General enquiries on this form should be made to:randd.defra.gov.uk › Document.aspx?Document=HH32… · Web viewend date 31 March 2008 6. It is Defra’s intention to publish this

General enquiries on this form should be made to:Defra, Science Directorate, Management Support and Finance Team,Telephone No. 020 7238 1612E-mail: [email protected]

SID 5 Research Project Final Report

SID 5 (Rev. 3/06) Page 1 of 18

NoteIn line with the Freedom of Information Act 2000, Defra aims to place the results of its completed research projects in the public domain wherever possible. The SID 5 (Research Project Final Report) is designed to capture the information on the results and outputs of Defra-funded research in a format that is easily publishable through the Defra website. A SID 5 must be completed for all projects.

This form is in Word format and the boxes may be expanded or reduced, as appropriate.

ACCESS TO INFORMATIONThe information collected on this form will be stored electronically and may be sent to any part of Defra, or to individual researchers or organisations outside Defra for the purposes of reviewing the project. Defra may also disclose the information to any outside organisation acting as an agent authorised by Defra to process final research reports on its behalf. Defra intends to publish this form on its website, unless there are strong reasons not to, which fully comply with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.Defra may be required to release information, including personal data and commercial information, on request under the Environmental Information Regulations or the Freedom of Information Act 2000. However, Defra will not permit any unwarranted breach of confidentiality or act in contravention of its obligations under the Data Protection Act 1998. Defra or its appointed agents may use the name, address or other details on your form to contact you in connection with occasional customer research aimed at improving the processes through which Defra works with its contractors.

Project identification

1. Defra Project code HH3229SSF

2. Project title

Incidence and epidemiology of strawberry crinkle disease

3. Contractororganisation(s)

East Malling ResearchNew RoadEast MallingKentME19 6BJ

54. Total Defra project costs £ £399,744.00(agreed fixed price)

5. Project: start date................ 21 January 2004

end date................. 31 March 2008


6. It is Defra’s intention to publish this form. Please confirm your agreement to do so...................................................................................YES NO (a) When preparing SID 5s contractors should bear in mind that Defra intends that they be made public. They

should be written in a clear and concise manner and represent a full account of the research project which someone not closely associated with the project can follow.Defra recognises that in a small minority of cases there may be information, such as intellectual property or commercially confidential data, used in or generated by the research project, which should not be disclosed. In these cases, such information should be detailed in a separate annex (not to be published) so that the SID 5 can be placed in the public domain. Where it is impossible to complete the Final Report without including references to any sensitive or confidential data, the information should be included and section (b) completed. NB: only in exceptional circumstances will Defra expect contractors to give a "No" answer.In all cases, reasons for withholding information must be fully in line with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

(b) If you have answered NO, please explain why the Final report should not be released into public domainThe sequences for the SCV primers and probes were supplied by the Central Science Laboratory, York, have not been published and are proprietary.

Executive Summary7. The executive summary must not exceed 2 sides in total of A4 and should be understandable to the

intelligent non-scientist. It should cover the main objectives, methods and findings of the research, together with any other significant events and options for new work.

Strawberry crinkle disease is attributable to a suite of RNA viruses: Strawberry crinkle virus (SCV), Strawberry mild yellow edge virus (SMYEV) and Strawberry mottle virus (SMoV). All three viruses are obligately vectored by aphids, either Chaetosiphon fragaeofolii or Aphis gossypii. Historically, the viruses have been identified and indexed by grafting to indicator varieties of Fragaria vesca., which is both time consuming and technically difficult. Nucleic acid-based methods have been developed for detection of all three viruses and were used in this project. Amplification of nucleic acid extracts from strawberry plants is sensitive to the presence of many endogenous inhibitors. Also, numbers of virus particles per unit volume in sampled tissues are seasonably variable. The first objective of this project was to determine the suitability of existing methods for quantifiable detection of SCV in particular, as well as SMYEV and SMoV. The first (published) set of oligonucleotide primers, while adequate for end-point PCR were not applicable to real time PCR (qPCR). These primers were abandoned and another set of primers and probe were evaluated and used starting in 2006. The detection threshold for these primers was approximately 9000 virus particles per sample.

The second objective of the project was to survey strawberry production and propagation fields for strawberry crinkle disease. This was accomplished by visual assessment of symptoms during crop walks, collection of materials from both plants showing symptoms and plants without symptoms and assessment of collected materials for all three viruses associated with the syndrome by reverse transcriptase end-point PCR. We found poor correlation between symptom expression and the identification of causal agent. Indeed, most symptomatic plants were found to harbour more than one of the viruses, which is in accord with published results: most modern varieties of strawberry are tolerant to single virus infection. Incidence of symptomatic strawberries ranged from 0% to approximately 8%, with frequency of symptomatic plants increasing with time in the field. There were, as well, differences between cultivars in the frequency of crinkle disease. Latent infection rates were found to be extremely high for both SCV and SMYEV, while SMoV was rarely found; many of these latently infected plants were infected with both SCV and SMYEV. SMYEV was detected in the majority of propagation materials The third objective was to determine SCV acquisition and transmission times by C. fragaeofolii. Two experiments were performed in growth cabinets at a constant temperature of 20 °C: one with virus acquisition times of 0, 24, and 48 h followed by transmission times of 7, 14 and 28 d; and the second with acquisition times of 0, 24 and 48 h, followed by transmission times of 3 and 7 d. Plants were evaluated for virus titre after 28 d after aphid removal in the first


experiment and 7 d in the second; RNA was similarly extracted, reverse transcribed and amplified from aphids at the time of removal.

