1.91 15.30924679 84.69075321
24 HE6 167.5 1.88 29.85074627 70.14925373
25 HE2 58.7 3.86 85.17887564 14.82112436
26 HE4 76.5 1.69 65.35947712 34.64052288
27 HE5 142.7 1.49 35.0385424 64.9614576
28 HE3 71.1 1.77 70.32348805 29.67651195
29 WD2 108 1.33 46.2962963 53.7037037
30 BD1 94.4 1.26 52.96610169 47.03389831
31 WA1 175.7 1.36 28.45759818 71.54240182
32 BD2 74.6 1.65 67.02412869 32.97587131
33 WA6 104.3 1.62 47.93863854 52.06136146
34 WA5 92 1.65 54.34782609 45.65217391
35 BD6 99.1 2.46 50.45408678 49.54591322
36 WA4 75 1.87 66.66666667 33.33333333
37 WA2 69.9 2.31 71.53075823 28.46924177
38 BD4 56.2 1.86 88.96797153 11.03202847
39 WA4 190 1.75 26.31578947 73.68421053
40 BD3 35 1.99 142.8571429 -42.85714286
41 BD5 75.8 2.15 65.96306069 34.03693931
42 KQ6 53.5 1.77 93.45794393 6.542056075
54
43 KQ5 61.2 1.52 81.69934641 18.30065359
44 KQ4 207.7 1.54 24.07318247 75.92681753
45 KQ3 196.9 1.69 25.39360081 74.60639919
46 KQ2 87.1 1.51 57.40528129 42.59471871
47 KQ1 227 1.59 22.02643172 77.97356828
48 YA6 134 1.17 37.31343284 62.68656716
49 YA5 45 1.12 111.1111111 -11.11111111
50 YA4 81.3 1.15 61.50061501 38.49938499
51 YA3 70.2 2.45 71.22507123 28.77492877
52 YA2 73.4 1.25 68.11989101 31.88010899
53 YA1 94.2 1.31 53.07855626 46.92144374
54 BL6 151.1 1.31 33.09066843 66.90933157
55 BL5 89.4 1.18 55.92841163 44.07158837
56 BL4 87.5 1.66 57.14285714 42.85714286
57 BL3 35 2.3 142.8571429 -42.85714286
58 BL2 63.9 1.23 78.24726135 21.75273865
59 BL1 52.9 1 94.51795841 5.482041588
60 BR1 66.5 1.89 75.18796992 24.81203008
61 BR2 51.7 1.71 96.71179884 3.288201161
62 TU6 45.9 1.7 108.9324619 -8.932461874
63 TU2 69.7 2.31 71.73601148 28.26398852
64 BR3 74 1.4 67.56756757 32.43243243
65 TU4 10 0 500 -400
66 BR6 67.7 1.5 73.85524372 26.14475628
67 TU3 10 0 500 -400
68 TU5 10 0.4 500 -400
69 AS6 68 0 73.52941176 26.47058824
70 BR5 69.6 2.3 71.83908046 28.16091954
71 SA3 86.3 1.91 57.93742758 42.06257242
72 AN5 40 3.95 125 -25
73 AN2 30 2.3 166.6666667 -66.66666667
74 AS4 40 2.49 125 -25
75 AS5 30 1.73 166.6666667 -66.66666667
76 SA4 89 1.7 56.17977528 43.82022472
77 BA3 40 1.29 125 -25
78 BA2 145.4 2.08 34.38789546 65.61210454
79 SA6 64.1 4.21 78.00312012 21.99687988
80 JE2 25 0.7 200 -100
81 JE4 30 0 166.6666667 -66.66666667
82 JE1 20 1.9 250 -150
83 JE5 65.8 1.5 75.98784195 24.01215805
84 JE6 51 1.45 98.03921569 1.960784314
85 AS2 64.4 1.64 77.63975155 22.36024845
86 BA5 35 1.79 142.8571429 -42.85714286
87 BA4 38 1.59 131.5789474 -31.57894737
88 AS1 60 1.32 83.33333333 16.66666667
89 SA1 68 1.34 73.52941176 26.47058824
90 TU1 20 1.49 250 -150
91 AN4 40 2.01 125 -25
92 AS3 20 1.99 250 -150
55
93 SA2 100.3 1.57 49.85044865 50.14955135
94 BA6 20 1.66 250 -150
95 AN6 40 1.59 125 -25
96 JE3 75.4 1.52 66.31299735 33.68700265
97 SA5 72.4 1.8 69.06077348 30.93922652
98 AN1 10 0 500 -400
99 BA1 81.7 2.54 61.1995104 38.8004896
100 BR4 40 1.99 125 -25
101 AN3 40 2.9 125 -25
56
Table (2): similarity matrix.
