Genes involved in the determination of the rate of inversions at short inverted repeats

Genes involved in the determination of the rate ofinversions at short inverted repeats

Malgorzata M. Slupska, Ju-Huei Chiang, Wendy M. Luther, Jean Lee Stewart,Lisa Amii, Alexis Conrad and Jeffrey H. Miller*

Department of Microbiology and Molecular Genetics and the Molecular Biology Institute, University of California, Los Angeles,

CA 90024, USA

Abstract

Background: Not all of the enzymatic pathways

involved in genetic rearrangements have been

elucidated. While some rearrangements occur by

recombination at areas of high homology, others are

mediated by short, often interrupted homologies.

We have previously constructed an Escherichia coli

strain that allows us to examine inversions at

microhomologies, and have shown that inversions

can occur at short inverted repeats in a recB,C-

dependent fashion.

Results: Here, we report on the use of this strain to

de®ne genetic loci involved in limiting rearrange-

ments on an F0 plasmid carrying the lac genes.

Employing mini-Tn10 derivatives to generate inser-

tions near or into genes of interest, we detected

three loci (rmuA,B,C) that, when mutated, increase

inversions. We have mapped, cloned and sequenced

these mutator loci. In one case, inactivation of the

sbcC gene leads to an increase in rearrangements,

and in another, insertions near the recE gene lead to

an even larger increase. The third gene involved in

limiting inversions, rmuC, has been mapped at

86 min on the E. coli chromosome and encodes a

protein of unknown function with a limited homol-

ogy to myosins, and some of the SMC (structural

maintenance of chromosomes) proteins.

Conclusions: This work presents the ®rst example of

an anti-mutator role of the sbcC,D genes, and

de®nes a new gene (rmuC) involved in DNA

recombination.

Introduction

Genetic rearrangements play a central role in manybiological processes, including development (Bostock1984), gene regulation (Haber 1983; Silverman &Simon 1983; Golden et al. 1987; Stragier et al. 1989),antibody formation (Tonegawa 1983) and evolution(Riley & Anilionis 1978). Rearrangements representingdeletions or duplications between repeated sequences,often involving short repeats which are strikingly similarto those found in bacterial rearrangements, have beenassociated with a number of human diseases. Sponta-neous Kearns±Sayre/chronic external opthalmoplegiaplus syndrome (Shoffner et al. 1989), Fabry disease(Kornreich et al. 1990) hereditary angioedema (Stoppa-Lyonnet et al. 1990) and Duchenne muscular dystrophy(Darras et al. 1988), as well as certain types of cancers

(Leder et al. 1983; Marx 1984), are but a few examplesof these diseases. Gene ampli®cation in mammalian cellsis responsible for the observed resistance to chemother-apeutic agents used in the treatment of cancer. Forexample, methotrexate resistance results from ampli®-cation of the dihydrofolate reductase gene in culturedcells (Schimke 1984) and in human patients (Horns et al.1984).

Although large genetic rearrangements have beenstudied for many years, some uncertainty still remainsabout the enzymatic pathways involved. While somerearrangements occur by recombination at largehomologies (Anderson & Roth 1981) (Mahan &Roth 1989), others are mediated by short, ofteninterrupted homologies, as demonstrated for deletionsin bacteria (Farabaugh et al. 1978; Albertini et al.1982). Moreover, gene ampli®cation events inbacteria are derived from spontaneous duplications(Tlsty et al. 1984). These duplications also occur atshort repeated sequences, even though the duplications

q Blackwell Science Limited Genes to Cells (2000) 5, 425±437 425

Communicated by: Martin Gellert*Correspondence: E-mail: [email protected]

may range in size from 5 kb (Edlund & Normark1981; Whoriskey et al. 1987) to 50 kb (Tlsty et al.1984). The frequency of these duplication/ampli®ca-tion events is dependent upon the extent of the shorthomology (Whoriskey et al. 1987). We have foundthat inversions may also occur at microhomologies,which in this case are short inverted repeats (Scho®eldet al. 1992).

Here, we present a study of E. coli genes involved indetermination of the rate of inversions at short invertedrepeats. Using a strain constructed for detection ofDNA inversions at microhomologies (Scho®eld et al.1992), we de®ned three genetic loci, rmuA, B and C,involved in limiting or enhancing rearrangements, andhave mapped and cloned each of these three loci. ThermuA locus is identical to the sbcC gene, the rmuB locusis upstream of and appears to activate the expression ofrecE, and the rmuC gene encodes a protein of unknownfunction (orf475; Genbank accession numberM87049). The rmuA (sbcC) effect is recA- and recB-dependent. However, the increase of DNA inversionsin rmuB strains is not recB-dependent and is only partlyrecA-dependent. The effect of rmuC on DNA inver-sions is seen only as an enhancer of the rmuA effect inrmuA rmuC double mutants. The single-mutant rmuCphenotype does not differ from the wild-type. We havealso examined the effect of another combination of rmumutations (rmuA, rmuB), which results in an increase inDNA inversions of up to 800 times over the wild-typestrain. This paper presents the ®rst example of an anti-mutator role for the sbcC genes, as was postulated by Leachand co-workers (Leach 1994; Leach et al. 1997), andde®nes a new gene (rmuC) involved in DNArecombination.

Results

Detection and mapping of genes involved in

DNA inversions

We used strain CC215, which we constructed todetect speci®c inversions at microhomologies in thelacZ gene on an F0 plasmid (Scho®eld et al. 1992), tolook for genes involved in DNA rearrangements. Thisstrain can revert from Lacÿ to Lac� by inversion of an800 bp segment ¯anked by 23 bp inverted repeats (Fig.1). Employing mini-Tn10 derivatives (see Experi-mental procedures), we looked for colonies with anincreased rate of inversions. They may be recognizedby the large number of blue papillae growing out ofcolonies on plates containing glucose, X-gal and P-gal(Fig. 2). We then con®rmed the mutator phenotype by

determining the frequency of Lac� reversion in brothcultures plated on lactose minimal medium. Table 1depicts the results. We detected three differentmutations that generate increased DNA inversions.We labelled the loci rmuA, rmuB and rmuC, `rearran-gement mutators'. P1 mapping placed the rmuA locusat 9 min on the E. coli chromosome, rmuB at30±31 min and rmuC at 86 min.

We have physically mapped all three rmu genes. Sincethe mutator phenotype was obtained by mini-Tn10insertions, we could identify the point of insertion byemploying the method of Higashitani et al. (1994),which is based on PCR ampli®cation of the chromo-somal segments ¯anking the Tn10 insertion (seeExperimental procedures).

rmuA

Two rmu mutations were caused by insertion into thesbcC gene, a locus previously described (Lloyd &Buckman 1985; Naom et al. 1989). The mapping wascon®rmed by hybridization to the Kohara library(Kohara et al. 1987). The Kohara clones 143 and 144hybridized to PCR-ampli®ed chromosomal fragments¯anking the rmuA Tn10 insertions. The two Koharaclones overlap in the region of sbcC. Anothercon®rmation came from sequencing the PCR-ampli-®ed fragments with primers complementary to thesequence of Tn10. PCR ampli®cations of the sbcC genefrom wild-type and rmuA strains showed that the DNAof sbcC from rmuA40 is 2.9 kb longer than the DNA ofsbcC from the wild-type strain (data not shown). ThesbcC DNA from rmuA19 is 1.4 kb longer than the sbcCDNA from the wild-type (data not shown). The mini-Tn10-tet used for construction of rmuA40 is 2.9 kb longand the mini-Tn10-cam used for construction ofrmuA19 is 1.4 kb long (Kleckner et al. 1991). The

M M Slupska et al.