Also investigated as part of the third objective was the possibility that strawberry-related weed species (F. vesca and Potentilla reptans) could serve as reservoirs for the viruses. Both F. vesca and P. reptans are known to be occasional hosts for strawberry virus vectors and all species of Fragaria have been reported as susceptible to the viruses. We confirmed that F. vesca is susceptible and symptomatic when infected with SCV and SMYEV. Symptom expression in P. reptans was subtle, at best, however, both SCV and SMYEV were detectable from P. reptans leaves subsequent to grafting with infected strawberry material. This finding suggests that P. reptans growing in proximity to strawberry fields may serve as reservoir for strawberry viruses and should be considered in virus disease management strategies.

The fourth major objective of the project was to investigate the spread of virus within and between fields. To this end, three sets of paired plots, each plot with 500 strawberry plants were planted. Ten virus-infected plants with high resident wingless aphid populations were placed at the centre of one of each pair of plots and the 25 plants were assayed for SCV in each plot over two seasons. At all three sites, the majority of plants within the plot where virus-infected plants had been transplanted were latently infected by the end of the first season. Virus titre was variable over time within infected plants. Aphid populations were always low at sampling; virus was present in the majority of aphids sampled. The plots distal to those in which infected plants were arrayed were much slower in developing detectable virus; however, by the end of the second season many of the assayed plants from these plots were also determined to be infected with SCV. Due to several complicating factors, it was not possible to determine the rate of spread nor the sources of infection, however, several tentative conclusions may be proposed: wingless aphids do not move far, but spread radially through fields transmitting virus as they go; winged aphids, either derived from the wingless population or from outside the experimental units were most likely responsible for the infections in the uninfested plots. Hence, virus-free planting materials can reduce the incidence of virus infection and slow the development of disease within crops, although strawberries will be infected with viruses by aphids either blown into or flying into the field. Aphid control and virus-free planting materials are, therefore, of paramount importance in reducing the incidence and spread of viruses within strawberry production fields.

Several of the milestones of this project were delayed due largely to technical problems. Having resolved many of these, it would be a good investment to continue several aspects of the research. First, a complete sequence of (at least one strain) of SCV should be generated. This would facilitate a better understanding of the replication process as primers could be developed for upstream segments of the RNA genome relative to the terminal fragments, which are amplified by the currently available primers. Since upstream segments are replicated first, and many of these are aborted before being packaged in coat proteins, development of upstream oligonucleotide primer sets would both improve detection and give insight into the efficiency of virus replication in both plant and aphid. Second, correlations between efficiency of detection by molecular methods and by grafting should be established. This would greatly help elucidate our present finding of high frequencies of latent virus infection and may have implications for the indexing and distribution of strawberry runners. Too, the correlations would allow for evaluation of the efficacy of screening propagation materials for latent infection. Third, with the improvement of our methodology and timely analysis of material (rather than collection and storage of same), experiments on spread of the disease within fields could be expanded and repeated, so that spread from individually infected plants could be examined. Fourth, with the methods now established, a clearer picture of the acquisition and transmission of virus by aphids can be established by examining the effects of different temperatures on these processes and on fecundity and longevity of aphids. A better understanding of these processes may have implications for growers in timing and frequency of aphid control measures consistent with the goal of pesticide reduction.

Project Report to Defra


8. As a guide this report should be no longer than 20 sides of A4. This report is to provide Defra with details of the outputs of the research project for internal purposes; to meet the terms of the contract; and to allow Defra to publish details of the outputs to meet Environmental Information Regulation or Freedom of Information obligations. This short report to Defra does not preclude contractors from also seeking to publish a full, formal scientific report/paper in an appropriate scientific or other journal/publication. Indeed, Defra actively encourages such publications as part of the contract terms. The report to Defra should include: the scientific objectives as set out in the contract; the extent to which the objectives set out in the contract have been met; details of methods used and the results obtained, including statistical analysis (if appropriate); a discussion of the results and their reliability; the main implications of the findings; possible future work; and any action resulting from the research (e.g. IP, Knowledge Transfer).

Introduction

The objectives of the project, as presented in the modified CSG7 form were:

1. The aim of this objective is to confirm reliability of PCR tests for routine detection of strawberry crinkle virus and other relevant viruses. This data can be used to examine the etiology of symptoms, which may result from infection by SCV only, or a mixture of strawberry viruses. Findings will highlight the importance of mixed infections in leading to strawberry crinkle disease.

2. To gain information on the incidence of SCV within the UK. The importance of SCV in terms of risk of losses in crops is well understood, but the economic importance of this will depend on incidence in the UK. Due to difficulty of visual assessment of plants this is not well documented. Objective 2 seeks to ascertain the importance of SCV, particularly in nursery plants, and its incidence in the UK strawberry industry

3. To investigate the role of aphids in spread of disease, and factors that may influence this. A better understanding of the biology of SCV in relation to its aphid vector Chaetosiphon fragaefolii is sought. A number of factors may influence virus acquisition and transmission. Controlled experiments will lead to improved understanding of the role of aphids in disease spread. The possibility that wild strawberries and Potentilla spp. act as reservoirs of the virus will be investigated.

4. To understand the spread of SCV in terms of the importance of both nursery plants and field production. Objective 4 will determine the pattern of incidence of strawberry crinkle virus in the field. An experimental approach seeks to determine the relative importance of nursery stock in introducing SCV into production fields, and then the subsequent spread of the virus in these plots.

5. To effectively transfer results arising to the UK strawberry industry, and the wider scientific community. This objective will ensure that results are communicated effectively and that opportunities for exploiting them are maximised.

All objectives have been met.

Strawberry crinkle disease is caused by a complex of aphid-borne viruses including Strawberry crinkle virus (SCV), Strawberry mild yellow edge virus (SMYEV), and Strawberry mottle virus (SMoV). The syndrome can reduce yields and fruit quality in infected hosts. However, diagnosis by visual symptomotology is subtle and subjective. To this end, a rapid and sensitive reverse transcriptase polymerase chain reaction (RT-PCR) method for SCV has been developed at the CSL, evaluated and adopted for use in this project. SMYEV and SMoV were reverse transcribed and amplified using the oligonucleotide primers of Thompson et al. (2004)(objective 1).