FQ3 FQ2 FQ1 TF1 TF2 TF3 TF4 TF5 RA1 RA2 RA3 RA4 RA5 RA6 RA7 RA8 HE11 HE10 HE9 HE8 HE1 HE12 HE7 HE6 HE2 HE4 HE5 HE3 WD2 BD1 WA1 BD2 WA6 WA5 BD6 WA4 WA2 BD4 WA3 BD3 BD5 KQ6 KQ5 KQ4 KQ3 KQ2 KQ1 YA6 YA5 YA4 YA3 YA2 YA1 BL6 BL5 BL4 BL3 BL2 BL1 BR1 BR2 TU6 TU2 BR3 TU4 BR6 TU3 TU5 AS6 BR5 SA3 AN5 AN2 AS4 AS5 SA4 BA3 BA2 SA6 JE2 JE4 JE1 JE5 JE6 AS2 BA5 BA4 AS1 SA1 TU1 AN4 AS3 SA2 BA6
FQ3 0.000
FQ2 0.000 0.000
FQ1 0.000 0.000 0.000
TF1 0.000 0.000 0.000 0.000
TF2 0.200 0.200 0.200 0.200 0.000
TF3 0.300 0.300 0.300 0.300 0.125 0.000
TF4 0.000 0.000 0.000 0.000 0.200 0.300 0.000
TF5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000
RA1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000
RA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000
RA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000
RA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000
RA5 0.571 0.571 0.571 0.571 0.615 0.692 0.571 0.571 0.571 0.571 0.571 0.571 0.000
RA6 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000
RA7 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000 0.000
RA8 0.824 0.824 0.824 0.824 0.800 0.867 0.824 0.824 0.824 0.824 0.824 0.824 0.571 0.538 0.538 0.000
HE11 0.250 0.250 0.250 0.250 0.417 0.500 0.250 0.250 0.250 0.250 0.250 0.250 0.500 0.571 0.571 0.765 0.000
HE10 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000
HE9 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000
HE8 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000
HE1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000
HE12 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000
HE7 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000
HE6 0.333 0.333 0.333 0.333 0.200 0.300 0.333 0.333 0.333 0.333 0.333 0.333 0.571 0.643 0.643 0.750 0.385 0.333 0.333 0.333 0.333 0.333 0.333 0.000
HE2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000
HE4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000
HE5 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000
HE3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000
WD2 0.462 0.462 0.462 0.462 0.500 0.583 0.462 0.462 0.462 0.462 0.462 0.462 0.333 0.417 0.417 0.667 0.500 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.538 0.538 0.462 0.000
BD1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.000
WA1 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000
BD2 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.938 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.222 0.636 0.000
WA6 0.667 0.667 0.667 0.667 0.727 0.818 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.750 0.750 0.857 0.692 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.636 0.636 0.667 0.400 0.636 0.250 0.556 0.000
WA5 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000
BD6 0.455 0.455 0.455 0.455 0.636 0.600 0.455 0.455 0.455 0.455 0.455 0.455 0.455 0.545 0.545 0.867 0.364 0.455 0.455 0.455 0.455 0.455 0.455 0.583 0.455 0.545 0.545 0.455 0.455 0.545 0.500 0.727 0.700 0.500 0.000
WA4 0.583 0.583 0.583 0.583 0.636 0.727 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.667 0.667 0.786 0.615 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.545 0.545 0.583 0.300 0.545 0.125 0.600 0.143 0.125 0.600 0.000
WA2 0.500 0.500 0.500 0.500 0.667 0.750 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.800 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.500 0.455 0.455 0.500 0.364 0.455 0.222 0.500 0.250 0.222 0.500 0.125 0.000
BD4 0.364 0.364 0.364 0.364 0.400 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.692 0.692 0.875 0.273 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.500 0.455 0.545 0.636 0.727 0.545 0.333 0.636 0.667 0.000
WA3 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000 0.500 0.125 0.222 0.545 0.000
BD3 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000
BD5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000
KQ6 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.938 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.400 0.750 0.250 0.700 0.750 0.600 0.727 0.636 0.500 0.750 0.222 0.300 0.000
KQ5 0.700 0.700 0.700 0.700 0.625 0.750 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.667 0.667 0.700 0.727 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.800 0.800 0.700 0.700 0.667 0.625 0.889 0.875 0.625 0.750 0.750 0.778 0.778 0.625 0.667 0.700 0.889 0.000
KQ4 0.400 0.400 0.400 0.400 0.600 0.700 0.400 0.400 0.400 0.400 0.400 0.400 0.545 0.500 0.500 0.857 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.400 0.500 0.500 0.400 0.545 0.500 0.600 0.556 0.667 0.600 0.375 0.700 0.600 0.600 0.600 0.333 0.400 0.375 0.714 0.000
KQ3 0.636 0.636 0.636 0.636 0.818 0.909 0.636 0.636 0.636 0.636 0.636 0.636 0.636 0.600 0.600 0.846 0.667 0.636 0.636 0.636 0.636 0.636 0.636 0.846 0.636 0.600 0.600 0.636 0.636 0.600 0.556 0.500 0.429 0.556 0.667 0.500 0.375 0.818 0.556 0.600 0.636 0.500 0.857 0.429 0.000
KQ2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.636 0.545 0.400 0.667 0.111 0.200 0.125 0.778 0.444 0.556 0.000
KQ1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000 0.100 0.222 0.667 0.333 0.600 0.111 0.000
YA6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000
YA5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000
YA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000
YA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000
YA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000
YA1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.545 0.455 0.455 0.583 0.200 0.100 0.222 0.800 0.500 0.600 0.111 0.200 0.100 0.100 0.100 0.100 0.100 0.000
BL6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000
BL5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000
BL4 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000