426 Genes to Cells (2000) 5, 425±437 q Blackwell Science Limited

Figure 1 System for inversion. The creation of inverted repeats

in lacZ and lacI (A) permits the inversion of an 800 bp segment of

lac, which results in the Lacÿ phenotype (B). Revertants to Lac�

may occur by an inversion at the repeated sequences (C).

exact locations of the mini-Tn10 in the sbcC gene fromrmuA40 and rmuA19 as well as the junction sequenceare shown in Fig. 3.

rmuB

The mutation rmuB54 was generated by an insertion inthe racC locus near the recE gene. The Kohara clone263 hybridized to the PCR ampli®ed fragment fromthe chromosomal DNA ¯anking the rmuB54::Tn10-cam insertion. Sequencing the ampli®ed segmentrevealed the junction sequence shown in Fig. 3. Thefunction of the racC gene is not known, but Clark andco-workers have shown that in-frame fusions of the C-terminal-encoded portion of the recE gene to the N-terminal-encoded portions of the racC gene cansuppress recE mutations (Chu et al. 1989). Insertionsbetween racC and recE as well as point mutationsupstream of racC are also known to activate the recEpromoter (Clark et al. 1994; A.J. Clark, personal

communication). On the other hand, the promoter ofthe gene for chloramphenicol acetyltransferase (cat) inmini-Tn10-cam is a strong promoter and can effecttranscription of the recE gene located downstream fromracC. With a set of PCR DNA ampli®cations usingprimers complementary to the mini-Tn10-camsequence and to the sequence surrounding thermuB54 insertion, we have found that the cat promoterin rmuB54 insertion is in the same orientation as therecE gene (data not shown).

To prove that rmuB54 insertion activates recE, weperformed Northern blot analyses of RNA isolatedfrom the mutator strains, from the wild-type startingstrain CC215, and from the strain expressing recE gene.Using a probe complementary to the recE gene, wedetected recE transcripts only in the rmuB54 strain andin the control strain expressing recE (Fig. 4 lanes 4 and6).

rmuC

We found rmuC68 by screening for mutations thatenhance the effect of rmuA (see Experimentalprocedures). The rmuC68 mutator alone does notincrease the DNA inversion rate, but the level ofinversions in the double mutant rmuC rmuA is elevated15-fold over the rmuA level and 190-fold over thelevel in wild-type (Table 1). We did not ®nd anyparticular phenotype of the strain carrying thermuC68 insertion alone. It grows on minimal andrich medium growing at temperatures from 30 to42 8C and does not display UV or mitomycin Csensitivity. rmuC68 maps at 86.1 min on the E. colichromosome in orf475 (Genbank accessionPID:g148230, protein ID AAC76835.1) next to theudp gene. Kohara clones 550 and 551 hybridized tothe PCR-ampli®ed DNA near the rmuC::Tn10-caminsertion. The two clones overlap in the region of udpand orf475. The PCR ampli®cation of the orf475from the wild strain and rmuC68 showed that DNAfrom the rmuC68 insertion is 1.4 kb longer than DNAfrom the wild-type strain (data not shown). The mini-Tn10-cam used for the construction of rmuC68 is1.4 kb long (Kleckner et al. 1991). The exact locationof rmuC68 Tn10-cam as well as the junction sequenceare shown in Fig. 3. To prove that the mutator effectof rmuC68 comes from knocking out orf475, wecloned the gene encoding orf475 in the over-expressing plasmid pKK388-1 and determinedwhether the resulting plasmid complements theeffect of the rmuC68 insertion. The results arepresented in Table 2. The plasmid over-expressing

Genes involved in DNA inversions


Figure 2 Comparison of the reversion rate of wild-type

(CC215), rmuA40 and rmuA40 rmuC68 strains by papillation

assay. Strains were grown on minimal glucose, X-gal, P-gal plates.

M M Slupska et al.


Table 1 Effects of rmuA, B and C mutators on frequency of DNA inversions as determined by Lac� revertant frequency in the strain CC215.

Strain Mutation rate per 95% con®dence Approximate fold increase

replication (´ 10ÿ9) limits (´ 10ÿ9) relative to wt

1. wild-type (CC215) 4.3 4.0, 5.3 1

2. recA 0.0 0.0, 0.08 0

3. recB 0.15 0.0, 0.62 0.035

4. rmuA19 33 20, 47 8

5. rmuA19 recA 0.14 0.07, 0.5 0.032

6. rmuA19 recB 4.6 0.0, 13.0 1

7. rmuB54 550 440, 670 130

8. rmuB54 recA 52 7.1, 120 12

9. rmuB54 recB 790 360, 1200 180

10. rmuC68 3.0 1.9, 5.9 0.7

11. rmuC68 recA 0.0 0.0, 0.09 0

12. rmuC68 recB 0.0 0.0, 0.5 0

13. rmuA40 54 52, 85 13

14. rmuC68 3.0 1.9, 5.9 0.7

15. rmuC68 rmuA40 830 660, 1100 190

16. rmuA40 rmuB54 3600 1300, 6200 840

See Experimental procedures for the method of determination of mutation rate per replication. Numbers are rounded to two signi®cant digits

Figure 3 The exact location of mini-Tn10 insertions in the rmu genes and the junction sequences. The sequence in bold represents the

sequence of the gene into which the insertion occurred, whereas the sequence in regular font represents the sequence of Tn10. The

numbers in parentheses show the nucleotide number with numbering relative to the A of the ATG translational start site (�1).

Underlined print shows the sequence of the duplicated 9 bp after Tn10 insertion.

orf475 complements the rmuC68 mutation, andintroduction of this plasmid into the double mutantrmuA40 rmuC68 brings the level of inversions down tothe level of the single rmuA40 mutant (Table 2,compare rows 4 and 8).

When possible, we constructed combinations ofdifferent mutators and determined the respectiveincreases in rearrangements. Table 1 shows the effectsof these different mutations on inversions. The highestrate is seen in the double mutant rmuA rmuB, an increaseof 800-fold over the wild-type strain.