The importance of viruses other than SCV to the development of the syndrome and their assessment in terms of impact on symptom differences was among the goals of this project. In terms of virus epidemiology, it is important that new planting materials be disease free. As the strawberry industry has moved away from perennial plantings to one- and two-year crops, it has become less likely that within crop transmission of viruses will be significant, as disease development is relatively slow and yield


reductions are not usually experienced until the second or later years of a crop. Information on the incidence of strawberry crinkle disease in the UK was the second objective of the project. (objective 2)

Virus spread within crops is mediated by aphid vectors. SCV and SMYEV are obligately vectored in a persistent circulative manner by the aphid Chaetosiphon frageiofollii (Cockerell); SMoV is vectored by both C. frageiofollii and Aphis gossypii in a semi-persistent manner. As a third objective, we explored acquisition and transmission times for SCV at a constant temperature in order to better understand the epidemiology of the virus. Additionally, after discussion with DEFRA project coordinator Emma Hennessy, the ability of Potentilla reptans to harbour strawberry viruses was investigated by grafting infected materials to P. reptans and identifying infections by RT-PCR. Several strawberry viruses are vectored by the strawberry aphid C. fragaefolii, which is known to occasionally infest other members of the genus Potentilla (Blackman and Eastop, 2000). Indeed, it has been pointed out that the genus is either paraphyletic or that Fragaria should be included within it (Mabberly 2002). Both wild strawberry (F. vesca L.) and P. reptans L. can be found growing in close proximity to commercial strawberry fields in the southern UK. All members of the genus Fragaria have been previously shown to be hosts of the virus (Martin and Tzanetakis 2006), however we wished to find out if local Potentilla spp. could harbour the virus, perhaps asymptomatically. (objective 3)

The fourth goal of the project was to study the spread of infection within strawberry fields. This was accomplished by placing SCV-infected plants (with cultures of aphids) at the centres of three plots and systematically sampling plants elsewhere in the field through time. (objective 4).

Materials and methods

Virus strains, plants and detection methods: The EMR virus collection is maintained by grafting infected materials to either the common susceptible cultivar Elsanta or the indicator F. vesca cv. UC-5. Strains of SCV, SMYEV and SMV are all in the collection, however their identities have become confused because aphids have occasionally infested the greenhouse where the collection is maintained and the viruses are all maintained in the same facility. Pure strains of virus were solicited froSm the CSL, but their collection has apparently become attenuated and they could not supply fresh material (R. Mumford, personal communication). Nevertheless, virus positive controls for PCR reactions were obtained for all three viruses. Fragaria vesca subsp. vesca FDP801 was supplied by the EMR strawberry breeding program and Potentilla reptans was collected locally and propagated at EMR.

Virus detection was accomplished through grafting to UC-5 indicator plants and/or through polymerase chain reaction products of reverse transcribed plant and aphid RNA extracts, described below.

For RNA extraction from strawberry tissues: Three 7 mm diameter leaf disks were cut from collected leaves to include part of the petiole and mid-rib of the leaf and frozen at -80 °C until use. Plant tissues were macerated in BioReba extraction bags with SE buffer (0.81 g NaCl, 15 mg KCl, 27 mg KH2PO4, 114 mg Na2HPO4, 2 g polyvinylpyrrolidone, 50 l Tween 20, 0.2 g albumin, 0.5 g bovine serum albumin, 50 mg sodium azide [Sigma Aldrich, Gillingham, Dorset] per 100 ml deionized water). Subsequent RNA extraction was accomplished using the RNA Easy® Mini kit (QIAGEN, Crawley, W. Sussex) ) following manufacturer’s instructions. RNA extracts were reverse transcribed (IllustraTM Ready-To-GoTM RT-PCR Beads, GE Healthcare, Little Chalfont, Bucks.) into cDNA using random oligomers and the cDNA was amplified using either end-point PCR or qPCR, described below, depending on the experiment. For plant-derived RNAs, positive control for the extraction process was accomplished through amplification of an intron-containing NAD sequence. After PCR, the presence of two NAD bands indicated both amplification of endogenous DNA and of reverse-transcribed RNA.

Total RNA was extracted from aphids using RNA Easy® Mini kits, as above. Reverse transcription was accomplished using QuantiTect® Reverse Transcription kits (QIAGEN). The cDNA was stored at -20 °C until use. Prior to reverse transcription, aphid extracts were treated with DNAase (QIAGEN) so that amplification with COX primers could serve as a procedure control for the reverse transcription.


Table 1. Oligonucelotide primer and probe sequences used in this project

Primer name Primer sequence Amplicon size Target Source

SMoVdeta 5’- TAAGCGACCACGACTGTGACAAAG 219 Non-coding region

Thompson et al. 2003

SMoVdetb 5’- TCTTGGGCTTGGATCGTCACCTG Thompson et al. 2003

SMYEVdeta 5’- GTGTGCTCAATCCAGCCAG 271 Coat protein Thompson et al. 2003

SMYEVdetb 5’- CATGGCACTCATTGGAGCTGGG “Thompson et al. 2003

SCV225f 5’-ATATCCTCCAGAGCTACGTATACGAAGGATC

89 L-protein CSL

SCV309r 5’- GTCCCATTCCTCAATTCGATG CSLSCV-probe 6FAM-TGG AAA ATG ATG GGT CTG CCA CCA CSLNAD2.1a 5’- GGACTCCTGACGTATACGAAGGATC NADH

dehydrogenase ND2

Thompson et al. 2004

NAD2.2b 5’- AGCAATGAGATTCCCCAATATCATSCV36F 5’- AACAATCATTAAAACRAGRAGRAGTG L-protein Mumford et

al. 2004SCV123R 5’- GGGATTMAGTGTWGTRTCTTCCARC L-protein “Mumford et

al. 2004SCV 67T* probe

6FAM-CCT CAT TCA CTG TCT TTA AGA ACT CTC

Mumford et al. 2004

COX r 5’- GTAATCTGAGTATCGGCGAGGTAT Cytochrome oxidase

COX f 5’-TGATTTTTTGGGCACCCAGAAG

End-point and qPCR for SCV were both accomplished using oligonucleotide sequences supplied by the CSL. For qPCR, a FAM-labelled TaqMan probe was included in the reaction mix.

