Upload
doannguyet
View
213
Download
0
Embed Size (px)
Citation preview
1
Generation of calves persistently infected with HoBi-like pestivirus and comparison of 1
methods for detection of these persistent infections 2
3
Generation and test of HoBi-like virus PI calves 4
5
F. V. Bauermann#ah, S. M. Falkenbergb, B. Vander Leyc, N. Decarod, B. W. Brodersene, A. 6
Harmonf, B. Hessmang, E. F. Floresh, J. F. Ridpatha 7
8
a Ruminant Disease and Immunology Research Unit, National Animal Disease Center, USDA, 9
Agricultural Research Service, P.O. Box 70, Ames, IA, 50010. 10
b Elanco Animal Health, Vaccine Development, 2500 Innovation Way, Greenfield, IN, 46160. 11
c College of Veterinary Medicine, University of Missouri, Columbia, MO, 65211. 12
d Department of Veterinary Medicine, University of Bari, Valenzano, Italy. 13
e School of Veterinary Medicine and Biomedical Sciences, University of Nebraska, Lincoln, NE 14
68583. 15
f Novartis Animal Health US, Inc., Larchwood, IA, 51241. 16
g Haskell County Animal Hospital LLC, Central States Testing LLC, Sublette, KS 67877. 17
h Department of Preventiva Veterinary Medicine, Federal University of Santa Maria, Santa 18
Maria, Brazil. 19
Fernando V. Bauermann - present address: Ruminant Disease and Immunology Research 20
Unit, National Animal Disease Center, USDA, Agricultural Research Service, P.O. Box 70, 21
Ames, IA, 50010. 22
JCM Accepts, published online ahead of print on 13 August 2014J. Clin. Microbiol. doi:10.1128/JCM.01563-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
2
#Corresponding Author: Dr. Fernando V. Bauermann, USDA, ARS, National Animal 23
Disease Center, 1920 Dayton Avenue, P.O. Box 70, Ames, IA 50010, 24
26
Abstract 27
Identification and elimination of persistently infected (PI) cattle are the most effective 28
measures for controlling bovine pestiviruses, including bovine viral diarrhea virus (BVDV) and 29
the emerging HoBi-like viruses. Here, colostrum deprived HoBi-like PI calves have been 30
generated and sampled (serum, buffy coat, ear notches) at day of birth and weekly for 5 31
consecutive weeks. Samples were assayed by diagnostic tests for BVDV: two reverse 32
transcriptase-polymerase chain reaction (RT-PCR); two commercial real-time RT-PCR (RT-33
qPCR); two antigen capture enzyme-linked immunosorbent assay (ACE) and 34
immunohistochemistry (IHC); and by HoBi-virus specific RT-PCR and RT-qPCR. The rate of 35
false negatives varied from calf to calf. The HoBi-like specific RT-PCR detected 83%, 75% and 36
87% of serum, buffy coat and ear notch samples, respectively, while the HoBi-like RT-qPCR 37
respectively detected 83%, 96% and 62%. In comparison, the BVDV RT-PCR test had a higher 38
rate of false negative in all tissues, especially for ear notches (missing at least 68% of samples). 39
The commercial BVDV RT-qPCRs and IHC detected 100% of ear notches. While ACE based on 40
the BVDV glycoprotein Erns detected at least 87% of ear notches, no samples were detected 41
using NS3 based ACE. The BVDV RT-qPCR, ACE, and the IHC tests yielded higher levels of 42
detection compared to HoBi-like specific assays, although the lack of differentiation between 43
BVDV and HoBi-like viruses would make these tests of limited use in a HoBi-like PI control 44
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
3
and/or surveillance. Improvement of HoBi-like virus tests is required before a reliable HoBi-like 45
PI surveillance program can be designed. 46
47
Key words: Atypical pestivirus, BVDV, diagnostic, transplacental infection. 48
49
50
Introduction 51
Bovine viral diarrhea (BVD) is a widespread disease in cattle, leading to significant 52
economic losses worldwide. The disease is historically associated with the bovine pestivirus 53
species bovine viral diarrhea virus type 1 (BVDV1) and BVDV2 (1, 2). Infection with a putative 54
pestivirus species variously referred as HoBi-like virus, BVDV3 or atypical pestivirus leads to a 55
repertoire of syndromes indistinguishable from BVD. Clinical signs includes upper respiratory 56
disease, fever, transient immune suppression, death among young stock, reproductive loses, and 57
the generation of persistently infected (PI) animals (3-8). 58
Calves born persistently infected with BVDV (BVDV PI) are positive for virus antigen in 59
nearly all tissues, but negative for antibodies against their homologous BVDV, prior to 60
colostrum intake. While some BVDV PI calves have congenital malformations others are 61
clinically normal (1, 9). These animals shed the virus to the environment continuously over their 62
lifetimes (1, 10) and thus play a major role in introducing and maintaining viral circulation in 63
cattle herds (11). 64
The course of uncomplicated acute BVDV infections in adult non-pregnant animals is 65
generally subclinical or clinically mild. As a consequence, the introduction of BVDV PI animals 66
into a naïve herd may goes undetected until an increased rate of reproductive loss is noticed. 67
Hence, the identification and elimination of BVDV PI calves, on the top of adoption of 68
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
4
biosecurity measures that prevent the introduction of BVDV PI animals into herds, is necessary 69
for the control of BVDV (11, 12). 70
Despite BVDV control efforts in several European countries (12), BVDV infections still 71
result in significant economical impact on major cattle markets worldwide (4, 13, 14). In 72
contrast, HoBi-like viruses do not appear to be endemic in all continents. In South America, 73
HoBi-like has been associated with reproductive disorders in Brazilian cattle herds, and death of 74
water buffalos as well (3, 4, 15). In Italy, infection of cattle with HoBi-like virus resulted in 75
abortion, respiratory disease, death of young animals and the birth of PI calves (5, 6, 16). 76
Evidence of HoBi-like virus in Asia has been reported. Although no clinical sign was noted, 77
seroconversion to HoBi-like viruses were observed in some dairy herds in Thailand (17). In 78
Bangladesh, HoBi-like viral sequences were detected in samples from animals that were 79
admitted to veterinary hospitals between the years 2009 and 2010. Although the specific clinical 80