We have also investigated the effects of certain recalleles which lower the reversion rate in the wild-type(Scho®eld et al. 1992). Wild-type cells need the RecAand RecBC proteins for the inversions to occur.There is a striking difference in the effects of recA andrecB defects on rmuA, B and C mutators. Similar tothe wild-type, rmuA requires normal RecA and RecB

proteins to display the elevated inversion rate, whereasinversions in the rmuB are RecB-independent andonly slightly affected by loss of RecA. In fact, thermuB recB double mutant seems to have a higherinversion rate than the rmuB mutant alone (Table 1),and displays earlier papillation (data not shown). rmuCshows the same pattern as the wild-type, and does notincrease the inversion rate (Table 1). Double mutantsrmuB recA and rmuA recB gave small colonies and lowertitre (data not shown); in addition, rmuA recB(sbcC,recB) mutants rapidly accumulate fast-growingsuppressors, but these suppressors have the sameinversion levels as small colonies of the rmuA recBstrain (data not shown).

Discussion

In this work, we have found three genetic loci, rmuA,



Figure 4 Northern blot analysis of RNA

isolated from the wild-type, mutator and

the control strain expressing recE (sbcA23).

(a) Loading control: 10 mg of RNA

isolated from wild-type and mutator cells

was separated on 1% formaldehyde±agar-

ose gel for 16 h at room temperature at

1.5 V/cm and transferred to a nitrocellu-

lose membrane. (b) Hybridization of the

blot. The blot was hybridized to a probe

complementary to the ®rst 700 nucleotides

from recE gene. Lanes: 1, RNA ladder; 2,

wild-type; 3, rmuA19; 4, rmuB54; 5,

rmuC68; 6, sbcA23. The position of recE

transcripts, 23S, 16S and size of molecular

standards are marked on the sides.

Table 2 Complementation of rmuC68 and rmuA40rmuC68 by orf475 cloned into pKK388-1.

Strain Mutation rate per 95% con®dence Approximate fold increase

replication (´ 10ÿ9) limits (´ 10ÿ9) relative to wt

1. wt (CC215) ´ pKK 388-1 2.1 1.1, 3.2 1

2. rmuA40 ´ pKK 388-1 20 15, 24 10

3. rmuC68 ´ pKK 388-1 2.5 1.9, 5.6 1

4. rmuA40 rmuC68 ´ pKK 388-1 2100 950, 3600 1000

5. wt (CC215) ´ orf475/pKK 388-1 1.1 0.75, 1.6 1

6. rmuA40 ´ orf 475/pKK 388-1 15 10, 19 13

7. rmuC68 ´ orf 475/pKK 388-1 1.6 1.3, 3.6 1

8. rmuA40 rmuC68 ´ orf 475/pKK 388-1 20 11, 42 18

See Experimental procedures for the method of determination of mutation rate per replication. Numbers are rounded to two signif-

icant digits

B and C, involved in preventing DNA inversions atshort inverted repeats. Two of them were mapped toknown genes involved in DNA recombination. ThermuA locus is identical to the sbcC gene. sbcC wasinitially detected as one of the suppressor mutationsthat, together with sbcB, can restore recombination inrecB,C strains by activation of the recF pathway(Barbour et al. 1970; Templin et al. 1972; Lloyd &Buckman 1985; Gibson et al. 1992). The sbcC geneforms an operon with sbcD (Naom et al. 1989), andmutations in either of these genes facilitate thepropagation of replicons with long palindromes thatare unstable in wild-type strains (Chalker et al. 1988;Gibson et al. 1992). Both genes were cloned andexpressed (Connelly et al. 1997); it was shown thatSbcCD protein forms a complex with ATP-depen-dent double-stranded DNA exonuclease and ATP-independent single-stranded endonuclease activities(Connelly & Leach 1996; Connelly et al. 1997).The SbcCD protein cleaves hairpin DNA (Connellyet al. 1998), but replication is required before it canrecognize DNA palindromes (Lindsey & Leach 1989).The minimum stem length required by the SbcCDprotein for hairpin endonuclease activity is between 8and 16 bp (Connelly et al. 1999). These observationsled to a proposal that SbcCD collapses replicationforks by attacking hairpin structures that arise onlagging-strand templates, and that broken replicationforks are repaired by homologous recombination(Connelly & Leach 1996). Our work demonstratesthat inversions at small inverted repeats are elevated instrains lacking the SbcC protein. Therefore, it may bethat some intermediate involved in generating inver-sions at short inverted repeats employs a structure thatis normally cleaved by the SbcCD protein.

Another locus involved in DNA inversions, rmuB,activates the RecE protein, exonuclease VIII (Joseph& Kolodner 1983). The recE gene product is an ATP-independent exonuclease that degrades linear double-stranded DNA in the 50 to 30 direction, and degradessingle-stranded DNA at low rates (Joseph & Kolodner1983). The RecE protein is expressed together withthe RecT protein (Luisi-DeLuca et al. 1988), a DNA-pairing protein capable of promoting recombinationby a DNA strand invasion mechanism (Noirot &Kolodner 1998). Expression of the RecE and RecTproteins (the RecE pathway) restores recombinationin recB,C strains (Clark 1974). We ®nd that inducedtranscription of the recE gene causes a large increase inthe rate of inversions at short inverted repeats (130-fold over the wild-type, Table 1), but even morestriking is the effect seen in the double mutant

rmuA rmuB (Table 1). The double mutant, which lacksthe SbcC protein and has the RecE pathway induced,has more than a 800-fold increased inversion ratecompared to the wild-type.

The third gene whose function is involved inpreventing DNA inversions, rmuC, encodes anunknown protein, orf475 (Genbank accessionPID:g148230). BLAST and PSI-BLAST searches (Altschulet al. 1997) revealed no signi®cant homology to anyknown protein. Best®t pairways analysis (GCG 1991)of the RmuC polypeptide sequence with over 30protein sequences representing best PSI-BLAST hits,showed a weak homology to coiled-coil domains ofmotor protein myosins (between 20 and 25% aminoacid identity). In addition to the homology todifferent myosins, Best®t analysis revealed a weakhomology of RmuC to human Rad50 protein (26.7%amino acid identity), and also to the centrosomeprotein pericentrin (approximately 24% amino acididentity) and nuclear mitotic apparatus proteins(NuMA, approximately 23% amino acid identity).Both NuMA and pericentrin are involved in spindlepole formation in eukaryotes (reviewed in Merdes &Cleveland 1997). There was also limited homology ofthe orf475 to the middle part of the SbcC protein(26% amino acid identity measured by Best®t),although this homology was missed by BLAST analysis.Rad50 shares a weak homology (20% by Best®t) tothe SbcC protein (Sharples & Leach 1995), and theyshare more extensive homology at the N- and C-terminal ends, which are responsible for the nucleaseactivity. These parts are missing in the orf475. Rad50,together with the MRE11 protein, has been shown toplay a role in S. cerevisiae nonhomologous DNA endjoining (Moore & Haber 1996; Tsukamoto et al.1996). The human Rad50-MRE11-p95 complexpossesses an endonuclease activity and a 30 to 50

exonuclease activity (Paull & Gellert 1998; Trujillo etal. 1998). In conjunction with a DNA ligase, MRE11promotes joining of noncomplementary ends in vitroby utilizing short homologies (1±5 bp) near the endsof DNA fragments (Paull & Gellert 1998). Rad50 andSbcCD belong to the family of structural maintenanceof chromosome proteins (SMC). Other members ofthe SMC family are also on the BLAST list of RmuCpotential homologues. SMC proteins have beenimplicated in mitotic chromosome condensation andsegregation, sister chromatid cohesion, gene dosagecompensation, and DNA recombination (Koshland &Strunnikov 1996; Jessberger et al. 1998; Hirano 1999).The similarity of SMC proteins to motor proteinssuch as kinesin and myosin has been noted (Strunnikov

M M Slupska et al.


et al. 1993). Both a tethering function (similar to achromatin clamp) and DNA motor functions havebeen proposed for the SMC family (Peterson 1994;Gasser 1995).