End-point PCR was performed with the above primers, (all from Sigma Genosys, Gillingham, Dorset). TAQ DNA polymerase kits (QIAGEN) and dNTPs (Invitrogen, Carlsbad CA) were used in thermostrips (Thermo Scientific, ABgene, Epsom, Surrey) on an MJ Research Peltier Thermal Cycler (Bio-Rad, Hemel Hempstead) using the following protocol: 40 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30s, extension at 72 °C for 30 s with a final extension step of 72 °C for 10 min 30 s. Products were separated on 2 % agarose in 0.5 strength Tris-borate-EDTA buffer ((5.4 g Tris base; 2.75 g boric acid; 2 ml 0.5 M EDTA) and stained with ethidium bromide. Current was adjusted to 100 mAmp. PCR products were visualized under UV-B on a Bio-Rad gel Doc 1000 transilluminator using Bio-Rad Quantity 1 software (Hemel-Hempstead) and equipped with an electronic camera.

Quantitative PCR was accomplished using an ABI 7500 Real Time PCR apparatus (Applied Biosystems, Foster City, CA) with the primers SCV 225F and SCV309R (Genosys), the SCV probe (Applied Biosystems), TaqMan® Universal PCR Master Mix No Amperase® UNG, Microamp® Optical 96 well Reaction Plates and Adhesive Film (Applied Biosystems) in a 20 l reaction volume with the following protocol: 1 cycle at 95 °C for 5 min; 40 cycles of 95 °C for 15 s, 60 °C for 1 minute (read temperature); with a final extension at 72 °C for 7 min.

Objective 1: Efficacy of primers and probes for RT-PCR and RT-qPCR of SCV

The SCV36F and SCV123R primer sets were successful in amplifying cDNA from virus infected plants. However, the SCV 67T* TAQMan probe was discovered to lie outside the amplicon and, therefore, could not function as described (data not shown). The probe was misprinted (or erroneously described) in the proceedings in which it was published. Subsequent amplifications used the SCV225f and SCV 309r and associated SCV-probe (CSL, unpublished; used by permission) and were successful.

Objective 2: Survey of strawberry production and propagation fields for strawberry crinkle disease

Strawberry fields were surveyed in 2004 and 2005 (map of sites in Appendix B). Symptomatic plants were scored and photographed and leaves sampled from seven sites in four counties. RNA was


extracted from the sampled leaves and the cDNA was amplified with the three primer sets designed for the viruses SMYEV, SCV and SmoV. An amplification with the NAD primers was also performed and the products were electrophoresed on 2 % agarose gels.

Strawberry production and propagation fields were surveyed in 2004 and 2005. Symtomatic plants were recorded and leaf samples collected. RT-PCR was performed and cDNAs analysed for the presence of SCV, SMYEV and SMoV. Additionally, plants proximal to the symptomatic plants were sampled to determine if latent infections were present and analyzed, as above.

Objective 3: Aphid acquisition and transmission of SCV

Aphid cultureChaetosiphon fragaefolii were cultured on Fragaria vesca cv. UC5 strawberry plants at 20 °C in long day length 14:10. These were established in 2005. Strawberry plantsUninfected Fragaria vesca cv. UC5 plants were grown in a glasshouse at approx 18 °C. These plants were planted from runners from a long term successive culture. Infected strawberry plants used for the experiments were grown in a separate glasshouse at approx 18 °C. These plants contained both SCV and SMYEV.

First virus acquisition experiment.

An experiment was set up in a controlled temperature room at 20 °C. There were five replicates of each of 9 treatments (Table 2) to ascertain the acquisition and transmission time of SCV.

Table 2. Treatments used in first virus acquisition and transmission by aphids experiment.

Treatment Acquisition time (hours)

Transmission time (days)

Sample time following aphid removal (days)

1 0 7 282 0 14 283 0 28 284 24 7 285 24 14 286 24 28 287 48 7 288 48 14 289 48 28 28

Due to the nature of the experiment, treatments were not randomised and were grouped to allow trays to be removed to a glasshouse area for fumigation following aphid removal at the end of the transmission period. To prevent experimental effects that may not be due to treatments, all plants used were as uniform as possible at the start of the experiment (5 leaf-stage) and plants were placed in individual saucers on capillary matting for watering. Saucers were placed in water filled trays to prevent aphid transfer between plants, and these trays were rotated between different areas in the CT room to prevent any positional effects.

To allow aphids to acquire the virus, C. fragaefolii (3rd to 4th instars) from an aphid culture, were transferred to two plants known to be infected with SCV. Aphids were gently transferred using paint-brushes to prevent damage to the aphid stylets. These plants were placed in an incubator at 20 °C under long days for the duration of the aphid acquisition period.