description for each animal was not disclosed, all animals admitted to the hospital displayed at 81
least one of the following clinical signs: diarrhea, respiratory distress and/or fever (18). 82
Limiting the spread of BVDV requires the fast and reliable detection of PI animals. The 83
gold standard test for BVDV PI identification is virus isolation, however this test is labor and 84
time consuming; and the presence of maternal antibodies may lead to false negative results (19, 85
20). The most commonly used tests in systematic controls and eradications strategies worldwide, 86
to detect newborn BVDV PI calves, are the antigen capture enzyme linked immunosorbent 87
assays (ACE) and variations of RT-PCR based tests using skin samples (11, 12). The RT-PCR 88
based tests yield fast results and the interference by maternal antibodies is absence or minimal 89
(20, 21). Another sensitive and specific tool for BVDV detection are immunohistochemistry 90
(IHC) test conducted on skin biopsies collected from the ear. IHC, based on detection of the 91
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
5
viral Erns in ear notch samples has been successfully used for BVDV PI screening (22). However, 92
because this test requires a higher level of expertise in determining results, the test is rarely 93
employed in large scale BVDV control efforts. 94
While the identification a HoBi-like PI calf has been detected in the field (23), there is 95
limited information available regarding HoBi-like PI animal detection. Failure to detect HoBi-96
like PIs and differentiate them from BVDV PIs may lead to underestimation the economic 97
impact of HoBi-like virus infection in cattle, and hamper efforts to detect the introduction of this 98
emerging pestivirus into non-endemic regions. In order to provide initial guidelines toward the 99
development of a HoBi-like surveillance system, the present study generated HoBi-like PI 100
animals under controlled conditions and then compared the detection rate of several tests 101
including BVDV diagnostic tests: two RT-PCR; two commercial RT-qPCR; two ACE and 102
immunohistochemistry. Samples were also tested by a RT-PCR and a RT-qPCR reaction specific 103
for HoBi-like viruses. 104
105
Material and Methods 106
107
Viruses and cells 108
Primary bovine turbinate cells (BTu) with twelve passages or less were used to propagate 109
and titrate the two HoBi-like virus strains used in this study (HoBi_D32/00 and Italy-1/10-1). 110
HoBi_D32/00 was isolated in Germany as a contaminant of a fetal bovine serum lot that 111
originated in South America (7), while the isolate Italy-1/10-1 was identified in an outbreak of 112
respiratory disease in an Italian herd (5). The cells used for virus amplification were grown in 113
minimal essential medium (MEM), supplemented with L-glutamine (1.4 mM), gentamicin (50 114
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
6
mg/l), and 10% FBS; tested free for pestivirus antigen and antibodies respectively by PCR and 115
VNT (24). For virus propagation, 25cm2 flasks containing 70% confluent BTu cell monolayers 116
were inoculated with one of the two HoBi-like strains and incubated at 37 °C for 72–96 h. 117
Following one cycle of freeze and thaw, the suspension was centrifuged for 10 min at 1,000 × g. 118
Supernatants were collected, aliquoted and stored at –70 °C until use. The virus stocks were 119
titrated in 96-well microtiter plates by end point dilution, using immunoperoxidase staining with 120
the anti-E2 monoclonal antibody N2 for endpoint detection of viral antigens as previously 121
described (24). Titers were calculated according to Reed & Muench (1938) and expressed as 122
median tissue culture infective doses (TCID) (25). 123
124
HoBi-like persistently infected calves generation and testing 125
Twelve crossbreed heifers tested negative for BVDV and HoBi-like viruses by virus 126
isolation and RT-PCR were selected (2, 26). These heifers also tested negative for BVDV and 127
HoBi-like virus neutralizing antibodies by virus neutralization test as previously described (27). 128
Estrus synchronization and artificial insemination were performed. Eight pregnant heifers were 129
selected and moved into biosecurity level 3 (BL3) containment around 55 days of gestation, and 130
housed two heifers per room. The animals were infected at around day 70 of gestation by 131
instillation of 2.5ml of infected cell supernatant (105 TCID50/ml) into each nostril. Four heifers 132
(two rooms) were infected with the HoBi-like strain Italy-1/10-1 and four heifers were infected 133
with the strain HoBi_D32/00. Body temperature was continuously monitored for 14 days post 134
infection using intravaginal devices and probes (Advanced Telemetry Systems, Isanti, MN, 135
USA), and recording using a remote system as previously described (28). Twelve temperature 136
readings (temperatures measured and stored every 5 min) were averaged for each hour. Blood 137
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
7
was collected on the 6th day post infection for virus detection. Buffy coats isolated from blood 138
were submitted to RT-PCR using the primer set N2-R5 following the protocol described below. 139
At approximately 75, 100, and 160 days of gestation, blood was collected from the heifers and 140
serum submitted to a third party commercial laboratory for certification of pregnancy status 141
using ELISA (BioPRYN - Bio Tracking LLC, Moscow, ID, USA). Six heifers achieved full 142
term gestation and birth was induced about 10 days prior to the estimated due date. Calves were 143
separated from the dam prior to receiving colostrum and were kept in BL3 containment in 144
individual crates under conditions described previously (29). Calves were housed two per room 145
in two rooms, depending on the viral strain with which they were infected. Animals were 146
handled in accordance with the Animal Welfare Acts Amended (7USC, 2131-2156). Calves were 147
sampled at day of birth (DOB) and all surviving calves were sampled weekly for five 148
consecutive weeks. Samples collected consisted of serum, buffy coat and ear notch. After 149
collection, samples were immediately processed as described below. Serum, buffy coat and ear 150