Considering the homology and phenotype of thermuC gene, we suspect that the protein encoded byorf475 is either a structural protein that protects DNAagainst nuclease action, or is itself involved in DNAcleavage at the regions of DNA secondary structures.However, a detailed explanation of its function requiresfurther biochemical studies.

The functions encoded by rmuA, B and C seem tobelong to different biochemical pathways. While theeffect of the rmuA(sbcC) mutant is limited only toDNA inversions, rmuB(recE) also in¯uences DNAdeletions at short homologies (data not shown). ThermuA(sbcC) and rmuB(recE) pathways are also differentwith regard to the requirement for RecA and RecBproteins. rmuA strains need the RecA and RecBproteins to display an increase in inversion, whereasthe inversion rate in rmuB(recE) is completelyindependent of RecB and only slightly dependenton RecA.

Based on the above results, the mechanism for DNAinversions at short inverted microhomologies shouldcontain the following elements:1 involvement of the RecA and RecB proteins,2 DNA structure that could be a substrate for theSbcCD nuclease,3 dependence of the sbcCÿ effect on the RecA andRecB proteins, and

4 independence of the recE effect from the recA and recBgenes.

To date, two mechanisms that satisfy these require-ments have been proposed. One is shown in Fig. 5 anddescribed below in more detail. The other mechanismwas proposed by Dr D.R.F. Leach (personal commu-nication) and will be described here only brie¯y since itis a continuation of the model for the formation ofdirect and inverted repeats (DIR) presented in Fig. 6 inPinder et al. (1997) and the model for secondarystructure repair by homologous recombination pre-sented in Fig. 1 in Leach et al. 1997. The majordifferences between the two models are the place andtime of secondary structure formation and the role ofRecBCD and RecE proteins. Dr Leach, in line with ahypothesis that SbcCD enzyme cleaves the secondarystructures formed during DNA replication, proposesthat the inversion of the DNA fragment could beexplained by two strand slippages in the replicationforks. The strand slippages are possible because of thepalindromic hairpin formation within the invertedrepeats on DNA strands displaced during replication.The ®rst strand slippage, from leading to laggingstrands at the inverted repeats, followed by backwardssynthesis of the spacer on the lagging strand, and thesecond strand slippage, back on to the leading strand,with continuation of DNA synthesis on the leadingstrand, may result in the inversion of a DNAfragment between the repeats, without participationof recombination proteins. The requirement for theRecA, RecBCD (and RecE) proteins comes at a



Figure 5 Proposed mechanisms of DNA inversions (see details in the text). Dashed lines and open letters symbolize the newly

synthesized DNA. For clarity, the proper orientation within the lac operon is shown.

later step because of their need to perform RecA-RecBCD-mediated repair of the broken replicationfork (Asai & Kogoma 1994; Kuzminov & Stahl1999).

In the model shown in Fig. 5, we propose that theproteins involved in recombination (RecA, RecBCDand RecE) are directly involved in the formation ofstructures that can be cleaved by SbcCD nuclease,which if not removed, can lead to DNA inversion. Asin the case of the double-stranded break repair modelof homologous recombination (Resnick 1976; Szostaket al. 1983), the DNA inversion at short invertedrepeats would start with an accidental double-strandedbreak in the region of inverted repeats (Fig. 5a). In E.coli cells the enzyme essential for the recombinationalrepair of DNA double-stranded breaks is theRecBCD protein (Skalka 1974; Sargentini & Smith1986; Asai & Kogoma 1994). The RecBCD complex(exonuclease V) is a multi-functional enzyme posses-sing DNA helicase, DNA-dependent ATPase, ATP-dependent exonuclease and ATP-stimulated endonu-clease activities. It acts as an initiator of homologousrecombination by producing a suitable single-strandedDNA for the RecA protein (for review seeKowalczykowski et al. 1994; Bianco et al. 1998).The RecBCD binds tightly to a double-strandedDNA end (Taylor & Smith 1995a), and, in thepresence of co-factors ATP and Mg2�, rapidlyunwinds the DNA (Taylor & Smith 1980) until itencounters the properly orientated sequence ÿ Chi ÿthat modi®es its activity. The reaction catalysed by theRecBCD enzyme in vitro depends on the conditionsused in the experiment. When Mg2� > ATP, theRecBCD acts as a potent exonuclease whose 30 to 50

exonuclease activity is attenuated on encountering theChi, and a 50 to 30 exonuclease activity is up-regulated(Dixon & Kowalczykowski 1993). WhenATP > Mg2�, the RecBCD enzyme unwinds DNAuntil it reaches a properly oriented Chi, and cuts thestrand that was 30 at the entry point without digestingit (Taylor & Smith 1995b). Currently there are noavailable accurate measurements of free Mg2� levels inthe cell (Taylor & Smith 1995b and referencestherein), although they are generally thought to beat low levels closer to conditions where RecBCDdoes not destroy the 30 end. This end could be usedby RecA in its search for homology. In the case ofDNA inversions in the model shown in Fig. 5, thenearest homology is in the region of the invertedrepeat. The RecA protein could then anneal theexposed 30 end to its complementary sequencethrough strand invasion and D-loop formation (Fig.

5b). The inverted repeat in our system is 23 bp long.The shortest homology needed for the ef®cientRecA-mediated recombination in vivo was shown tobe between 23 bp (Shen & Huang 1986) and 40 bp(King & Richardson 1986), but recombinationfacilitated by RecA has been noted for homologylower than 13 bp (King & Richardson 1986). In vitro,the homology needed for RecA-mediated annealingwas shown to be 8 bp (Hsieh et al. 1992) or 15 bp(Tracy & Kowalczykowski 1996). After the initialannealing in the region of inverted repeats, strandexchange cannot proceed through branch migrationsince the homology ends after the inverted repeat. Onthe other hand, the 30 end can be extended by DNApolymerase as in the case of recombination-dependentreplication or inducible stable DNA replication(iSDR) (Masai et al. 1994; Asai & Kogoma 1994;Fig. 5b). If the strand displaced by the RecA proteinis also nicked and RecA anneals the 30 end of thisnicked strand to its complementary sequence in theinverted repeat (Fig. 5c), one can speculate that DNAsynthesis will proceed with a switch of templates asshown in Fig. 5c,d. A similar mechanism ofextension/dissociation/re-annealing or intermolecularstrand switch has been proposed to account fordifferences in the frequency of correction of thequasi-palindrome occurring in the leading or laggingstrand (Rosche et al. 1997). Degradation of displacedsingle strands of DNA (Fig. 5d) and gap ®lling (Fig.5e) would complete the inversion of the DNAfragment between the repeats.

