KUOPION YLIOPISTON JULKAISUJA G. – A. I. VIRTANEN –INSTITUUTTI 23 KUOPIO UNIVERSITY PUBLICATIONS G.

A. I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES 23

HANNA KANKKONEN

Gene Therapy in the Treatment of Familial Hypercholesterolemia

Evaluation and Development of

Viral Vectors and Gene Transfer Techniques

Doctoral dissertation

To be presented by permission of the Faculty of Natural and Environmental Sciences of the University of Kuopio for public examination in Mediteknia Auditorium, University of

Kuopio, on Friday 3rd December 2004, at 12 noon

Department of Biotechnology and Molecular Medicine A. I. Virtanen Institute for Molecular Sciences

University of Kuopio

Distributor: Kuopio University Library P. O. Box 1627 FI-70211 KUOPIO FINLAND Tel. +358 17 163 430 FAX +358 17 163 410 http://www.uku.fi/kirjasto/julkaisutoiminta/julkmyyn.html Series Editors: Prof. Karl Åkerman, M.D., Ph.D. Department of Neurobiology A. I. Virtanen Institute for Molecular Sciences Research Director Jarmo Wahlfors, Ph.D. Department of Biotechnology and Molecular Medicine A. I. Virtanen Institute for Molecular Sciences Author’s address: Department of Biotechnology and Molecular Medicine A. I. Virtanen Institute for Molecular Sciences University of Kuopio P. O. Box 1627 FI-70211 KUOPIO FINLAND E-mail: Hanna.Kankkonen@uku.fi Supervisor: Prof. Seppo Ylä-Herttuala, M.D., Ph.D. Department of Biotechnology and Molecular Medicine A. I. Virtanen Institute for Molecular Sciences University of Kuopio Reviewers: Docent Katriina Aalto-Setälä, M.D., Ph.D. Department of Medicine University of Tampere Docent Anu Jalanko, Ph.D. Department of Molecular Medicine National Public Health Institute Opponent: Professor Kimmo Kontula, M.D., Ph.D. Department of Medicine University of Helsinki ISBN 951-781-382-1 ISBN (PDF) 951-27-0087-5 ISSN 1458-7335 Kopijyvä Kuopio 2004 Finland

Kankkonen, Hanna. Gene Therapy in the Treatment of Familial Hypercholesterolemia – Evaluation and Development of Viral Vectors and Gene Transfer Techniques. Kuopio University Publications G. – A. I. Virtanen Institute for Molecular Sciences 23. 2004. 111 pp. ISBN 951-781-382-1 ISBN (PDF) 951-27-0087-5 ISSN 1458-7335

ABSTRACT Sustained production of therapeutic protein is fundamental for long-term amelioration of familial hypercholesterolemia (FH), an inherited autosomal disease caused by a mutation in the low-density lipoprotein receptor (LDLR) gene. Moloney murine leukemia virus (MMLV) –based retroviral vectors and lentiviral vectors are capable of integrating into the host cell genome which makes them an attractive tool for stable gene transfer. In this study we evaluated MMLV retroviral vectors and lentiviral vectors, based on human immunodeficiency virus –1 (HIV-1) and feline immuno-deficiency virus (FIV), for their potential as gene delivery tools in conjunction with vascular ex vivo gene transfer and direct in vivo gene transfer to liver and brain.

We developed an ex vivo gene transfer technique into rabbit arterial wall using autologous smooth muscle cells (SMCs) and demonstrated high efficiency local gene transfer in arteries. In addition to targeting local vascular phenomena during surgical procedures, we showed that genetically engineered SMCs can be used as a means of systemic delivery of gene products.