notch samples were tested using two BVDV RT-PCR and two commercial BVDV RT-qPCR. 151
Ear notches samples were also tested using two BVDV antigen capture enzyme-linked 152
immunosorbent assay (ACE) and IHC. A HoBi-like specific RT-PCR and a HoBi-like specific 153
RT-qPCR were also used to test RNA samples from serum, buffy coat, and ear notches. The 154
identity of the virus infecting the PI calves was confirmed by sequencing products amplified 155
from serum samples using the HoBi-like specific RT-PCR (primers N2-R5) as described below. 156
The PCR products were not cloned but sequenced directly in both directions. All templates were 157
sequenced in duplicate from both directions. Templates were labeled according to 158
manufacturer’s recommendations using commercial available chemistries (Terminator BigDye 159
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
8
v3.1, Invitrogen, Carlsbad, CA) and sequenced (3130xl Genetic Analyzer, Invitrogen, Carlsbad, 160
CA). 161
Tissues collection and preparation 162
For serum, blood was collected in serum separation tubes with gel and clot activator. 163
Buffy coat samples were obtained from whole blood collected in heparin tubes. Tubes were 164
centrifuged at 800 x g for 25 min, buffy coats were separated and collected. Ear skin biopsies 165
were collected using an ear notch punch. Three sets of ear notch samples, from each calf, were 166
collected for each time point. One set of 0.3 cm2 ear notch pieces were individually soaked in 167
500 µl of PBS for 30 min followed by a –20 °C freeze/thaw cycle. Samples prepared using this 168
method will be hereafter called conventionally extracted samples. Aliquots of the PBS that the 169
ear notches had soaked were processed for RNA extraction and ACE. The second set of 0.3 cm2 170
ear notch pieces were individually soaked in a proprietary extraction solution (Bill Hessman - 171
Haskell County Animal Hospital LLC, Central States Testing LLC, Sublette, KS, USA), these 172
samples will be referred as enhanced extracted. Aliquots of enhanced extracted ear notches fluid 173
were used for ACE tests. The third set of ear notches was formalin-fixed, paraffin-embedded and 174
cut at 4μm. These sections were used for IHC testing as described previously (22). 175
RNA extraction 176
For RNA extraction from blood derived samples, a 140 µl aliquot of serum or a 70 µl of 177
aliquot of freeze/thawed buffy coat lysate (added of 70 µl of PBS) was used. For ear notches, 178
140 µl of solution (PBS) from samples conventionally extracted was used. RNA extraction was 179
performed using a robotic workstation (Qiacube, Qiagen, Hilden, Germany) for automated RNA 180
purification by spin-column system (QIAamp Viral RNA Mini Kit, Qiagen, Hilden, Germany) 181
according to the manufacture’s recommendations. The extracted RNA were stored at –70 °C. 182
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
9
Bovine viral diarrhea virus (BVDV) diagnostic tests 183
RT-PCR developed for use in research 184
RNA extracted from serum, buffy coat and ear notch was assayed using two published 185
RT-PCR tests that target the 5’ end untranslated region of the viral genome (5’UTR). 186
These tests previously were shown to detect several species of pestiviruses and frequently are 187
used to generate sequences used in phylogenetic analysis (2, 30). The primer sets used in these 188
two tests, HCV 90-368 and 324-326, will thereafter be referred to as BVDV primers. Reactions 189
were performed as previously described (2, 30). 190
Commercial RT-qPCR assays 191
The RNA samples extracted from the serum, buffy coats and ear notches were also 192
analyzed using two commercially available RT-qPCR assays. The first assay, hereafter-called 193
BVDV RT-qPCR-1 (Bovine Virus Diarrhea RNA test Kit - Applied Biosystems, Life 194
Technologies, Austin, TX, USA), was designed for detection of BVDV RNA extracted from 195
bovine ear notches. The 25 µl-reaction mixture used for the test consisted of 12.5 µl of 2 x RT-196
PCR Buffer, 1 µl of 25x BVDV Primer Probe Mix, 1 µl of of 25x RT-PCR Enzyme Mix and 8 197
µl of extracted RNA. Neither oligonucleotide sequences nor PCR target region are disclosed. 198
The thermal protocol consisted of revere transcription (RT) at 45 °C for 10 min, RT 199
inactivation/initial denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 200
°C for 15 s and annealing-extension at 60 °C for 45 s. The second assay was the Virotype BVDV 201
test Kit (Qiagen, Labor Diagnostik Leipzig GmbH, Leipzig, Germany), hereafter called RT-202
qPCR-2. This assay was designed to detect BVDV in blood, plasma, serum, milk and ear notches 203
samples. The 25 µl-reaction mixture contained 19.75 µl of RT-PCR Mix, 0.25 µl of Enzyme Mix 204
and 5 µl of extracted RNA. Neither oligonucleotide sequences nor PCR target gene were 205
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
10
disclosed by the company. The thermal protocol follows: revere transcription at 50 °C for 20 206
min, RT inactivation/initial denaturation at 95 °C for 15 min, followed by 40 cycles of 207
denaturation at 95 °C for 30 s and annealing at 57 °C for 45 s and extension at 68 °C for 45 s. 208
Antigen capture enzyme linked immunosorbent assays (ACE) on ear notches 209
Aliquots prepared using conventional and enhanced extraction methods were tested using 210
two ACE based tests. The commercial HerdChek BVD Antigen Test Kit (IDEXX Laboratories, 211
Westbrook, ME, USA), was designed to detected epitopes located in the BVDV glycoprotein 212
Erns, and hereafter is referred as Erns ACE. This test was performed in duplicate following the 213
manufacture’s recommendations and the average value of the optical density (OD) was used to 214
calculate the sample to positive (S/P) ratio. Samples with S/P ratio equal or higher 0.3 were 215
considered positive. The second used ACE based test used was developed for use in a private 216
diagnostic laboratory (Haskell County Animal Hospital LLC, Central States Testing LLC, 217
Sublette, KS, USA) and consists of a dual antibody sandwich ACE targeting epitopes in the 218
BVDV non-structural protein NS3. It will here after be referred to as NS3 ACE. Ear notch 219
samples prepared by enhanced extraction were tested by ACE following the protocol described 220