In wild-type cells, one of the enzymes that preventsthe DNA inversion described above from occurringmay be SbcCD nuclease, since the structure shown inFig. 5b might be a substrate for this enzyme. TheSbcCD nuclease has been shown to cleave a variety ofsubstrates, including hairpins and 50 single-strandedoverhangs (Connelly et al. 1999). Although cleavageof the D-loop by SbcCD nuclease has not beentested, SbcCD degradation of the hairpin with single-stranded ends (Figs 5 in Connelly et al. 1999) and 50

single-stranded overhangs justi®es the presentedhypothesis. Participation of the SbcCD protein incleavage of the structure shown in Fig. 5b couldexplain why the rmuA mutants display elevated levelsof DNA inversions but are RecA- and RecB-dependent. On the other hand, in the case of thermuB strains, the RecE (exonuclease VIII) and RecTproteins are expressed. These proteins can promoteRecA-independent double-stranded break repair(Kusano et al. 1994). The RecE protein is anexonuclease that preferentially degrades linear duplex

M M Slupska et al.


DNA in the 50 to 30 direction (Joseph & Kolodner1983). The RecT protein is capable of promotingrecombination by a DNA strand invasion mechanism(Noirot & Kolodner 1998). The length of homologyrequired for the RecT annealing activity is notknown at present. In the model shown here, theRecE exonuclease could partially degrade the 50 endat the double-stranded break to expose the 30 end forRecT-promoted strand invasion in the region ofother inverted repeats (Fig. 5b). This would explainthe independence of the rmuB effect from the recAand recB genes. The small increase in DNAinversions displayed by the double mutantrecB rmuB54, in comparison to the singlemutant rmuB54, may be due to competitionbetween the RecBCD and the RecE proteins forends at double-stranded breaks.

Experimental procedures

Bacterial strains and reagents

Escherichia coli CC215 has been described by Scho®eld et al.

(1992). The strain carries an 800 bp Lacÿ inversion ¯anked

by 23 bp inverted repeats, on an F0 plasmid (Fig. 1). As a

control strain for recE expression in Northern blot analysis,

we used the strain JC8679 (Fÿ supE44 lacY1 galK2 ara-14 xyl-5

mtl-1thr-1leuB6 proA2 hi-4 arg E3 hi-328 recB21 recC22 sbcA 23

rpsL31 j-1 tsx-33 lÿ [strR]) from ATCC (ATCC number

47001). P1 transductions, lambda phage infections and Hfr

crosses were carried out as described by Miller (1992).

Restriction enzymes and DNA ligase were obtained from

New England Biolabs Inc. (Beverly, Massachusetts, USA). All

enzymes were used under the conditions described by the

manufacturer.

DNA synthesis, sequencing and PCR

ampli®cation of DNA segments

Oligonucleotides were synthesized on a Beckman oligo1000

DNA synthesizer using solid-phase cyanoethyl phosphoramidite

chemistry. All oligonucleotides were de-protected in ammonium

hydroxide and used without further puri®cation.

DNA sequencing was performed using [a-32P] dATP and a

SequiThermTM Cycle Sequencing Kit (Epicentre Technologies,

Madison, Wisconsin, USA) with reagents supplied by the

manufacturer. The conditions for PCR ampli®cations of DNA

fragments were as described by Higashitani et al. (1994). Taq

DNA polymerase was obtained from Gibco BRL Life Technol-

ogies Inc. (Gaithersburg, Maryland, USA).

Detection of rmuA and rmuB

We employed mini-Tn10 derivatives to generate insertions into

or near the genes involved in limiting rearrangements. The work

proceeded according to the following steps.

CC215 was infected with lambda phage derivatives carrying

either a mini-Tn10tet or a mini-Tn10cam. To detect mutators,

we used the medium described by Nghiem et al. (1988) that

identi®es mutants as colonies with a speci®cally high number

of blue lac� papillae. Either tetracycline-resistant (Tetr) or

chloramphenicol-resistant (Camr) colonies were grown on

plates containing 5-chloro-4-bromo-indolyl-b,D-galactoside

(X-gal), phenyl-b,D-galactoside (P-gal), glucose and the respective

antibiotic. After several days, colonies with Lac� revertants gave

rise to blue microcolonies, or papillae, on this medium (Fig.

2).

Colonies with more papillae than the starting strain were

candidates for mutators, or strains with a higher than normal level

of inversions at short inverted repeats. These colonies were

picked, re-puri®ed and re-tested, both on the same medium and

on lactose minimal plates to quantify the level of inversions that

restored the Lac� phenotype.

P1 transduction was used to show that the insertion

disrupted a gene or genetic region involved in rearrange-

ments. P1 lysates made on the mutator strains were used to

transduce the starting strain to either Tetr or Camr, and the

transduced strain was then tested to determine whether the

mutator phenotype was linked to the antibiotic resistance

marker. In all cases, the linkage was 100%, showing that the

Tetr or Camr marker was in the gene affecting rearrangement

frequencies.

The antibiotic resistance marker was then mapped by a

combination of Hfr crosses and P1 transduction.

Detection of rmuC

We started out with a strain carrying a mini-Tn10tet insertion in

the rmuA gene, rmuA40, and sought additional mutations that

would result in further increases in the rate of inversions. This

was carried out as follows.

Cells were infected with a lambda derivative carrying a mini-

Tn10cam, and then plated on the same medium described above.

Colonies with higher papillation rates than the starting strain

with rmuA40 were picked, puri®ed and re-tested.

P1 transduction was used to transfer the Camr marker into

both the starting strain, and a wild-type derivative of the starting

strain without the rmuA40 mutation.

The rmuC mutation was mapped with Hfr crosses and P1

transduction.

Determination of the frequency of DNA

inversions

Seven to 15 colonies of the appropriate strain were inoculated

into Luria±Bertani medium and grown overnight at 37 8Covernight. Samples were plated on lactose minimal medium and

titres were determined on glucose minimal medium. Frequencies

of mutations were arranged in an ascending order and mutation

rate per replication for median value was calculated by solving the



following equation:

m ln�Nm� � f

where m is the mutation rate per replication, f is the mutant

frequency, and N is the population size (Drake 1991). 95%

con®dence limits for median mutant frequency were estimated

using standard statistical methods, and appropriate limits for mwere calculated by using presented above formula.

Cloning rearrangement mutators

For cloning rearrangement mutators obtained by mini-Tn10

mutagenesis, we employed the method of Higashitani et al. 1994.

The method is based on PCR ampli®cation of the chromosomal

segments ¯anking the mini-Tn10 insertion and consists of the

following steps.