BL3 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000
BL2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000 0.000
BL1 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000
BR1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000
BR2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000
TU6 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000 0.200 0.200 0.000
TU2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000
BR3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000 0.000
TU4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.667 0.583 0.455 0.583 0.200 0.100 0.222 0.800 0.333 0.600 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.111 0.111 0.111 0.111 0.100 0.100 0.111 0.100 0.100 0.000
BR6 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000
TU3 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000
TU5 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.714 0.692 0.692 0.800 0.417 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.455 0.667 0.500 0.727 0.667 0.750 0.750 0.769 0.545 0.667 0.455 0.364 0.500 0.778 0.600 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.400 0.400 0.400 0.400 0.364 0.364 0.400 0.364 0.364 0.300 0.400 0.400 0.000
AS6 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000
BR5 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.786 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.222 0.500 0.444 0.700 0.500 0.727 0.600 0.636 0.500 0.500 0.400 0.300 0.600 0.571 0.700 0.800 0.500 0.400 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.500 0.300 0.300 0.500 0.300 0.300 0.400 0.333 0.333 0.500 0.222 0.000
SA3 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000
AN5 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000
AN2 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000
AS4 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.867 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.444 0.700 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.250 0.750 0.375 0.667 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.333 0.333 0.333 0.125 0.300 0.300 0.125 0.300 0.300 0.222 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.000
AS5 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000 0.400 0.111 0.333 0.111 0.111 0.111 0.125 0.000
SA4 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000 0.222 0.111 0.000
BA3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000
BA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000
SA6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000
JE2 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000
JE4 0.500 0.500 0.500 0.500 0.400 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.692 0.692 0.714 0.273 0.500 0.500 0.500 0.500 0.500 0.500 0.364 0.500 0.583 0.583 0.500 0.615 0.455 0.545 0.636 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.455 0.500 0.636 0.625 0.727 0.818 0.545 0.455 0.500 0.500 0.500 0.500 0.500 0.583 0.500 0.500 0.667 0.667 0.667 0.545 0.500 0.500 0.545 0.500 0.500 0.583 0.400 0.400 0.400 0.455 0.500 0.455 0.455 0.455 0.500 0.400 0.455 0.400 0.400 0.400 0.250 0.000
JE1 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.769 0.750 0.750 0.933 0.583 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.333 0.333 0.400 0.667 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.400 0.375 0.875 0.667 0.778 0.444 0.500 0.400 0.400 0.400 0.400 0.400 0.333 0.400 0.400 0.250 0.250 0.250 0.444 0.400 0.400 0.444 0.400 0.400 0.333 0.444 0.444 0.250 0.333 0.556 0.333 0.333 0.333 0.375 0.444 0.333 0.250 0.250 0.250 0.500 0.600 0.000
JE5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.846 0.833 0.833 0.929 0.667 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.444 0.700 0.286 0.625 0.700 0.909 0.667 0.700 0.700 0.700 0.600 0.500 0.500 0.857 0.778 0.750 0.556 0.600 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.556 0.500 0.500 0.556 0.500 0.500 0.444 0.556 0.556 0.375 0.444 0.500 0.444 0.444 0.444 0.500 0.556 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.000
JE6 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.583 0.583 0.714 0.538 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.300 0.545 0.500 0.727 0.545 0.750 0.636 0.667 0.545 0.545 0.455 0.364 0.636 0.625 0.727 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.545 0.545 0.545 0.545 0.364 0.364 0.545 0.364 0.364 0.455 0.400 0.400 0.400 0.300 0.333 0.300 0.300 0.300 0.500 0.400 0.300 0.222 0.222 0.222 0.250 0.400 0.444 0.375 0.000
AS2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000
BA5 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000
BA4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000
AS1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000
SA1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000
TU1 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000
AN4 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000
AS3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000
SA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000
BA6 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000 0.250 0.500 0.429 0.250 0.250 0.250 0.143 0.250 0.250 0.143 0.250 0.250 0.250 0.000
AN6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000 0.250
JE3 0.545 0.545 0.545 0.545 0.600 0.700 0.545 0.545 0.545 0.545 0.545 0.545 0.857 0.846 0.846 0.857 0.583 0.545 0.545 0.545 0.545 0.545 0.545 0.667 0.545 0.500 0.500 0.545 0.769 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.545 0.375 0.875 0.667 0.625 0.444 0.500 0.545 0.545 0.545 0.545 0.545 0.500 0.545 0.545 0.444 0.444 0.444 0.444 0.545 0.545 0.444 0.545 0.545 0.500 0.444 0.444 0.600 0.500 0.556 0.500 0.500 0.500 0.375 0.444 0.500 0.600 0.600 0.600 0.500 0.600 0.500 0.429 0.600 0.600 0.600 0.556 0.600 0.600 0.556 0.600 0.600 0.600 0.500