elsewhere (31). 221
Immunohistochemistry on ear notches 222
Slides were deparaffinized and stained on an automated immunohistochemical stainer 223
(Ventana BenchMark ULTRA, Ventana Medical Systems, Inc., Tucson, AZ, USA). Primary 224
antibodies consisted of anti-BVDV Erns monoclonal antibody 15C5 IDEXX Laboratories, 225
Westbrook, Maine, USA (32). Positive and negative controls for BVDV staining consisted, 226
respectively, of a slide containing known positive tissue along with slides of test samples using 227
an irrelevant primary antibody. After deparaffinization on the immunohistochemistry stainer, the 228
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
11
slides were incubated with Protease III (Ventana, Ventana Medical Systems, Inc., Tucson, AZ, 229
USA) for 12 min. Before application of the primary antibody (optimally diluted at 1:5,000), a 230
blocking step using Antibody Diluent (Ventana, Ventana Medical Systems, Inc., Tucson, AZ, 231
USA) for 12 min was performed. Primary antibody incubation was for 45 min at 37 °C. 232
Secondary antibody, alkaline phosphatase, and substrate are proprietary (UltraView Universal 233
Alkaline Phosphatase Red Detection Kit, Ventana Medical Systems, Inc., Tucson, AZ, USA). 234
Tissues were counterstained with hematoxylin for 4 min and covered with glass cover slip for 235
examination. 236
HoBi-like specific RT-PCR and RT-qPCR test 237
The RNA samples extracted from serum, buffy coat, and ear notches were tested using 238
two HoBi-like specific diagnostic tests developed for used in research. Both tests targeted the 239
5’UTR region. The first was a RT-PCR previously used for surveillance of HoBi-like viruses in 240
commercial fetal bovine serum batches (26). Briefly, the reaction employs the primers N2 241
(TCGACGCATCAAGGAATGCCT) and R5 (TAGCAGGTCTCTGCAACACCCTAT). The 242
reaction mix (25 µl total) included 6 µl of total RNA and was prepared using a commercial kit 243
(SuperScript III one-step RT-PCR system with Platinum Taq high fidelity, Invitrogen, Carlsbad, 244
CA, USA) following manufacture’s instructions. The assay included a reverse transcription step 245
at 55 °C for 25 min, followed by 2 min at 94 °C, 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 68 246
°C for 25 s, with a final extension at 68 °C for 5 min. PCR amplicons were detected by 247
electrophoresis in a 1.0% stained (GelRed, Biotium, Hayward, CA, USA) agarose gel with 248
visualization under UV light. The second HoBi-like specific tested was a TaqMan RT-qPCR 249
based test also used in surveillance of clinical and biological samples for HoBi-like viruses (33). 250
The quantitative assay was conducted using the QuantiTect Probe RT-PCR Kit (Qiagen, Hilden, 251
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
12
Germany) in a 25 µl-reaction mixture containing 12.5 µl of 2x QuantiTect Probe RT-PCR 252
Master Mix, 0.25 µl of QuantiTect RT Mix, 600 nM of primers T134-F (5’-253
GACTAGTGGTGGCAGTGAGC-3’) and T220-R (5’-GAGGCATTCCTTGATGCGTC-3’), 254
200 nM of probe T155r-P (6FAM– 5’-ACTCGGGGCTTCGGTGATCCAGGG-3’-BHQ1) and 2 255
µl of RNA. The thermal profile consisted of revere transcription at 50 °C for 30 min, PCR initial 256
heat activation at 95 °C for 15 min, followed by 45 cycles of denaturation at 95 °C for 15 s and 257
annealing-extension at 60 °C for 1 min. 258
259
Results 260
HoBi-like PI calves generation 261
Based on RT-PCR testing using the primers N2-R5, buffy coat samples of all heifers 262
were positive for HoBi-like virus at day 6 post inoculation. ELISA confirmed seven out of eight 263
heifers as pregnant at days 75, 100 and 160 of gestation. One heifer #241, inoculated with 264
HoBi_D32/00 was negative during preg-check on day 75, and no evidence of abortion was found 265
in the pen during the study. Fever was verified in all heifers for at least two days during the first 266
seven days post inoculation. No other clinical signs were observed in the 14 days following virus 267
inoculation. Heifer #622 (inoculated with HoBi_D32/00) aborted around the eighth month of 268
gestation; fetal size was consistent with the gestation period and no malformation was evident. 269
HoBi-like virus was detected in the abdominal fluid of the aborted fetus using RT-PCR with the 270
N2-R5 primer set and fetal ear notch was positive by ACE and IHC (Fig. 1). 271
Parturition on the remaining six pregnant heifers was induced around 10 days before the 272
predicted due date. Calves #105 and #106 were born apparently healthy but died within 36 h of 273
birth. Both calves were born to heifers infected with the isolate Italy-1/10-1 and presented 274
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
13
bloody diarrhea in the 24 h following birth. At necropsy, their abdomen was distended and filled 275
with bloody fluid. Ear notch samples were positive using ACE and IHC (Fig. 1). HoBi-like virus 276
RNA was detected in both calves by RT-PCR using the primer set N2-R5. The four remaining 277
calves were diagnosed as PI animals by consecutive positive results throughout the study as 278
described below. Sequencing of templates of serum samples using the primers N2-R5 confirmed 279
that the virus infecting the PI calves matched the virus with which the dams were inoculated. 280
HoBi-like PI calves tissues testing 281
The results of testing are summarized in Table 1 and Figure 2. Variation in the 282
percentage of correct diagnosis was observed based on the test used, sample, and animal age. 283
The highest detection rate was achieved in ear notches using IHC, and the commercial BVDV 284
RT-qPCR-1 and 2 tests (100% for all ear notch samples in all calves). In contrast, the NS3 ACE 285
did not detect a single positive sample. 286
Bovine viral diarrhea virus (BVDV) diagnostic tests 287
RT-PCR developed for use in research 288
The rate of detection using a BVDV RT-PCR designed to detect a wide range of BVDV (HCV 289
90-368) or a “panpestivirus” test (324-326) were lower than the rate of detection using either of 290
the HoBi-like virus specific RT-PCR based tests. Comparing samples from all tested tissues and 291
time points, the rate of detection ranged from 28% to 83%. The rate of detection varied by calf 292