The chromosomal DNA of each mutator strain was isolated

according to standard procedures and digested with Sau3AI

restriction endonuclease. Sau3AI cuts the Tn10 70 nucleotides

from both ends as well as cutting the chromosomal DNA near the

Tn10 insertion.

The digested DNA was circularized by self-ligation and circles

containing the Tn10 fragments were PCR-ampli®ed using

primers complementary to the sequence between the Sau3AI site

and the end of Tn10. The sequence of the primers was ah1:

50GATTTTTACCAAAATCATTAGGGGATTCATC30, ah2: 50C

ATTAAGTTAAGGTGGATACACATCTTG30

The ampli®ed segments of DNA were then sequenced with

primers ah1 and ah2, and also hybridized to membranes with

immobilized DNA of the Kohara library (Takara Shuzo Co. Ltd,

Otsu, Japan). The hybridization was performed according to the

protocols described by the manufacturer.

After localization of the Tn10 in a gene, the primers for PCR

ampli®cation of that gene were made and the DNA was ampli®ed

from both the control strain (CC215) and the mutator strain.

Conditions for PCR ampli®cations of chromosomal DNA

segments were as follows: 25 cycles of 94 8C for 45 s, 52 8C for

30 s and 72 8C for 5 min. We used a hot start to the PCR reaction:

5 min at 94 8C followed by a decrease to 80 8C. In the case of

the mutator strains, the ampli®ed DNA fragment containing the

Tn10 was larger than the fragment from the control strain. The

PCR-ampli®ed fragments were sequenced again, this time using

primers complementary to the sequence of Tn10 or to the

sequence of the gene; and the exact sequence of the junction

between Tn10 and the ¯anking gene was obtained. The

sequences of primers complementary to Tn10 were: for Tn10-

cam: #70 50CGGGTGATGCTGCCAACTTACTGA30 (primer

in the opposite orientation to the cat promoter, with 50 end

located approximately 150 bp from the end of Tn10-cam) and

#71 50CCGCTTATGTCTATTGCTGGTTTA30 (primer in

the same orientation as cat promoter, with the 50 end located

245 bp from the end of Tn10-cam); for Tn10-tet: #87

50ATTTGATCATATGACAAGATGTGT30 (primer comple-

mentary to the inverted repeats on Tn10, with 50 end located

74 bp from the end of the transposome). The sequences of

primers complementary to the E. coli chromosomal DNA were

based on Genbank sequences sbcC (accession no. X15981), racC

(accession no. M24905) and orf475 (accession no. M87049).

RNA isolation and Northern blot analysis of

recE and rmuC (orf475) transcript

RNeasy Total RNA Kit (Qiagen, Chatsworth, California,

USA) was used for RNA isolation from E. coli cells. The RNA

was additionally puri®ed by treatment with RNase-free

DNAase I from Epicentre Technologies (Epicentre Technolo-

gies, Madison, Wisconsin, USA) under the conditions

described by the manufacturer. RNA was separated on a 1%

formaldehyde±agarose gel for 16 h at room temperature at

1.5 V/cm and transferred to the nitrocellulose membrane

(Micron Separations Inc. Westborough, Massachusetts, USA).

Transfer and Northern blot were performed according to

Sambrook et al. (1989).

Construction of the plasmid for over-

expression of orf475

We used plasmid pKK388-1 (Clontech Laboratories, Inc. Palo

Alto, California, USA) for cloning. The DNA of orf475 was

PCR-ampli®ed with primers complementary to the sequence

of the gene (accession no. M87049) and ¯anked with the

restriction sites for NcoI and KpnI. The ampli®ed segment of

DNA was cut with the same enzymes, and ligated to the pre-

cut plasmid. The resultant plasmid was sequenced in its cloned

part, to ensure that there were no PCR-introduced point

mutations.

Acknowledgements

The authors would like to thank Dr David R. F. Leach for critical

comments on the manuscript. Tadeusz Slupski is acknowledged

for providing a computer program for the calculation of

mutation rate per replication. This work was supported by a

grant from the National Institutes of Health (GM32184) to

J.H.M.

ReferencesAlbertini, A.M., Hofer, M., Calos, M.P. & Miller, J.H. (1982)

On the formation of spontaneous deletions: the importance ofshort sequence homologies in the generation of largedeletions. Cell 29, 319±328.

Altschul, S.F., Madden, T.L., SchaÈffer, A.A., et al. (1997) GappedBLASTand PSI-BLAST: a new generation of protein databasesearch programs. Nucl. Acids Res. 25, 3389±3402.

Anderson, P. & Roth, J. (1981) Spontaneous tandem duplicationsin Salmonella typhimurium arise by unequal recombinationbetween rRNA (rrn) cistrons. Proc. Natl. Acad. Sci. USA 78,3113±3117.

Asai, T. & Kogoma, T. (1994) D-loops and R-loops: alternativemechanisms for the initiation of chromosome replication inEscherichia coli. J. Bacteriol. 176, 1807±1812.

M M Slupska et al.


Barbour, S.D., Nagaishi, H., Templin, A. & Clark, A.J. (1970)Biochemical and genetic studies of recombination pro®ciencyin Escherichia coli. II. Rec� revertants caused by indirectsuppression of Rec-mutations. Proc. Natl. Acad. Sci. USA 67,128±135.

Bianco, P.R., Tracy, R.B. & Kowalczykowski, S.C. (1998) DNAstrand exchange proteins: a biochemical and physical compar-ison. Frontiers Biosci 3, 570±603.

Bostock, C.J. (1984) Chromosomal changes associated withchanges in development. J. Embryo Exp. Morphol. 83 (Suppl.),7±30.

Chalker, A.F., Leach, D.R.F. & Lloyd, R.G. (1988) Escherichia colisbcC mutants permit the stable propagation of repliconscontaining a long palindrome. Gene 71, 201±205.

Chu, C.C., Templin, A. & Clark, A.J. (1989) Suppression of aframeshift mutation in the recE gene of Escherichia coli K-12occurs by gene fusion. J. Bacteriol. 171, 2101±2109.

Clark, A.J. (1974) Progress toward a metabolic interpretation ofgenetic recombination of Escherichia coli and bacteriophagelambda. Genetics 78, 259±271.

Clark, A.J., Satin, L. & Chu, C.C. (1994) Transcription of theEscherichia coli recE gene from a promoter in Tn5 and IS50. J.Bacteriol. 176, 7024±7031.

Connelly, J.C. & Leach, D.R.F. (1996) The sbcC and sbcD genesof Escherichia coli encode a nuclease involved in palindromeinviability and genetic recombination. Genes Cells 1, 285±291.

Connelly, J.C., de Leau, E., Okely, E. & Leach, D.R. (1997)Overexpression, puri®cation and characterization of theSbcCD protein from E. coli. J. Biol. Chem. 272, 19819±19826.

Connelly, J.C., Kirkham, L.A. & Leach, D.R.F. (1998) TheSbcCD nuclease of Escherichia coli is a structural maintenance ofchromosomes (SMC) family protein that cleaves hairpinDNA. Proc. Natl. Acad. Sci. USA 95, 7969±7974.