Ex vivo gene therapy for liver disorders such as FH has proven laborious, time consuming and inefficient. In order to circumvent the adversity of ex vivo gene transfer and also the need for liver resection of standard MMLV-retroviral vectors, we generated HIV-1 –based lentiviral vectors encoding rabbit LDLR or green fluorescent protein under the control of a liver-specific promoter (LSP), and evaluated their efficacy and safety in vitro and in vivo. After demonstrating the functionality of the vectors in cell culture, we injected 1×109 infectious virus particles into the portal vein of Watanabe heritable hyperlipidemic (WHHL) rabbits. In addition, we injected another group of WHHL rabbits with MMLV retroviral vectors encoding for human LDLR (LTR-LDLR) or a marker gene. From liver biopsy and tissue samples we showed stable transgene expression and normal liver function and morphology with no sign of major infection or inflammatory changes. LSP-LDLR and LTR-LDLR treatment of WHHL rabbits had a therapeutic effect as it resulted in decreased cholesterol levels in comparison with the control rabbits. Furthermore, the rabbits treated with LDLR exhibited prolonged lifespan. Veterinarian pathological examination of the rabbits in all study groups revealed symptoms mainly related to atherosclerosis. No obvious gene transfer related pathological findings were detected.

For improved vector safety, we constructed a doxycycline (Dox)–regulated self-inactivating HIV-1 lentiviral vector system. Following the verification of the system functionality in vitro, we assessed their applicability in vivo. We demonstrated that the dose-dependent and repeatedly inducible vector system was capable of efficient expression and explicit regulation of the transgene in rat brain in vivo.

In conclusion, this study demonstrates the safety and potential usefulness of HIV-1 lentiviral vectors, and also of the standard MMLV-retroviral vectors, in the treatment of familial hyperchole-sterolemia. Constructing the vector systems towards targeted and regulated expression of a carefully chosen therapeutic gene from a distinct target organ, together with accurate choice of gene delivery approach, have beneficial effects on the safety and efficacy of gene therapy applications.

National Library of Medicine Classification: WD 200.5.H8, QZ 50, QW 168.5.R18 Medical Subject Headings: hypercholesterolemia, familial / therapy; arteriosclerosis; gene therapy; gene transfer techniques; genetic vectors; retroviridae / genetics; lentivirus / genetics; receptors, LDL / genetics; myocytes, smooth muscle; transcription, genetic; promoter regions (genetics); liver; rabbits; rats

Any powerful idea is absolutely fascinating

and absolutely useless until we choose to use it.

― Richard Bach

ACKNOWLEDGEMENTS This study was carried out at the Department of Biotechnology and Molecular Medicine, A. I. Virtanen Institute for Molecular Sciences, University of Kuopio, during the years 1995 – 2004. Numerous individuals have been involved in this study whose contribution I would like to acknowledge.

I wish to express directly my deepest gratitude to Professor Seppo Ylä-Herttuala, my supervisor, for your perceptive scientific guidance, enduring encouragement and unceasing forbearance during all the phases of this study. Discussions with you have broadened my understanding of both science, and life. I never cease to admire your positive attitude, compassionate personality and enthusiasm for science.

It has been a privilege to collaborate with Professor Inder Verma of the Salk Institute (La Jolla, CA, USA). I am grateful for the opportunity to have implemented the lentiviral technology from his lab, and for our scientific discussions and the insights that he shared with me. I am deeply indebted to Dr. Robert Marr for the skilled preparation and analysis of the lentiviral vectors, and for our fruitful correspondence on matters relating to lentiviral vectors and gene therapy.

I wish to thank Professor Wolfgang Hillen and Professor Hermann Bujard for their kind contribution to the tetracycline-regulated lentiviral vector study.

I owe my sincere thanks to the official reviewers of the dissertation, Docent Katriina Aalto-Setälä and Docent Anu Jalanko for their careful revision, valuable comments and constructive criticism in improving this thesis. For the language revision of the thesis, I wish to thank Mr. John Mills.

Over the years, I have had the pleasure of working with a dynamic, innovative and skilful group of researchers with diverse interests and a variety of experience. I owe my sincere thanks to my co-authors for their contribution to this study. I am deeply indebted to Jonna Koponen for her meticulous design and implementation of the regulated lentiviral system and her infinite source of insights concerning molecular biology and lentiviral technology. My warmhearted thanks belong to my dear friend, Elisa Vähäkangas, who with her delightful character has brightened my days and brought joy to many moments in the lab. I wish to express my sincere gratitude to Dr. Mikko Turunen who in his characteristically straightforward manner took part in introducing me to the field of vascular gene therapy and the animal facilities. I am grateful to Dr. Timo Pakkanen and Anniina Laurema for performing the surgical operations on the rabbits. The in vivo gene transfer studies were possible by Timo’s extraordinary talent for surgery and Anniina’s forthright enthusiasm. I am greatly indebted to Pia Leppänen for her endless assistance with design and implementation of PCRs, and Dr. Ivana Kholová for helping me to understand rabbit pathology. I wish to acknowledge Dr. Thomas Wirth, Dr. Mikko Hiltunen, and Jani Kannasto for their contribution to this study.