with the highest rate observed with tissues from calf #104 and the lowest from calf #101. Both 293
of these calves were infected with the HoBi-like strain Italy-1/10-1 (Table 1). The detection of 294
samples from calves infected with the strain Italy-1/10-1 was similar between BVDV RT-PCR-1 295
and 2. In contrast, detection was markedly lower for calves infected with the strain 296
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
14
HoBi_D32/00 using the BVDV RT-PCR-2. This was true with both ear notch and serum 297
samples. 298
Commercial BVDV RT-qPCR assays 299
The commercial BVDV RT-qPCR-1 and 2 detected all tested ear notches. Further, BVDV RT-300
qPCR-2 detected all serum and buffy coat samples. However, the rate of detection was lower on 301
serum and buffy coat samples using BVDV RT-qPCR-1. There was also a marked variation 302
observed in detection among samples from different calves using this test. While the RT-qPCR 303
test detected 61% of samples from calf #101, it detected at least 94% of the samples from the 304
other three PIs (Table 1). 305
Antigen capture enzyme linked immunosorbent assays (ACE) on ear notches 306
The Erns ACE detected all ear notch samples from PIs #102, and #104 but missed the detection of 307
PIs #101 and #103 at day of birth and PI #101 at week 1. Following enhanced extraction, 308
retesting using the same ACE kit, detection was improved with all samples but the ear notch 309
from PI #101 at day of birth (Fig. 2). An increase in the S/P ratio was observed with age using 310
conventional extraction. However, samples subjected to enhanced extraction exhibited a 311
consistent S/P ratio among the tested weeks (Fig. 3). The Erns ACE based tests had a higher 312
detection rate for HoBi-like viruses than BVDV RT-PCR-1 and 2 reactions. Regardless of 313
extraction method, all ear notches samples tested negative using the NS3 ACE (Table 1). 314
Immunohistochemistry on ear notches 315
IHC also detected 100% of ear notches samples. While the IHC and ACE Erns tests employed the 316
same monoclonal antibody (15C5), the detection rate was higher with IHC. Positive structures 317
included the epidermis, hair follicle infundibula, sebaceous glands, and dermal fibrocytes (Fig. 318
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
15
1). The staining pattern observed in ear skin sections from HoBi PI calves was indistinguishable 319
from the staining pattern seen in skin sections from BVDV PI animals. 320
HoBi-like specific RT-PCR and RT-qPCR tests 321
Using a HoBi-like virus specific RT-PCR, the detection of all combined tissues from each calf 322
ranged from 44% (PI #101) to 94% (PIs #102; 103; 104), using the HoBi specific RT-PCR test. 323
The rates of false negative results for each specimen were 25% for buffy coat, 17% for serum, 324
and 13% for ear notch (Table 1). Using the RT-qPCR reaction specific for HoBi-like viruses, the 325
detection ranged from 61% to 89%. The detection failure rate also varied by animal with calf 326
#101 with the highest rate and calf #103 with the lowest rate. While HoBi RT-PCR and RT-327
qPCR had the same level of detection in serum samples (83%), the rate of detection by RT-PCR 328
was lower in buffy coat samples. RT-PCR had a false negative rate of 25% compared to 4% of 329
failure using RT-qPCR. Conversely, using ear notch samples RT-qPCR had a higher false 330
negative rate, 38% versus 12% (Table 1). 331
332
Discussion 333
This study reports the generation and testing of calves persistently infected with HoBi-334
like viral strains under experimental conditions. While the abortion and the death of two 335
newborns cannot be unequivocally ascribed to HoBi-like virus infection, these events are 336
consistent with clinical presentations classically observed with other pestiviruses (1). Although 337
multiple positive tests over time were not possible, the presence of virus in multiple tissues and 338
fluids of these three animals is consistent with persistent infection (1, 9, 10, 23). The four 339
remaining calves were confirmed as persistently infected with HoBi-like viruses based on 340
multiple detections over a period of several weeks. 341
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
16
Both BVDV RT-PCR reactions had a greater number of false negative results compared 342
to HoBi-like virus specific RT-PCR based tests, corroborating with a previous report (26) these 343
results show that these frequently used BVDV tests are not reliable for use in a HoBi-like virus 344
surveillance programs. The number of the false negative results may, in part, be attributed to 345
mismatches between both BVDV primer pairs and HoBi-like virus sequences as previously 346
described (26). In contrast, a higher level of detection was achieved using either of the 347
commercial RT-qPCR tests. While the combination of all sample tissues resulted in a false 348
negative rate of 11% using the BVDV RT-qPCR-1, it should be noted that this test was 349
developed and validated for ear notches samples and the detection rate was 100% for ear notch 350
samples. However, neither test can differentiate between BVDV and HoBi-like virus infections. 351
Thus they are of limited use in a program designed to survey for HoBi-like viruses, requiring 352
additional testing for differentiation. 353
The S/P ratios on the Erns ACE were variable over time in conventionally extracted 354
samples with a trend toward increased S/P ratios with age. As these animals were colostrum 355
deprived, this effect cannot be attributed to the decrease of maternal antibodies. Additionally, 356
Erns ACE detection was improved by the enhanced extraction. Not only by stronger and 357
consistent signal throughout the study, but also by the higher number of positive samples as well. 358
It is unclear whether animals harboring BVDV strains would have a similar pattern of increased 359
S/P ratios when comparing samples from day of birth with samples collected two or more weeks 360
apart. It has been suggested that, for BVDV surveillance programs, testing at birth, before the 361
ingestion of colostrum is optimum (34). The results suggest that surveillance protocols for the 362
detection of HoBi-like viruses, especially for newborns, should include an enhanced extraction 363