Connelly, J.C., de Leau, E.S. & Leach, D.R.F. (1999) DNAcleavage and degradation by SbcCD protein complex fromEscherichia coli. Nucl. Acids Res. 27, 1039±1046.

Darras, B.T., Blattner, P., Harper, J.F., Spiro, A.J., Alter, S. &Francke, U. (1988) Intragenic deletions in 21 Duchennemuscular dystrophy (DMD)/Becker muscular dystrophy(BMD) families studied with the dystrophin cDNA: locationof breakpoints on HindIII and BglII exon-containing fragmentmaps, meiotic and mitotic origin of the mutations. Am. J.Hum. Genet. 43, 620±629.

Dixon, D.A. & Kowalczykowski, S.C. (1993) The recombinationhotspot x is a regulatory sequence that acts by attenuating thenuclease activity of the E. coli RecBCD enzyme. Cell 73,87±96.

Drake, J.W. (1991) A constant rate of spontaneous mutation inDNA-based microbes. Proc. Natl. Acad. Sci. USA 88,7160±7164.

Edlund, T. & Normark, S. (1981) Recombination between shortDNA homologies causes tandem duplication. Nature 292,269±271.

Farabaugh, P.J., Schmeissner, U., Hofer, M. & Miller, J.H. (1978)Genetic studies of the lac repressor. VII. On the molecularnature of spontaneous hotspots in the lacI gene of Escherichiacoli. J. Mol. Biol. 126, 847±857.

Gasser, S.M. (1995) Coiling up chromosomes. Curr. Biol. 5,357±360.

GCG (1991) Program Manual for the GCG Package 7th edition.Genetic Computer Group (GCG), Madison, WI.

Gibson, F.P., Leach, D.R. & Loyd, R.G. (1992) Identi®cation of

sbcD mutation as cosuppressors of recBC that allow propagationof DNA palindromes in Escherichia coli K-12. J. Bacteriol. 174,1222±1228.

Golden, J.W., Mulligan, M.E. & Haselkorn, R. (1987) Differentrecombination site speci®city of two developmentally regu-lated genome rearrangements. Nature 327, 526±529.

Haber, J.E. (1983). Mating-type genes of Saccharomyces cererisiae.In: Mobile Genetic Elements (ed. J.A. Shapiro), pp. 560±619.New York: Academic Press.

Higashitani, A., Higashitani, N., Yasuda, S. & Horiuchi, K.(1994) A general and fast method for mapping mutations onthe Escherichia coli chromosome. Nucl. Acids Res. 22,2426±2427.

Hirano, T. (1999) SMC-mediated chromosome mechanics: aconserved scheme from bacteria to vertebrates? Genes Dev. 13,11±19.

Horns, R.C.J., Dower, W.J. & Schimke, R.T. (1984) Geneampli®cation in a leukemic patient treated with methotrexate.J. Clin. Oncol. 2, 2±7.

Hsieh, P., Camerini-Otero, C.S. & Camerini-Otero, R.D.(1992) The synapsis event in the homologous pairing ofDNAs: RecA recognizes and pairs less than one helical repeatof DNA. Proc. Natl. Acad. Sci. USA 89, 6492±6496.

Jessberger, F., Frei, C. & Gasser, S.M. (1998) Chromosomedynamics: the SMC protein family. Curr. Opin. Genet. Dev. 8,254±259.

Joseph, J.W. & Kolodner, R. (1983) Exonuclease VIII ofEscherichia coli. II. Mechanism of action. J. Biol. Chem. 258,10418±10424.

King, S.R. & Richardson, J.P. (1986) Role of homology andpathway speci®city for recombination between plasmids andbacteriophage l. Mol. Gen. Genet. 204, 141±147.

Kleckner, N., Bender, J. & Gottesman, S. (1991) Uses of transposonswith emphasis on Tn10. Meth. Enzymol. 204, 139±180.

Kohara, Y., Akiyama, K. & Isono, K. (1987) The physical map ofthe whole E. coli chromosome: application of a new strategyfor rapid analysis and sorting of a large genomic library. Cell50, 495±508.

Kornreich, R., Bishop, D.F. & Desnick, R.J. (1990) Alpha-galactosidase A gene rearrangements causing Fabry disease.Identi®cation of short direct repeats at breakpoints in an Alu-rich gene. J. Biol. Chem. 265, 9319±9326.

Koshland, D. & Strunnikov, A. (1996) A mitotic chromosomecondensation. Annu. Rev. Cell. Dev. Biol. 12, 305±333.

Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder,S.D. & Rehrauer, W.M. (1994) Biochemistry of homologousrecombination in Escherichia coli. Microb. Rev. 58, 401±465.

Kusano, K., Takahashi, N.K., Yoshikure, H. & Kobayashi, I.(1994) Involvement of RecE exonuclease and RecTannealingprotein in DNA double-strand break repair by homologousrecombination. Gene 138, 17±25.

Kuzminov, A. & Stahl, F.W. (1999) Double-strand end repair viathe RecBC pathway in Escherichia coli primes DNA replica-tion. Genes Dev. 13, 345±356.

Leach, D.R.F. (1994) Long palindromes, cruciform structures,genetic instability and secondary structure repair. Bioessays 16,893±900.

Leach, D., Okely, E. & Pinder, D. (1997) Repair by recombina-tion of DNA containing a palindromic sequence. Mol.Microbiol. 26, 597±606.

Leder, P., Battey, J., Lenoir, G., et al. (1983) Translocations amongantibody genes in human cancer. Science 222, 765±771.



Lindsey, J.C. & Leach, D.R.F. (1989) Slow replication ofpalindrome-containing DNA. J. Mol. Biol. 206, 779±782.

Lloyd, R.G. & Buckman, C. (1985) Identi®cation and geneticanalysis of sbcC mutations in commonly used recBC sbcB strainsof Escherichia coli K-12. J. Bacteriol. 164, 836±844.

Luisi-DeLuca, C., Clark, A.J. & Kolodner, R.D. (1988)Analysis of the recE locus of Escherichia coli K-12 by usingpolyclonal antibodies to exonuclease VIII. J.Bacteriol. 170,5797±5805.

Mahan, M.J. & Roth, J.R. (1989) Role of recB,C in formation ofchromosomal rearrangements: a two-step model for recombi-nation. Genetics 121, 433±443.

Marx, J.L. (1984) Oncogenes ampli®ed in cancer cells. Science223, 40±41.

Masai, H., Asai, T., Kubota, Y., Arai, K.-i. & Kogoma, T.(1994) Escherichia coli PriA protein is essential for inducibleand constitutive stable DNA replication. EMBO J. 13,5338±5345.

Merdes, A. & Cleveland, D.W. (1997) Pathways of spindle poleformation: different mechanisms; conserved components. J.Cell Biol. 138, 953±956.