After 24 hours, treatments 1 to 3 were set up by transferring 5 aphids from the non-viruliferous aphid culture to each of six uninfected plants per treatment. At the same time, treatments 4 to 6 were set up, again with 5 aphids per plant, but using the aphids that had been placed on the SCV infected plants to acquire virus. After 48 hours, treatments 7 to 9 were set up in the same way using aphids from the SCV plants. A record was made of which plant the aphids had been feeding on before transfer. Fluon (liquid PTFE) coated cardboard rings were placed around the rim of the plant pots to encourage the aphids to remain on the plants and to prevent aphid transfer. Ten minutes after transfer the aphids were observed under the microscope to ensure that they were settled and feeding before plants were placed in individual saucers in the water filled trays in the controlled temperature compartment.


After the allocated transmission time for each treatment, either 7, 14 or 28 days, all adult aphids on the plant were removed, using either a clean entomology pin or sterile pipette tip, into individual labelled micro-centrifuge tubes, one tube per plant. The tubes were placed into a -80 °C freezer for subsequent analysis (see molecular methods). A record of the number of aphids collected per plant was made. The number of nymphs deposited per plant was recorded. Plants were taken to a glasshouse (temperature set at 18 °C) to be fumigated using nicotine to kill any remaining nymphs. After three days they were returned to the CT room.

Plant material was sampled 28 days after the aphid removal by picking one young fully expanded leaf per plant into a labelled plastic bag for subsequent molecular analysis (see molecular methods). Clean gloves were used to sample each plant.

Plants were visually assessed for SCV.

Second virus acquisition and transmission by aphids experimentPrior to the experiment, clean plants onto which aphids would be transferred were tested (see molecular methods) to check that they were free of virus. Plants on which cultured aphids were feeding were also tested to ensure that aphids were not already viruliferous. Leaf material was put into a labelled bag and clean gloves were used when sampling each new leaf to prevent possible contamination.

The experiment was set up as randomised complete blocks with five blocks of 6 treatments. Treatments (Table 3) had acquisition times of 0, 24 or 48 hours and transmission times of 3 or 7 days. Blocks were assigned to account for plant size and area in the CT room. At the start of the experiment plants were at the 5-7 leaf stage. Light levels in the CT room were slightly higher on the lower shelf than on the upper shelf, although both were above the level needed to stimulate crop plant growth, although temperature was constant. Again the water filled tray design was used, with capillary matting in each individual saucer. Two large trays were used per block to allow adequate space to prevent contamination between plants if runners were produced. Each plant was individually labelled with a unique identifier.

At the start of the experiment, late-instar aphids were transferred from the clean aphid culture to either a plant known to be infected with SCV (to be used subsequently in treatments 3-6) or to an uninfected plant (to be used subsequently in treatments 1-2). Aphids were gently transferred using paint-brushes to protect the aphid stylets. These were labelled either SCV or uninfected. Both had previously been soaked in 100 % EtOH and then washed in detergent. SCV and uninfected plants were held in separate incubators at 20 °C in long day-length.

Table 3. Treatments in second virus acquisition and transmission experiment

Treatment Acquisition time (hours)

Transmission time (days)

Sample time following aphid removal (days)

1 0 3 7 2 0 7 7 3 24 3 7 4 24 7 7 5 48 3 7 6 48 7 7

After 24 hours, treatments 1 to 4 were set up by transferring 4 aphids to each plant from either the infected or uninfected plant as appropriate. After 48 hours treatments 5 to 6 were set up by transferring 4 aphids to each plant from the infected plant. The aphids were observed under the microscope to be settled and feeding before plants were returned to the controlled temperature compartment. All plants were placed in set randomised positions in each block following aphid transfer.

After the allocated transmission time for each treatment, either 3 or 7 days, the aphids were removed, using either a clean entomology pin or sterile pipette tip for each aphid, into individual labelled micro-centrifuge tubes. These were placed into a -80 °C freezer for subsequent analysis (see molecular methods). A record of the number of aphids collected per plant was made, and of any dead aphids. The number of nymphs deposited per plant was recorded and nymphs were removed from the plant.


Obviously with differing acquisition and transmission times the date of aphid removal differed by up to 5 days from the first to the last removal. Plants were returned to their allocated positions in each block.

Plants were sampled 7 days after the aphid removal by picking one young fully expanded leaf per plant into a labelled plastic bag for subsequent molecular analysis (see molecular methods). Again clean gloves were used to sample each plant. As before, the sampling differed by up to 5 days from the first to the last removal. Plants were returned to their allocated positions in each block and were retested at 28 days after aphid removal when a visual assessment of symptoms was also done.

Objective 3: Potentilla reptans as a potential reservoir of virus

Virus-infected leaves of Elsanta strawberry were grafted into UC-5 indicator plants. When symptoms appeared in the UC-5 plants, leaves from these were grafted into Potentilla reptans and F. vesca plants. One month after grafting virus into the P. reptans and F. vesca, leaves from these plants were grafted onto new, uninfected UC-5 plants. One month later, the UC-5 plants were examined for symptoms and were extracted for viruses, as above. The grafted F. vesca, P. reptans and uninfected controls were similarly extracted and the extracts amplified by end-point PCR.

Objective 4: Spread of SCV in the field

Three fields were planted with 990 plants of cv. Elsanta in April 2006. Each field was divided into two sections of 500 plants (see below) separated by 10 m. At the centre of one plot in each field, ten virus infected strawberry plants were transferred with actively growing C. fragaefollii cultures to represent the nidus of an epidemic. These plots were systematically sampled for virus, three times in 2006 and twice in 2007. The adjacent uninfested plots were randomly sampled from the end of the 2006 growing season through the 2007 growing season. Aphids were sampled from the plots on three occasions: twice in 2006 and once in 2007. Collected leaves and aphids were analyzed for SCV titre using quantitative reverse transcriptase PCR (qRT-PCR) and disease progress followed through time. Appendix A illustrates the plot design and sampling strategy for the infested plots. The uninfested adjacent plots were sampled less frequently and randomly, as opposed to systematically. Results