step prior ACE Erns testing. Once again, these animals were colostrum deprived and the impact of 364
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
17
maternal antibodies in the tests employed in study cannot be measured. Although, using ACE 365
was reported a decrease of at least 10 fold in Erns titers when comparing samples of animals 366
before and after receiving colostrum; with Erns returning to initial levels three weeks later (21). 367
The ACE NS3 based test did not give a positive result with any of the samples. 368
Previously it has been reported that NS3 specific antibodies are present in BVDV PI calves prior 369
to ingestion of colostrum (21). In addition, in that study, calves presented a fairly stable NS3 370
antibody titer in the first month of age (21). Such antibodies could interfere with tests based on 371
NS3 detection. On the other hand, detection failure may merely correlate to the low/absent 372
antigenic cross reactivity between HoBi-like virus and BVDV within epitopes recognized by the 373
monoclonal antibodies used in this specific NS3 ACE. Some degree of divergences between 374
BVDV and HoBi-like NS3 has been shown by other studies (7, 24). Regardless for the reasons 375
for detection failure, the results presented in this study suggest that using both the Erns and the 376
NS3 ACE in tandem would allow the differentiation of HoBi-like viral infections from BVDV 377
infections for the purposes of preliminary screening. 378
It was observed that while both tests specific for HoBi-like viruses did detect HoBi-like 379
viruses in all calves, in multiple tissues and at multiple time points, neither one had a 100% 380
detection rate. While the HoBi-like strain D32/00 have no sequence mismatch with the primers 381
sequences used for the HoBi-like RT-PCR, there is one mismatch within the reverse primer (R5) 382
for the isolate Italy-1/10-1 (Fig. 4). Comparing sequences of the primers and probe used in the 383
RT-qPCR, both HoBi-like isolates used have mismatches when align with the forward primer 384
(T134-F) and probe (T155r-P) (Fig. 4). As mismatches are not located on the primers and/or 385
probe 3’ end extremity, it may not represent a major issue for the assay, and corroborate with 386
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
18
descriptions of successful detection of these viruses in others studies using these assays (3, 5, 26, 387
35). 388
Detection failure was particularly notable for samples from PI calf #101. Only 44% and 389
61% of these samples were detected using the HoBi-like RT-PCR and RT-qPCR assays, 390
respectively. The reason for reduced detection in this calf could not be deduced from the data 391
collected in this study. Based on simple comparison of Cq values, generated using the two 392
commercial BVDV RT-qPCR tests, the rate of false negative tests did not correlate with lower 393
viral load in the calf (Fig. 2). Neither does it correlate with viral strain, as a higher detection rate 394
was seen for PI calf #104, which was infected with the same strain. Further research is needed to 395
determine the source of the high rate of test failure in some animals. 396
This is the first report of the generation of HoBi-like virus PI calves under experimentally 397
controlled conditions. Further, generation of HoBi PIs was fairly efficient with 4 out of 8 heifers 398
giving birth to clinically normal appearing calves that survived until they were harvested at five 399
months of age for necropsy. Assuming that similar to BVDV PIs, HoBi PIs are efficient for 400
introducing HoBi-like viruses and keeping them in circulation, their detection and removal are 401
important to the control and eradication of this emerging bovine pestivirus (11, 12). While 402
HoBi-like viruses and BVDV species share genetic and antigenic similarities (7, 24), current 403
diagnostic tests designed for BVDV detection fail in detecting and/or differentiating HoBi-like 404
viruses or have decreased sensitivity compared to BVDV detection, which severely limits their 405
usefulness in a HoBi-like virus control program. (24, 26, 27, 33, 35, 36). The inability to 406
differentiate between BVDV and HoBi-like viruses is not critical if it is known that a region in 407
free of HoBi-like viruses. However differentiation is critical to surveillance programs designed 408
to either determine the prevalence of HoBi-like viruses or to monitor if HoBi-like viruses have 409
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
19
entered a region. Differentiation of BVDV and HoBi-like viruses allows determination of 410
ruminant pestivirus prevalence and would be key to developing recommendations for 411
vaccination (no vaccination, vaccination against BVDV only or vaccination against both BVDV 412
and HoBi-like viruses). 413
In summary, the two commercial BVDV RT-qPCR tests and IHC had a 100% accuracy 414
rate for positive ear notch tissue. However, HoBi-like and BVDV infections cannot be 415
differentiated using these tests. RT-PCR based tests for HoBi-like viruses could specifically 416
identify between BVDV and HoBi-like infections but had reduced accuracy compared to IHC 417
and the commercial BVDV RT-qPCR test. Enhanced extraction of samples prior to testing 418
improved detection for ACE Erns based tests. Used in tandem ACE tests designed to detect Erns 419
and NS3 respectively could be used to differentiate HoBi-like virus from BVDV. Improvement 420
on HoBi-like specific diagnostic tests is required before a reliable HoBi-like PI surveillance 421
program can be designed. 422
423
Acknowledgements 424
The authors are most thankful for the help from Brian Conrad, Doug Ewing, Jeremy 425
Spieker, John Kent, Katrina Pile and Jay Steffen for the animal care and collection of samples. 426
To Kathy McMullen and Patricia Federico for technical support as well as Dr.’s Rebecca 427
Madison and Jean Laufer for veterinary services. Thank you Novartis Animal Health for 428
providing animals for the study. Thank you Dr. Stephen Hennart for consulting. 429
430
Declaration of conflicting interests 431
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
20
Disclaimer: Mention of trade names or commercial products in this publication is solely for the 432