I also wish to thank Dr. Paula Syrjälä of the National Veterinary and Food Research Institute, Kuopio Regional Laboratory, for performing the veterinarian pathological examinations. I want to express my gratitude to Mervi Nieminen, Anne Martikainen, Tommi Heikura, Virve Immonen, Seija Sahrio, Tiina Koponen, Aila Erkinheimo, and Janne Kokkonen for their skillful technical assistance, and to Jani Räty for his assistance in computing matters. I also wish to thank Marja Poikolainen and Helena Pernu for their invaluable administrative assistance.

The working spirit at the A. I. Virtanen Institute during these years has been unique, and I would like to acknowledge the contribution of the Institute personnel and especially of the members of our research group. I place special value on the friendship of Maija Päivärinta. I have truly enjoyed

our discussions during which we have increased our life expectancy over pizza, tea and hamburgers. My heartfelt thanks belong to Pauliina Lehtolainen, Johanna Laukkanen, and Stefanie Maurer, dear friends and valued colleagues, with whom I have had the honor to share life’s ups and downs, and equally the ups and downs of science. I want to extend my sincere thanks to my valued friend, Dr. Reitu Agrawal for her constructive criticism on many aspects of science, and of life. I thank Helena Viita for introducing me to cell culture techniques, and value her kinship in scientific ambition. I thank Dr. Mikko Laukkanen for the memorable field trips he organized to North Karelia. I wish to thank my valued coworkers Anna-Mari Turunen and Päivi Turunen, with whom I have had the extraordinary pleasure of sharing an office, and Dr. Annaleena Heikkilä, Dr. Marja Hedman and Hanna Sallinen for their friendship and for sharing the experience of pregnancy and motherhood. I am also grateful to Dr. Jarmo Wahlfors for his advice on lentiviral technology, and to Dr. Yashpal Agrawal for introducing me to the field of flow cytometry.

I want to extend my sincere thanks to the personnel of the University of California, San Diego, especially to Professor Theodore Friedmann and Dr. Atsushi Miyanohara for their expert scientific guidance. I also wish to thank Dr. Sean Page and Dr. Cellia Habita for sharing many memorable moments by the bench and beyond, and Mark Freeman for his help with US bureaucratic procedures.

For providing perspective on life, I thank my cherished friends Tanja Vähämäki, Satu Syrjänen and Niina Saikanmäki. In particular, Tanja, thank you for being a lifelong friend!

My most heartfelt thanks belong to my dear husband, Tapsa, for his remarkable support and understanding, patience and love, and to our beloved daughter, Tinka, for filling my days with love beyond comprehension. I dedicate my warmest thanks and highest appreciation to my family, my parents, Marja and Matti for their endless support, and for their loving resort home for Tinka, my sister, Jaana, for her emotional support with words of encouragement and never-failing faith in me, my godson, Mikael, for his thought-provoking questions and opinions on a variety of matters, and Pipsa, my furry friend, for keeping me company during the lonely times. I also want to express my appreciation for my sister-in-law, Taru, for her being such a loving godmother to Tinka.

Lempäälä, November 2004

Hanna Kankkonen

This study was supported financially by grants from the Academy of Finland, the National Technology Agency of Finland (TEKES), the Commission of the European Communities, the Saastamoinen Foundation, the Finnish Foundation for Cardiovascular Research, the Finnish Cultural Foundation of Northern Savo, the Sigrid Juselius Foundation, the Jenny and Antti Wihuri Foundation, the Emil Aaltonen Foundation, the Maud Kuistila Foundation, the Ida Montin Foundation, and the Kuopio University Foundation.