Objective 1: Reliability of PCR tests for routine detection of strawberry crinkle and other relevant viruses

The initial TAQman primer and probe sequences 36f and 123r with probe 67T (Mumford et al., 2004) were evaluated. The primers successfully amplified SCV in end-point PCR reactions, however, the probe, as designed, lies to the outside of the amplicon and, thus, did not work. When contacted about the problem, the designers of the system sent the sequences for the 225f/309r/probe (SCV Mark II), as given in Table 1. The Mark II primers and probe successfully amplified and detected SCV from reverse-transcribed extracts with nearly 100% efficiency (Fig.1). The amplicon was cloned and sequenced and the sequence was confirmed as that of SCV. The amplicon, however, was 85 bp in length, 4 bp shorter than expected (R. Mumford, personal communication). The cloned amplicon was grown in its vector, the plasmid separated and subsequently used as the standard for quantification of the qPCR data, presented below. The detection threshold was approximately 4.3 x 10-4 picograms cDNA, which converts to approximately 9000 virions based on an estimate of 14,158 bp within the SCV genome (Schoen et al., 2004). The detection threshold in single aphids was approximately 2.2 x 10 -5 pg cDNA when twice the amount of template was used in the reverse transcription relative to the volume used in RNA extracted from plants. However, this threshold was determined with manual adjustment of the detection limits and was considered unreliable.

Although the three viruses and control are reported to simultaneously detect the viruses in a multiplex PCR reaction (Thompson et al., 2003; Thompson et al., 2004) we had great difficulty in accomplishing this. The cause of this was that the reported multiplex uses different SCV primers than those used here and the amplicon produced by the SCV225F/ SCV309R primer pair is small, hence difficult to distinguish from the ‘primer cloud’ after electrophoresis. Therefore, separate reactions were run for

SID 5 (Rev. 3/06) Page 10 of 18

each set of oligonucleotide primers. This allowed for optimization of electrophoresis conditions to separate SCV-derived amplicons from residual oligonucleotide primers.

Figure 1. Efficiency of the SCV 225f/309r/probe TaqMan viruse detection system

Objective 2: Correlation between symptoms and virus

Symptoms of crinkle disease were significantly correlated with the presence of virus as determined by end-point RT-PCR. Symptoms were most severe in plants co-infected with SCV and SMYEV. SMoV was detected, but with far lower frequency than SCV and SMYEV. One plant was found to be infected with all three viruses. Representative photographs of symptoms and molecular indexing results are in Fig. 2.

Figure 2. Representative photographs of symptoms and results of molecular indexing

A. Symptoms of pure viruses from graft inoculations

Strawberry crinkle virus Strawberry mild yellow edge Strawberry mottle virus

SID 5 (Rev. 3/06) Page 11 of 18

B. Symptoms in the field of pure and mixed infections with PCR identifications of viruses

SCV & SMYEV SCV & SMYEV SCV & SMoV

SCV & SMYEV SCV SCV & SMYEV

SCV SCV SCV & SMYEV

SMYEV SCV & SMYEV SCV & SMYEV

SCV SCV & SMYEV SCV & SMYEV

SMYEV SCV, SMYEV & SMoV SMYEV

Objective 2: Frequency of virus infection in strawberry production and propagation fields

SID 5 (Rev. 3/06) Page 12 of 18

Seven sites were sampled for virus incidence as determined by disease symptoms and by random sampling with assessment by RT-PCR in 2004 and 2005. Symptoms were assessed at seven farms in four counties: three in Kent; two in Staffordshire; and one each in Norfolk and Herefordshire. A further farm was randomly sampled for virus incidence in Norfolk and only two of the sites in Kent were randomly sampled. All other farms were both scouted visually and additionally randomly sampled. The two farms in Norfolk are both sites for propagation of elite planting material, as well as sites for strawberry production. In 2004, cv. Elsanta was sampled at all sites and cv. Alice at six of the seven. In 2005, cv. Alice was replaced by cv. Florence and all sites were resampled.

Virus incidence, as assessed by symptomotology, was generally highest among strawberries that had been in the field longest (Table 4), with third year plantings showing up to nearly 8 % symptomatic plants. Unsurprisingly, symptom expression was highly correlated with positive detection of virus by end-point RT-PCR. Not all symptomatic plants had detectable levels of virus in sampled leaves; virus levels appear to decline with leaf age to below the detection threshold.

Table 4. Incidence of virus symptoms in growers’ fields

Site Cultivar Time since planting (years)

Proportion symptomatic

Percent symptomatic

A: Kent 1 Elsanta 2 22/1500 1.5Alice 2 120/3850 3.1Elsanta 3 204/3000 6.8Alice 3 71/900 7.9Florence 2 39/2400 1.6

B. Kent 2 Elsanta 3 35/880 4.0Florence 3 2/1000 0.2

C: Kent 3 Elsanta 2 2/1000 0.2Alice 2 11/1350 0.8Elsanta 3 0/1000 0.0Florence 2 1/1000 0.1Elsanta 3 4/1000 0.4Florence 3 2/1000 0.2

D: Norfolk 1 Elsanta 2 4/1000 0.4Alice 2 11/1350 0.8Elsanta 2.5 0/1000 0.0Elsanta 3 20/1000 2.0

E: Herefordshire 1 Elsanta 1 1/1997 0.1Elsanta 2.5 122/2700 4.5Elsanta 2 9/1200 0.8Elsanta 2 6/1000 0.6

F: Herefordshire 2 Elsanta 2 84/2015 4.1Alice 2 32/2500 1.3Alice 2 3/1500 0.2

G: Staffordshire Elsanta 2 2/1000 0.2Florence 2 3/800 0.4Florence 1.5 2/1000 0.2

Random samples not necessarily associated with virus symptoms, were also collected and analyzed for the presence of SCV, SMYEV and SMoV by end-point RT-PCR (Table 5). All random samples had been in the field for a minimum of two years. Incidence of SMoV was negligibly low among all farms. However, SCV incidence ranged from 0% to 67% and SMYEV from 0% to 98% per farm site. Most of these infections were latent, even when plants were infected by multiple viruses. The high incidence of latent infection, while surprising, is not inexplicable: Martin and Tzanetakis (2006) in their review of strawberry viruses state that most modern cultivars of strawberry are tolerant of single virus infection and that multiple infections are necessary for full and severe symptom expression.