purpose of providing specific information and does not imply recommendation or endorsement 433
by the U.S. Department of Agriculture. 434
435
436
References 437
438
1. Baker JC. 1995. The clinical manifestations of bovine viral diarrhea infection. Vet. Clin. 439
North. Am. Food. Anim. Pract. 11:425-445. 440
2. Ridpath JF, Bolin SR, Dubovi EJ. 1994. Segregation of bovine viral diarrhea virus into 441
genotypes. Virology 205:66-74. 442
3. Bauermann FV, Ridpath JF, Weiblen R, Flores EF. 2013. HoBi-like viruses: an 443
emerging group of pestiviruses. J. Vet. Diagn. Invest. 25:6-15. 444
4. Cortez A, Heinemann MB, De Castro AMMG, Soares RM, Pinto AMV, Alfieri AA, 445
Flores EF, Leite RC, Richtzenhain LJ. 2006. Genetic characterization of Brazilian 446
bovine viral diarrhea virus isolates by partial nucleotide sequencing of the 5' -UTR 447
region. Pes. Vet. Bras. 26:211-216. 448
5. Decaro N, Lucente MS, Mari V, Cirone F, Cordioli P, Camero M, Sciarretta R, 449
Losurdo M, Lorusso E, Buonavoglia C. 2011. Atypical pestivirus and severe 450
respiratory disease in calves, Europe. Emerg. Infect. Dis. 17:1549-1552. 451
6. Decaro N, Lucente MS, Mari V, Sciarretta R, Pinto P, Buonavoglia D, Martella V, 452
Buonavoglia C. 2012. Hobi-like pestivirus in aborted bovine fetuses. J. Clin. Microbiol. 453
50:509-512. 454
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
21
7. Schirrmeier H, Strebelow G, Depner K, Hoffmann B, Beer M. 2004. Genetic and 455
antigenic characterization of an atypical pestivirus isolate, a putative member of a novel 456
pestivirus species. J. Gen. Virol. 85:3647-3652. 457
8. Ridpath JF, Falkenberg SM, Bauermann FV, VanderLey BL, Do Y, Flores EF, 458
Rodman DM, Neill JD. 2013. Comparison of acute infection of calves exposed to a 459
high-virulence or low-virulence bovine viral diarrhea virus or a HoBi-like virus. Am. J. 460
Vet. Res. 74:438-442. 461
9. McClurkin AW, Coria MF, Cutlip RC. 1979. Reproductive performance of apparently 462
healthy cattle persistently infected with bovine viral diarrhea virus. J. Am. Vet. Med. 463
Assoc. 174:1116-1119. 464
10. Arenhart S, Bauermann FV, Oliveira SA, Weiblen R, Flores EF. 2009. Shedding and 465
transmission of bovine viral diarrhea virus by persistently infected calves. Pesq. Vet. 466
Bras. 29:736-742. 467
11. Houe H, Lindberg A, Moennig V. 2006. Test strategies in bovine viral diarrhea virus 468
control and eradication campaigns in Europe. J. Vet. Diagn. Invest. 18:427-436. 469
12. Stahl K, Alenius S. 2012. BVDV control and eradication in Europe--an update. Jpn. J. 470
Vet. Res. 60 Suppl:S31-39. 471
13. Ridpath JF, Fulton RW, Kirkland PD, Neill JD. 2010. Prevalence and antigenic 472
differences observed between Bovine viral diarrhea virus subgenotypes isolated from 473
cattle in Australia and feedlots in the southwestern United States. J. Vet. Diagn. Invest. 474
22:184-191. 475
14. Ridpath JF, Lovell G, Neill JD, Hairgrove TB, Velayudhan B, Mock R. 2011. 476
Change in predominance of Bovine viral diarrhea virus subgenotypes among samples 477
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
22
submitted to a diagnostic laboratory over a 20-year time span. J. Vet. Diagn. Invest. 478
23:185-193. 479
15. Bianchi E, Martins M, Weiblen R, Flores EF. 2011. Genotypic and antigenic profile of 480
bovine viral diarrhea virus isolates from Rio Grande do Sul, Brazil (2000-2010). Pesq. 481
Vet. Bras. 31:649-655. 482
16. Decaro N, Mari V, Pinto P, Lucente MS, Sciarretta R, Cirone F, Colaianni ML, Elia 483
G, Thiel HJ, Buonavoglia C. 2012. Hobi-like pestivirus: both biotypes isolated from a 484
diseased animal. J. Gen. Virol. 93:1976-1983. 485
17. Kampa J, Alenius S, Emanuelson U, Chanlun A, Aiumlamai S. 2009. Bovine 486
herpesvirus type 1 (BHV-1) and bovine viral diarrhoea virus (BVDV) infections in dairy 487
herds: self clearance and the detection of seroconversions against a new atypical 488
pestivirus. Vet. J. 182:223-230. 489
18. Haider N, Rahman MS, Khan SU, Mikolon A, Gurley ES, Osmani MG, Shanta IS, 490
Paul SK, Macfarlane-Berry L, Islam A, Desmond J, Epstein JH, Daszak P, Azim T, 491
Luby SP, Zeidner N, Rahman MZ. 2014. Identification and epidemiology of a rare 492
HoBi-like pestivirus strain in Bangladesh. Transbound. Emerg. Dis. 61:193-198. 493
19. Dubovi EJ. 2013. Laboratory diagnosis of bovine viral diarrhea virus. Biologicals 41:8-494
13. 495
20. Zimmer GM, Van Maanen C, De Goey I, Brinkhof J, Wentink GH. 2004. The effect 496
of maternal antibodies on the detection of bovine virus diarrhoea virus in peripheral 497
blood samples. Vet. Microbiol. 100:145-149. 498
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
23
21. Fux R, Wolf G. 2012. Transient elimination of circulating bovine viral diarrhoea virus 499
by colostral antibodies in persistently infected calves: a pitfall for BVDV-eradication 500
programs? Vet. Microbiol. 161:13-19. 501
22. Brodersen BW. 2004. Immunohistochemistry used as a screening method for persistent 502
bovine viral diarrhea virus infection. Vet. Clin. North. Am. Food. Anim. Pract. 20:85-93. 503
23. Decaro N, Losurdo M, Lucente MS, Sciarretta R, Mari V, Larocca V, Elia G, 504
Cavaliere N, Martella V, Fasanella A, Buonavoglia C. 2013. Persistent infection 505
caused by Hobi-like pestivirus. J. Clin. Microbiol. 51:1241-1243. 506
24. Bauermann FV, Flores EF, Ridpath JF. 2012. Antigenic relationships between Bovine 507
viral diarrhea virus 1 and 2 and HoBi virus: possible impacts on diagnosis and control. J. 508
Vet. Diagn. Invest. 24:253-261. 509
25. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. 510
Amer. J. Epid. 27:493-497. 511
26. Bauermann FV, Flores EF, Falkenberg SM, Weiblen R, Ridpath JF. 2014. Lack of 512
evidence for the presence of emerging HoBi-like viruses in North American fetal bovine 513
serum lots. J. Vet. Diagn. Invest. 26:10-17. 514
27. Bauermann FV, Harmon A, Flores EF, Falkenberg SM, Reecy JM, Ridpath JF. 515
2013. In vitro neutralization of HoBi-like viruses by antibodies in serum of cattle 516
immunized with inactivated or modified live vaccines of bovine viral diarrhea viruses 1 517
and 2. Vet. Microbiol. 166:242-245. 518
28. Falkenberg SM, Ridpath J, Vander Ley B, Bauermann FV, Sanchez NCB, Carroll 519