Miller, J.H. (1992) A short course in bacterial genetics. Alaboratory manual and handbook for Escherichia coli and relatedbacteria. Cold Spring Harbor, New York: Cold Spring HarborLaboratory Press.

Moore, J.K. & Haber, J.E. (1996) Cell cycle and geneticrequirements of two pathways of nonhomologous end-joiningrepair of double-strand breaks in Saccharomyces cerevisiae. Mol.Cell. Biol. 16, 2164±2173.

Naom, I.S., Morton, S.J., Leach, D.R.F. & Lloyd, R.G. (1989)Molecular organisation of sbcC, a gene that affects geneticrecombination and viability of DNA palindromes in Escherichiacoli K-12. Nucl. Acids Res. 17, 8033±8045.

Nghiem, Y., Cabrera, M., Cupples, C.G. & Miller, J.H. (1988)The mutY gene: a mutator locus in Escherichia coli that generatesGC ! TA transversions. Proc. Natl. Acad. Sci. USA 85,2709±2713.

Noirot, P. & Kolodner, R.D. (1998) DNA strand invasionpromoted by Escherichia coli RecT protein. J. Biol. Chem. 273,12274±12280.

Paull, T.T. & Gellert, M. (1998) The 30 to 50 exonuclease activityof Mre11 facilitates repair of DNA double-strand breakes. Mol.Cell 1, 969±979.

Peterson, L.C. (1994) The SMC family: novel motor proteins forchromosome condensation? Cell 79, 389±392.

Pinder, D.J., Blake, C.E. & Leach, D.R.F. (1997) DIR: a novelDNA rearrangement associated with inverted repeats. Nucl.Acids Res. 25, 523±529.

Resnick, M.A. (1976) The repair of double-strand breaks in DNA:a model involving recombination. J. Theor. Biol. 59, 97±106.

Riley, M. & Anilionis, A. (1978) Evolution of the bacterialgenome. Annu. Rev. Microbiol. 32.

Rosche, W.A., Trinh, T.Q. & Sinden, R.R. (1997) Leadingstrand speci®c spontaneous mutation corrects a quasipalin-drome by an intermolecular strand switch mechanism. J. Mol.Biol. 269, 176±187.

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) MolecularCloning. A Laboratory Manual. Cold Spring Harbor, New York:Cold Spring Harbor Laboratory Press.

Sargentini, N.J. & Smith, K.C. (1986) Quantitation of theinvolvement of the recA, recB, recC, recF, recJ, recN, lexA, radA,radB, uvrD and umuC genes in the repair of X-ray-induced

DNA double-strand breaks in Escherichia coli. Radiat. Res. 107,58±72.

Schimke, R.T. (1984) Gene ampli®cation in cultured animalcells. Cell 37, 705±713.

Scho®eld, M.A., Agbunag, R. & Miller, J.H. (1992) DNAinversions between short inverted repeats in Escherichia coli.Genetics 132, 295±302.

Sharples, G. & Leach, D. (1995) Structural and functionalsimilarities between the SbcCD proteins of Escherichia coliand the RAD50 and MRE11 (RAD32) recombination andrepair proteins of yeast [Letter]. Mol. Microbiol. 17,1215±1217.

Shen, P. & Huang, H.V. (1986) Homologous recombination inEscherichia coli: dependence on substrate length and homology.Genetics 112, 441±457.

Shoffner, J.M., Lott, M.T., Voljavec, A.S., Soueidan, S.A.,Costigan, D.A. & Wallace, D.C. (1989) Spontaneous Kearns±-Sayre/chronic external ophthalmoplegia plus syndrome asso-ciated with a mitochondrial DNA deletion: a slip-replicationmodel and metabolic therapy. Proc. Natl. Acad. Sci. USA 86,7952±7956.

Silverman, M. & Simon, M. (1983) Phase variation and relatedsystems. In: Mobile Genetic Elements (ed. J.A. Shapiro), pp.537±557. New York: Academic Press.

Skalka, A. (1974) A replicator's view of recombination (andrepair). In: Mechanisms in Recombination (ed. F.R. Grell), pp.421±423. New York: Plenum Press.

Stoppa-Lyonnet, D., Carter, P.E., Meo, T. & Tosi, M. (1990)Clusters of intragenic Alu repeats predispose the human C1inhibitor locus to deleterious rearrangements. Proc. Natl. Acad.Sci. USA 87, 1551±1555.

Stragier, P., Kunkel, B., Kroos, L. & Losick, R. (1989)Chromosomal rearrangement generating a composite genefor a developmental transcription factor. Science 243,507±512.

Strunnikov, A., Larionov, V.L. & Koshland, D. (1993) SMC1: anessential yeast gene encoding a putative head±rod±tail proteinis required for nuclear division and de®nes a new ubiquitousprotein family. J. Cell Biol. 123, 1635±1648.

Szostak, J.W., Orr-Weaver, T.L., Rothstein, R.J. & Stahl, F.W.(1983) The double-strand break repair model for recombina-tion. Cell 33, 25±33.

Taylor, A. & Smith, G.R. (1980) Unwinding and rewinding ofDNA by the RecBC enzyme. Cell 22, 447±457.

Taylor, A.F. & Smith, G.R. (1995a) Monomeric RecBCDenzyme binds and unwinds DNA. J. Biol. Chem. 270,24451±24458.

Taylor, A.F. & Smith, G.R. (1995b) Strand speci®city of nickingof DNA at Chi sites by RecBCD enzyme. J. Biol. Chem. 270,24459±24467.

Templin, A., Kushner, S.R. & Clark, A.J. (1972) Genetic analysisof mutations indirectly suppressing recB and recC mutations.Genetics 72, 205±215.

Tlsty, T.D., Albertini, A.M. & Miller, J.H. (1984) Geneampli®cation in the lac region of E. coli. Cell 37, 217±224.

Tonegawa, S. (1983) Somatic generation of antibody diversity.Nature 302, 575±581.

Tracy, R.B. & Kowalczykowski, S.C. (1996) In vitro selection ofpreferred DNA pairing sequences by the Escherichia coli RecAprotein. Genes Dev. 10, 1890±1903.

Trujillo, K.M., Yuan, S.-S.F., Lee, E.Y.-H.P. & Sung, P. (1998)Nuclease activities in a complex of human recombination and

M M Slupska et al.


DNA repair factors Rad50, Mre11, and p95. J. Biol. Chem.273, 21447±21450.

Tsukamoto, Y., Kato, J.-I. & Ikeda, H. (1996) Effects ofmutations of Rad50, Rad51, Rad52 and related genes onillegimate recombination in Saccharomyces cerevisiae. Genetics142, 383±391.

Whoriskey, S.K., Nghiem, V.H., Leong, P.M., Masson, J.M. &

Miller, J.H. (1987) Genetic rearrangements and gene ampli-®cation in Escherichia coli: DNA sequences at the junctures ofampli®ed gene fusions. Genes Dev. 1, 227±237.

Received: 25 September 1999

Accepted: 15 February 2000



Documents

Genes involved in the determination of the rate of inversions at short inverted repeats