Table 5. Incidence of virus infection among randomly sampled fields

SID 5 (Rev. 3/06) Page 13 of 18

Site Cultivar SCV SMYEV SMoVKent 1 Alice 14/15 0/15 0/15

Elsanta 39/66 56/66 0/66Florence 19/58 4/58 0/58

Kent 2 Alice 26/39 22/39 1/39Elsanta 3/7 7/7 0/7Florence 30/39 25/39 0/39

Staffordshire 1 Elsanta 0/4 4/4 0/4Staffordshire 2 Elsanta 20/45 2/45 1/45

Florence 16/50 3/50 0/50Norfolk 1 Elsanta 38/126 77/126 0/126

Alice 26/49 0/49 0/49Florence 16/44 0/44 0/44

Norfolk 2 Alice 3/6 0/6 0/6Elsanta 26/48 47/48 0/48

Herefordshire Elsanta 45/77 55/77 0/77

Objective 3: Virus acquisition and transmission by Chaetosiphon fragaefolii

Experiment 1. Aphids were able to acquire virus after 24 h feeding and to transmit it after 14 d. However, frequency of acquisition was low at both 24 h and 72 h, and transmission even lower.

Experiment 2. Aphids were able, again, to acquire SCV after 24 h feeding on infected plants. Frequency of acquisition increased with time, however, no transmission was observed after transfer of aphids to uninfected plants during the course of the experiment.

The results from both experiments are consistent with findings by Frazier (1968) working with a related aphid. He suggested that SCV required far longer periods than does SMYEV for aphids to become viruliferous and further that these periods were longer than those evaluated in our experiments (up to 59 d). We have shown in principle, though, that it is possible to detect virus acquisition in individual aphids and that this may be accomplished after feeding periods as short as 24 h. Transmission apparently (and tentatively) requires a minimum of 14 d post-acquisition in the aphid in order to occur, albeit at low efficiency. Having shown that the methods can be used, it remains to explore variability in virus acquisition and transmission over a range of temperatures, including fluctuating temperatures such as those experienced in the field.

Objective 3: Potentilla reptans and Fragaria vesca as potential reservoirs of virus

We grafted strawberry virus-infected material to members of P. reptans with subsequent use of indicator plants and reverse transcriptase PCR (RT-PCR) to detect infections. In these experiments, positive detection of SMYEV and SCV was obtained from Potentilla.

Symptoms developed and virus infection was confirmed by RT-PCR, as expected, in all accessions of F. vesca demonstrating the efficacy of the grafting protocols for virus transmission. PCR products were cloned and sequenced, confirming that the material was infected with SCV. Very subtle or no virus or virus-like symptoms of infection were observed in P. reptans for more than two months subsequent to having scions of infected UC-5 plants grafted; the plants appeared normal. It has been observed that single virus infections are not particularly dramatic nor severe in most modern cultivars of strawberry (Martin and Tzanetakis 2006). Indeed, only the UC-5 indicator cultivar and the wild F. vesca were markedly affected. When young, asymptomatic leaves from the P. reptans were grafted onto UC-5 indicator plants, symptoms were observed in two of the grafted plants. Both SCV and SMYEV were detected by RT-PCR from RNA extracted from the UC-5s and from the P. reptans showing that P. reptans can act as a latent host of, at least, two strawberry viruses.

The possibility of both P. reptans and F. vesca serving as alternate hosts should be further investigated since both can be found growing near to many commercial strawberry fields. Clean planting material is still the best way to limit virus ingress into commercial plantings, but it may be that management of strawberry relatives, either through isolation or eradication, may be an important adjunct to aphid control in maintaining virus-free strawberry propagation beds.

SID 5 (Rev. 3/06) Page 14 of 18

Further research is needed to show that SCV and SMYEV can be transmitted to P. reptans by aphids and to exclude it as a possible latent host of other viruses such as SMoV, which is vectored by C. fragaefolii and A. gossypii.

Objective 4. Spread of virus in the field

Virus was detectable in the plants most proximal to the nidus of infection within one month to five weeks of introduction of infected plants. Symptoms, however, failed to develop until the following spring. In general, the spread of the virus was radial and, with few exceptions, was consistently detected after the first positive observation of virus. For those plants previously identified as infected, but subsequently producing negative PCR results the titre at detection was consistently very low – near the threshold of detection (e.g. for plant RB17: CT = 38.7 in October 2006, undetected in April 2007). Virus had spread through all three experimental plots by the end of 2007, with few escapes. Virus was first detected in the adjacent plots in August 2006 – all sampled plants were negative when assessed at earlier dates. Eight of 25 random samples were positive for SCV in August 2006 in one plot; zero of 25 at another and two of 25 at the third. No significant correlation was detected between proximity to the initially infested area and virus detection, nor between virus titre and symptom development. The evidence suggests that alate aphids entered the adjacent plots shortly after introducing infected plants to the systematically sampled plots, infected several plants and either departed or died without establishing new populations among these plants.