ABBREVIATIONS

AAV Adeno-associated virus ABP α1-microglobulin/bikunin promoter ACAT Acyl coenzyme A:cholesterol Ad Adenovirus ADA Adenosine deaminase ADH6 Alcohol dehydrogenase-6 AFOS Alkaline phosphatase AIDS Acquired immune deficiency syndrome ALAT Alanine aminotransferase ANOVA Analysis of variance apo Apolipoprotein apobec-1 ApoB mRNA editing polypeptide 1 ASAT Aspartyl aminotransferase ASGP Asialoglycoprotein cDNA Complementary DNA CHD Coronary heart disease CMV Cytomegalo virus cppt Central polypurine tract CRP C-reactive protein DiI 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate DNA Deoxiribonucleic acid Dox Doxycyclin EBV Epstein-Barr virus EGF Epidermal growth factor EIAV Equine infectious anemia virus ELISA Enzyme linked immuno sorbent assay ER Endoplasmic reticulum FLDB Familial ligand-defective apo B FH Familial hypercholesterolemia FH-NK FH – North Karelia FIV Feline immunodeficiency virus FIX Clotting factor IX GFP Green fluorescent protein hAAT Human α1-antitrypsin HAEC Human amniotic epithelial cells HBV Hepatitis B virus HDL High density lipoprotein HERV Human endogenous retrovirus HIV Human immunodeficiency virus HLP Hyperlipoproteinemia HMG-CoA 3-hydroxy-3-methylglutaryl coenzyme A HSV Herpes Simplex virus HTG Hypertriglyceridemia ICC Immunocytochemistry IDL Intermediated density lipoprotein IHC Immunohistochemistry INSIG Insulin-induced gene IRES Internal ribosomal entry site

kDa Kilo Dalton lacZ β-galactosidase LDL Low density lipoprotein LDLR LDL receptor LPDS Lipoprotein deficient serum LRP LDLR-related protein LSP Liver specific promoter LTR Long terminal repeat MLV Murine leukemia virus MMLV Moloney murine leukemia virus mRNA Messenger RNA NZW New Zealand White ORF Open reading frame OTC Ornithine transcarbamylase PCR Polymerase chain reaction PEG Polyethylene glycol PEPCK Phosphoenolpuryvate carboxykinase RCV Replication competent virus RNA Ribonucleic acid RRV Ross river virus RRV-G Ross River virus glycoproteins RT-PCR Reverse transcriptase polymerase chain reaction rtTA Reverse tetracycline-transactivator SAE Severe adverse event SCAP SREBP cleavage-activating protein SCID Severe combined immunodeficiency disease SD Standard deviation SEM Standard error of mean SIN Self-inactivating SIV Simian immunodeficiency virus SMC Smooth muscle cell SRE Sterol regulatory element SREBP SRE binding proteins SV40 Simian virus 40 SV-F Sendai virus glycoprotein F TBG Thyroid hormone-binding globulin Tc Tetracycline tetO Tc resistance operator tetR Tc resistance repressor protein TG Triglyceride tTA Tc-regulated transactivator tTS Tc-responsive transcriptional silencer TU Transducing unit VLDL Very low-density lipoprotein VLDLR VLDL receptor VSV-G Vesicular Stomatitis virus G-glycoprotein WHHL Watanabe Heritable Hyperlipidemic WPRE Woodchuck hepatitis virus post transcriptional element

LIST OF ORIGINAL PUBLICATIONS This study is based on the following original articles, which are referred to in the text body by the corresponding Roman numerals (I – IV):

I. Kankkonen HM, Turunen MP, Hiltunen MO, Lehtolainen P, Koponen J, Leppänen P, Turunen A-M and Ylä-Herttuala S (2004) Feline Immuno-deficiency Virus and Retrovirus-Mediated Adventitial Ex Vivo Gene Transfer to Rabbit Carotid Artery using Autologous Vascular Smooth Muscle Cells. J. Mol. Cell. Cardiol. 36: 333-41.

II. Kankkonen HM, Vähäkangas E, Marr RA, Pakkanen T, Laurema A, Leppänen P,

Jalkanen J, Verma IM and Seppo Ylä-Herttuala (2004) Long-Term Lowering of Serum Cholesterol Levels in LDL-Receptor Deficient WHHL Rabbits by Gene Therapy. Mol. Ther. 9:548-56.

