Pfliigers Arch - Eur J Physiol (1996) 431[Suppl]:R193-R194 © Springer-Verlag 1996

Genetic changes in the origin and development of renal cell carcinoma (RCC) Damjan Glavael, 3 • M. Ravnik-Glava62 . Zdenka Ov6ak 3 . Andrej Magera 3

1 National Institute of Chemistry, Ljubljana, Slovenia 2 Institute of Biochemistry, Medical Faculty, Ljubljana, Slovenia 3 Institute of Pathology, Medical Faculty, Ljubljana, Slovenia

Abstract. 64 kidney tumours of clear cell histopathology were analysed with non-isotopic SSCP and HA for the presence of VHL gene defects. All positive cases were further characterised by direct sequencing. In 30 tumours (48%) mutations were identified in the coding region of the VHL gene. Other tumours were examined for methylation changes in 5' CpG islands in exon 1. Bisulphite genomic sequencing which gives positive signal for methylated cytosines, was used in this analysis and in 7 tumours hypermethylation of 5' CpG islands was found. These findings suggest that VHL gene mutations together with methylation associated inactivation of the VHL gene are important events that predispose to renal cell tumorigenesis,

Key words: Tumor suppressor gene - ~'TqL gene - Renal cell carcinoma Kidney cancer - Genetic analysis - Methylation - PCR - SSCP

Introduction

The accumulations of multiple genetic changes are essential steps in the progression of human cancers including renal cell carcinoma (RCC), the most common renal tumour in adults. Recently from 3p25 p26 region the gene responsible for the von Hippel-Lindau disease (VHL-tumour suppressor gene) was identified by a positional cloning strategy [1]. The cloned portion of VHL gene contains 3 exons with 852 nucleotides in the coding region and 2200 nucleotides of the 3'-untranslated region. The VHL protein was shown to bind specifically to the Elongin B and C to inhibit Elongin (SIII) transcriptional activity in vitro [2]. In genetic analysis studies of the VHL gone somatic mutations were identified in about 50% of sporadic, clear cell RCCs [3,4]. Recently it has also been reported that aberrant methylation of CpG islands in the 5' region might inactivate VIJL gene [51.

Correspondence to: D.Glava~5, Institute of Pathology, Faculty of Medicine, Korytkova2, Ljubljana, S l o v e n i a

We attempted to analyse the correlation between turnouts with positive and/or negative mutation in the VtIL locus with the pathological grade or stage of the tumour and silencing of the VHL gene via DNA methylation mechanism.

Materials and methods

Renal carcinomas A total of 64 renal carcinoma samples from Urologic Clinic (Clinical Center in Ljubljana) were included in the study. All tumours samples were t a k e n

from primary tumours in previously untreated patients, and were frozen in liquid nitrogen and stored at -70 C until analysed. Detailed histological analysis with clazsification of the turnout cell phenotype according WIIO typing was made by examination of histopathological sections without knowledge of the molecular genetic data. High molecular weight DNA was isolated from frozen tumour tissue by standard methods.

Detection of mutations Polymerase chain reaction (PCR) amplitication of all the three exons was employed to analyse lhe entire coding region and also a part of untranslated region of VHL gene. Primers sequence used for PCR were ~s previously reported [3], except for exon 1 where the following oligonucleotides were used: F-l: 5 ' -ACAGTAACGAGTTGGCCTAG R-2: 5'-CTGCGTGCGCGCTCCCGATG (168bp) F-5: 5'CGAGCGCGCGCGAAGACTAC R-g: 5 'GGCCTCCATCTCCTCCTCGG (253 bp) F- 13:5 'CCGAGGAGGAGATGGAGGCC VHL-22:5 'GACCGTGCTATCGTCCCTGC (244bp)

PCR products were analysed using non-isotopic single strand con[brmational polymorphism (SSCP) and heteroduplex analysis (HA). Three btL of reaction product was added to 9 gl of 95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol and 20 mM NaOH. The mixture was heated at 97°C for two minutes then placed immediately on ice. Two ~tl, ul were loaded on non-denaturing polyacrylamide gels containing 50 mM Tris- borat, pH 8.3, 4 mM EI)TA. Electrophoresis was run a t 50 W in a 4 °C cold room tbr 10-16 hours using 50 mM Tris-borat buffer with a sequencing gel apparatus (IB[). Gels were silver stained+

Direct sequencig The sequence of DNA samples showing aberrant migration in SSCP analysis was determined according to the USB (United States Biochemical Corporation) Sequenase protocol. Single stranded DNA was obtained by Streptavidin separation of the biotin containing strand according to Dynabeads protocol. Bisulphite genomic sequencing was perlbrmed as described 151.