Aphids were collected in groups from the same plants as were sampled for virus. on several occasions. Aphid abundance was bi-modal within the growing season with an early peak in late April, far fewer in June 2007 and a second peak in autumn 2007. This observation is in agreement with those of Krczal (1982). SCV was detected by RT-qPCR from individual aphids on four occasions in April and June 2007, more frequently when RNA was isolated from groups of aphids (up to 5 aphids), with 18 of 120 collections positive for SCV. Virus titre was higher, on occasion, when detected from single aphids than from collections, indicating either dilution within collections due to several aphids being negative for virus or exceptionally high titre (hence variation) among infectious individuals. Location relative to centres of infection was unimportant in virus detection.

Future work

Several of the milestones of this project were delayed due largely to technical problems. Having resolved many of these, it would be a good investment to continue several aspects of the research. First, a complete sequence of (at least one strain) of SCV should be generated and published. Although a proceedings indicates that this has been accomplished, the authors have decided not to submit the full sequence and wish instead to patent it. A full sequence would allow a better understanding of the replication process, as primers could be developed for upstream segments of the RNA genome relative to the terminal fragments, which are amplified by the currently available primers. Since upstream segments are replicated first, and many of these are aborted before being packaged in coat proteins, development of upstream oligonucleotide primer sets would both improve virus detection and give insight into the efficiency of virus replication in both plant and aphid. Second, correlations between efficiency of detection by molecular methods and by grafting should be established. This would greatly help elucidate our present finding of high frequencies of latent virus infection and may have implications for the indexing and distribution of strawberry runners. Too, the correlations would allow for evaluation of the efficacy of current screening protocols of propagation materials for latent infection. Third, with the improvement of our methodology and timely analysis of material (rather than collection and storage of same), experiments on spread of the disease within fields could be expanded and repeated, so that spread from individually infected plants could be examined. Fourth, with the methods now established, a clearer picture of the acquisition and transmission of virus by aphids can be established by examining the effects of different temperatures on these processes and on fecundity and longevity of aphids. A better understanding of these processes may have implications for growers in timing and frequency of aphid control measures consistent with the goal of pesticide reduction.

References

Blackman, R.L. & Eastop, V.F. (2000). Aphids on the World’s Crops: An Idenitfication and Information Guide. 2nd Edition. Wiley, NY. 324 pp.

SID 5 (Rev. 3/06) Page 15 of 18

Frazier, N.W. (1968). Transmission of strawberry crinkle virus by the dark strawberry aphid, Chaetosiphon jacobi. Phytopathology 58: 165-172.

Krczal, H. Investigations on the biology of the strawberry aphid (Chaetosiphon fragaefolii), the most important vector of strawberry viruses in West Germany. Acta Horticulturae 129: 53-68.

Mabberly, D.J. (2002). Potentilla and Fragaria (Rosaceae) reunited. Telopea, 9, 793-801.

Martin, R.R. & Tzanetakis, I.E. (2006). Characterization and recent advances in detection of strawberry viruses. Plant Disease 90, 384-396.

Mumford, R.A., Skelton, A.L., Boonham, N., Posthuma, K.I., Kirby, M.J. & Adams, A.N. (2004). The improved detection of Strawberry crinkle virus using real-time RT-PCR (TaqMan®). Acta Horticulturae 656: 81-86.

Schoen, C.D., Limpens, W., Moller, I., Greoneveld, L., Klerks, M.M. and Lindner, J.L. (2004). The complete genomic sequence of Strawberry crinkle virus, a member of the Rhabdoviridae. Acta Horticulturae 656:45-50.

Thompson, J.R., Wetzel, S. & Jelkmann, W. (2004). Pentaplex RT-PCR for the simultaneous detection of four aphid-borne viruses in combination with a plant mRNA specific internal control in Fragaria spp. Acta Horticulturae 656: 51-56.

Thompson, J.R., Wetzel, S., Klerks, MM, Vašková, D., Schoen, C.D., Špak, J & Jelkmann, W. (2003). Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control. J. Virolog. Methods 111: 85-93.

Appendix A. Sampling pattern for Objective 4 (spread of virus in the field)

19

alley

alley

alley

alley

26

alley

alley

alley

alley

25

18

11 17

10

9

1 * * * * 820

12 2 * * * * 7 16 24

3 * * * * 64 5

13 1514

SID 5 (Rev. 3/06) Page 16 of 18

21

22

23

References to published material9. This section should be used to record links (hypertext links where possible) or references to other

published material generated by, or relating to this project.

SID 5 (Rev. 3/06) Page 17 of 18

NSA Seminar – Pest and Disease Control in Soft Fruit Propagation. Quy Mills Hotel, Cambridge, 22 February 2005

‘Strawberry diseases – some EMR research’ – oral presentation to visiting soft fruit growers from Sweden, 27 October 2004

Down, G.J. Incidence and epidemiology of strawberry crinkle disease. Plant It, Issue 8 (August 2005)

Cross, J., Fitzgerald, J. & Down G. (2005). Aphids and their control on strawberry. HDC Factsheet 26/05.

A visual presentation on the project was made to visitors at ‘Fruit Focus’ in July 2005.

A talk entitled ‘Application of PCR-based detection to aphid borne viruses of strawberries’ was presented at the Presidential Meeting of the British Society for Plant Pathology in Nottingham (19-21 December 2005)

Yohalem, D. & Lower, K. (in press). Wild and cultivated Potentilla spp. may serve as alternate hosts and possible reservoirs of strawberry viruses. Proceedings of the IOBC Soft Fruit Workshop, East Malling, Kent (23-24 September, 2007)

Yohalem, D., Lower, K. , Harvey, N. & Passey, T. (submitted). Potentilla reptans may serve as an alternate host and possible reservoir of strawberry viruses. European Journal of Plant Pathology

SID 5 (Rev. 3/06) Page 18 of 18

Documents

General enquiries on this form should be made to:randd.defra.gov.uk › Document.aspx?Document=HH32… · Web viewend date 31 March 2008 6. It is Defra’s intention to publish this