SA5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429
AN1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429
BA1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429
BR4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000 0.125 0.125 0.125 0.143
AN3 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429
57
FQ3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
FQ2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
FQ1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
TF1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
TF2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
TF3 1 1 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0
TF4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
TF5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
RA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
RA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
RA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
RA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
RA5 1 1 0 0 1 1 0 0 1 1 0 0 0 0 1 0 0 0 1
RA6 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1
RA7 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1
RA8 0 0 0 0 1 1 0 0 0 1 1 0 0 1 1 0 1 0 0
HE11 1 1 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 1 1
HE10 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE9 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE8 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE12 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE7 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE6 1 1 0 0 0 0 1 1 1 1 0 0 1 0 0 0 0 0 0
HE2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
HE3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
WD2 1 1 0 0 1 1 0 0 1 1 0 0 1 0 0 0 0 1 0
BD1 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
WA1 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0
BD2 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
WA6 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0
WA5 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0
BD6 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 1
WA4 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0
WA2 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 1
BD4 1 1 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 1 0
WA3 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0
BD3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
BD5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
KQ6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
KQ5 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
KQ4 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1
KQ3 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 1
KQ2 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
KQ1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
YA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
YA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
YA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
YA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
YA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
YA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BL1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
BR1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BR2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
TU6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1
TU2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BR3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
TU4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1
BR6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0
TU3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0
TU5 1 1 0 0 0 0 1 1 0 1 0 0 1 1 0 0 0 0 0
AS6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
BR5 0 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
SA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
AN5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
AN2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
AS4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0
AS5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0
SA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0
BA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
BA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
SA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
JE2 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
JE4 1 0 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 0 0
JE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
JE5 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
JE6 1 0 0 0 0 0 1 1 0 1 0 0 1 0 1 0 0 0 0
AS2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
BA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
BA4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
AS1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
SA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
TU1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
AN4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
AS3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
SA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
BA6 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
AN6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0
JE3 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1 1 0
SA5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
AN1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
BA1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
BR4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
AN3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0
Appendix(3):FAMD Format
58
أ
( Olea europea L
2113
ب
( Olea europea L
Microsatellite (SSR)29
03
6
936
04044
PCA
أ