JA. 2014. Comparison of temperature fluctuations at multiple anatomical locations in 520
cattle during exposure to bovine viral diarrhea virus. Lives. Sci. 164:159-167. 521
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
24
29. Liebler-Tenorio EM, Ridpath JE, Neill JD. 2002. Distribution of viral antigen and 522
development of lesions after experimental infection with highly virulent bovine viral 523
diarrhea virus type 2 in calves. Am. J. Vet. Res. 63:1575-1584. 524
30. Vilcek S, Herring AJ, Herring JA, Nettleton PF, Lowings JP, Paton DJ. 1994. 525
Pestiviruses isolated from pigs, cattle and sheep can be allocated into at least three 526
genogroups using polymerase chain reaction and restriction endonuclease analysis. Arch. 527
Virol. 136:309-323. 528
31. Hessman BE, Sjeklocha DB, Fulton RW, Ridpath JF, Johnson BJ, McElroy DR. 529
2012. Acute bovine viral diarrhea associated with extensive mucosal lesions, high 530
morbidity, and mortality in a commercial feedlot. J. Vet. Diagn. Invest. 24:397-404. 531
32. Corapi WV, Donis RO, Dubovi EJ. 1990. Characterization of a panel of monoclonal 532
antibodies and their use in the study of the antigenic diversity of bovine viral diarrhea 533
virus. Am. J. Vet. Res. 51:1388-1394. 534
33. Liu L, Xia H, Belak S, Baule C. 2008. A TaqMan real-time RT-PCR assay for selective 535
detection of atypical bovine pestiviruses in clinical samples and biological products. J. 536
Virol. Methods. 154:82-85. 537
34. Hilbe M, Stalder H, Peterhans E, Haessig M, Nussbaumer M, Egli C, Schelp C, 538
Zlinszky K, Ehrensperger F. 2007. Comparison of five diagnostic methods for 539
detecting bovine viral diarrhea virus infection in calves. J. Vet. Diagn. Invest. 19:28-34. 540
35. Decaro N, Mari V, Lucente MS, Sciarretta R, Moreno A, Armenise C, Losurdo M, 541
Camero M, Lorusso E, Cordioli P, Buonavoglia C. 2012. Experimental infection of 542
cattle, sheep and pigs with 'Hobi'-like pestivirus. Vet. Microbiol. 155:165-171. 543
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
25
36. Larska M, Polak MP, Liu L, Alenius S, Uttenthal A. 2013. Comparison of the 544
performance of five different immunoassays to detect specific antibodies against 545
emerging atypical bovine pestivirus. J. Virol. Methods. 187:103-109. 546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
26
Table 1 – Rate of detection of samples from HoBi-like persistently infected (PI) calves by 567
various testing methods* 568
Test specificity/ assay
Positive samples for each PI (day of birth to week 5)
Detection totals for each
tested tissue
Calf 101
Calf 104
Calf 102
Calf 103
Serum Buffy coat
Ear notch
BVDV
RT-PCR1 28% 83% 61% 50% 83% 58% 25%
RT-PCR2 17% 72% 33% 33% 37% 46% 33%
RT-qPCR1 61% 100% 100% 94% 83% 83% 100%
RT-qPCR2 100% 100% 100% 100% 100% 100% 100%
BVDV - ear notch
Conv. ext. + ErnsACE 67% 100% 100% 83% - - 87%
Enh. ext. + ErnsACE 83% 100% 100% 100% - - 96%
Enh. ext. + NS3 ACE 0% 0% 0% 0% - - 0%
IHC 100% 100% 100% 100% - - 100%
HoBi-like
RT-PCR 44% 94% 94% 94% 83% 75% 87% RT-qPCR 61% 89% 89% 83% 83% 96% 62%
569
* Test identification: 570
BVDV RT-PCR1 – primers 324-326; BVDV RT-PCR2 – primers HCV 90-368; BVDV qRT 571
PCR1 – Bovine Virus Diarrhea RNA test Kit; BVDV RT-qPCR2 –Virotype BVDV test Kit; 572
Conventional extracted samples tested by Erns antigen capture ELISA – HerdCheck BVD 573
antigen; Enhanced extracted samples tested by Erns antigen capture ELISA; Enhanced extracted 574
samples tested by NS3 antigen capture ELISA; Immunohistochemistry; HoBi-like RT-PCR – 575
primers N2-R5; HoBi-like RT-qPCR – primers T134-F, T220-R and probe T155r-P. 576
577
578
579
580
581
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
27
Figure legends 582
583
Fig. 1 – Aural skin biopsies stained using monoclonal antibody 15C5. Fetus infected with strain 584
Italy-1/10-1. Positive staining in hair follicle infundibula and apocrine glands. Scale 50μm (A). 585
Calf #101 at one day of age; persistently infected with the HoBi-like strain HoBi_D32/00. 586
Positive staining in epidermis, hair follicle infundibula, sebaceous glands, and dermal fibrocytes 587
(B). Calf #102 at one day of age; persistently infected with the HoBi-like strain HoBi_D32/00. 588
Positive staining in epidermis, hair follicle infundibulum, sebaceous glands, and arterial wall (C). 589
B and C scale is 20μm. 590
591
Fig. 2 – Results of testing animals persistently infected with a HoBi-like virus from day of birth 592
(DOB) to week 5 (W5). White squares filled with “+” means positive result. Positive results for 593
the RT-qPCR are represented by the Cq value. Dark squares means negative result. Test 594
identification: BVDV RT-PCR1 – primers 324-326; BVDV RT-PCR2 – primers HCV 90-368; 595
BVDV qRT PCR1 – Bovine Virus Diarrhea RNA test Kit; BVDV qRT-PCR2 –Virotype BVDV 596
test Kit; Conventional extracted samples tested by Erns antigen capture ELISA – HerdCheck 597
BVD antigen; Enhanced extracted samples tested by Erns antigen capture ELISA; Enhanced 598
extracted samples tested by NS3 antigen capture ELISA; Immunohistochemistry; HoBi-like RT-599
PCR – primers N2-R5; HoBi-like qRT-PCR – primers T134-F, T220-R and probe T155r-P. The 600
used cutoff value for all the RT-qPCR was 38 cycles. 601
602
Fig. 3 – Sample to positive ratio (S/P ratio) for each persistently infected (PI) calf (#101; #102; 603
#103 and #104). Samples from day of birth (DOB) and weekly for five consecutive weeks (W1 604
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
28
to W5) were tested using commercial Erns ACE kit, with conventional (Conv. ext.) or enhanced 605
extraction (Enh. ext.) process, and respectively represented by triangle or square marker. Axis 606
“X” crosses axis “Y” at 0.3, the threshold sample to positive ratio (S/P) value for the Erns antigen 607
capture ELISA used. 608
609
Fig.4 Alignment of the HoBi-like viruses isolates HoBi_D32/00 (AB871953.1) and Italy-1/10-1 610
(HQ231763.1) with the primers N2, R5, T134-F, T220-R, and probe T155r-P used for specific 611
detection of HoBi-like viruses. Primers reverse R5, T220-R and the probe T155r-P are presented 612
as the reverse complement of the original sequence. 613
614
on July 11, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from