R194

Results

PCR products in 30 cases (48%) showed aberrant migration in SSCP and/or HA and were sequenced. Sequence analysis revealed 18 deletions, 2 insertions, 9 missense and one splice mutation (Fig la).

a)

iilt >

b)

/ No11 553 676 852

. . . . . . . . S ' - 7

.b ..._._. o×on 1 -7// e~on 2 e×on 3 3'

methVlo~ion sites

Fig,1 a) distribution of mutations within the VHL gene in sporadic renal carcinoma. Arrowheads representing position and type of the mutation in the ~'7-[L gene b) methylation sites in exon 1 of the VHL gene identified by bisulphite genomic sequencing in turnouts with no mutation in the VHL gene.

1 2 3 4 5 6 7 8 9 1011

In 7 RCC tumours with no mutation in the ~TtL region bisulphite genomic sequencing revealed hypermethylation of 5'CpG islands in the exon 1 (Fig lb).

Discussion

Genetic changes in renal tumorigenesis are still not completely understood. Therefore it is of interest to further extent mutation analysis of the VHL gene to identify types of mutations involved in clear cell and other n,pes of RCCs. In our study of 64 clear cell RCCs somatic mutations were found in 30 tumours (48%). Distribution of identified VHL mutations is broadly similar as reported in previous studies [3,4,5]. Frameshiff deletions and insertions accounted for 60% of all mutations while 30% were missense mutations. Most mutations were detected in exon 2. Almost all frameshift mutations (16 deletions ,and 2 insertions) cause truncation of the gene product. No correlation with pathological grade or stage of the tumour and b~e of ~7/L gene defect was found. In 7 (20%) tumours with no mutation in the coding region of the IHL gene hypermethylated cytosines were identified. One hot spot of methylated cytosines was detected around Not I site and the other upstream around Sma I site (Fig lb). Since it was shown that methylation of CpG islands correlates with loss of I,'7tL expression and silencing of 17/L gene [7] it is likely that inactivation of fiT/L tumour suppressor gene is the most important mechanism which leads to initiation and progression of renal cell carcinoma.

NORMAL 483delCT

A C G T A C G T

Fig,2 a) Example of mutation screening by SSCP analysis in sporadic RCC. Additional bands (arrowed) were detected in tumour DNA sample No.7, b) Sequence analysis of sample No. 7 revealed deletion of CT at nt. 483.

References

1. Latif F, Tory K, Gnarra J, Yao M. Duh F-M, Orcult M, Stackhouse T, Kuzmin 1 et al. (1993) Identification of the von Hippel-l,indau Disease Tumor Suppressor Gene. Science 260:1317-1321

2. Duan DR, Pause A~ Burgess WH, Conaway RC, Conaway ,TW, l,mchan WM, Klausner RD (1995) Inhibition of Transcription l'longation by the UHL Tumor Suppressor Protein. Science 269:1402-1405

3. Gnarra J, Tory K, Weng Y, Scimaidt L. Wei MIL Li H, Latif F, IAu F et al., (1994) Mutations of the I,'7~L turnout suppressor gene in renal carcinoma. Nature Genetics 7:85-90

4. Foster K, Prowse A, van den Berg ~ Fleming S, ltulsbeek MMF, Crossey PA, Richards FM et al, (1994) Somatic mutations of the yon l iippel Lindau disease tumor suppressor gene in non-f.'uniliat clear cell renal

carcinoma. Human Molecular Genetics 3:2169-2173 5. Shuin T, Kondo K, Torigoe S. Kishida T, Kubota Y. Hosaka M,

Nagashima Y, Kitamura H et al, (1994) Frequent somatic mutations and loss ofheterozygosity of the von Hippel - Lindau tumor suppressor gene in primm'y human renal cell carcinomas. Cancer Research 54:2852 - 2855

6. Clark SJ, Harrison J, Paul CL, Frommer M (1994) ltigh sensitivity mapping ofmethylated cytosines, Nucleic Acids Research 22:2990-2997

7. lterman JG, Lalif F, Weng Y, l,erman MI, Zbar 1:1. Liu S, Samid D, l)uan D-SR et al. (1994) Silencing of the t 7~L tumor-suppressor gene by I)NA methylation in renal carcinonla. Proc. NatI.Acad.Sci.USA 9 1:9700-9704