III. Kankkonen HM, Pakkanen TM, Vähäkangas E, Laurema A, Kholová I, Hedman M, Marr RA, Verma IM & Ylä-Herttuala S (2004) Long-Term Safety Study of Liver-Directed In vivo Gene Transfer with Moloney Murine Retroviruses and Lentiviruses in Watanabe Heritable Hyperlipidemic Rabbits. (submitted)

IV. Koponen JK, Kankkonen H, Kannasto J, Wirth T, Hillen W, Bujard H and Ylä-Herttuala S (2003) Doxycycline-Regulated Lentiviral Vector System with a Novel Reverse Trans-activator rtTA2S-M2 Shows a Tight Control of Gene Expression In Vitro and In vivo. Gene Ther. 10: 459-66.

TABLE OF CONTENTS 1. INTRODUCTION...............................................................................................15

2. REVIEW OF THE LITERATURE ..............................................................................17

2.1. Cholesterol metabolism ..............................................................................17 2.1.1. LDL-cholesterol and atherosclerosis.................................................... 19

2.2. Familial hypercholesterolemia .....................................................................19 2.2.1. Clinical features ............................................................................... 19 2.2.2. Phenotypic variation ......................................................................... 20 2.2.3. Prevalence of FH.............................................................................. 21 2.2.4. Molecular bases............................................................................... 21

2.2.4.1. LDL receptor ......................................................................... 21 2.2.4.2. Ligands for LDLR.................................................................... 22 2.2.4.3. Receptor-mediated endocytosis of LDL..................................... 24 2.2.4.4. LDL uptake via LDLR independent pathway............................... 25 2.2.4.5. Regulation of cellular cholesterol levels.................................... 25

2.2.5. Gene defects ................................................................................... 26 2.2.5.1. Gene defects associated with monogenic hypercholesterolemia . 26 2.2.5.2. Functional defects of LDLR...................................................... 26 2.2.5.3. FH in Finland ........................................................................ 27

2.2.6. Diagnosis and current treatment methods ........................................... 28 2.2.7. Animal models of FH ........................................................................ 29

2.3. Gene therapy ............................................................................................30 2.3.1. Definition......................................................................................... 30 2.3.2. Gene transfer vectors........................................................................ 30

2.3.2.1. Viral gene transfer vectors ...................................................... 31 2.3.2.1.1. MLV retroviral vectors .................................................. 31 2.3.2.1.2. Lentiviral vectors ......................................................... 34 2.3.2.1.3. AAV vectors................................................................ 37 2.3.2.1.4. Adenoviral vectors ...................................................... 38 2.3.2.1.5. Other viral vectors ...................................................... 39

2.3.2.2. Non-viral gene transfer vectors ............................................... 42 2.3.3. Development of targeted and regulated gene transfer vectors ............... 43

2.3.3.1. Targeted vectors .................................................................... 44 2.3.3.1.1. Targeting cell surface receptors .................................... 44 2.3.3.1.2. Transcriptional targeting .............................................. 45 2.3.3.1.3. Gene targeting ........................................................... 46

2.3.3.2. Transcriptionally regulated vectors........................................... 47 2.3.3.2.1. TetON, TetOFF .......................................................... 47

2.3.4. Gene transfer techniques .................................................................. 49 2.3.4.1. Vascular gene transfer............................................................ 49 2.3.4.2. Liver-directed gene transfer..................................................... 51

2.3.4.2.1. Delivery route ............................................................. 51 2.3.4.2.2. Vectors for liver-directed gene transfer .......................... 52

2.3.5. Apolipoproteins in gene therapy for hyperlipidemia.............................. 53 2.3.5.1. Apo E................................................................................... 53 2.3.5.2. ApoA-I, apoA-IMilano ................................................................ 55 2.3.5.3. Apobec-1 ............................................................................. 56

2.3.6. Human gene therapy ........................................................................ 56 2.3.7. FH gene therapy .............................................................................. 57

2.3.7.1. Ex vivo approach ................................................................... 57 2.3.7.2. In vivo approach ................................................................... 58

3. AIMS OF THE STUDY.........................................................................................62

4. MATERIALS AND METHODS ...............................................................................63

5. RESULTS AND DISCUSSION...............................................................................68

5.1. Article I .....................................................................................................68 5.1.1. Adventitial ex vivo gene transfer resulted in efficient gene expression ..... 68 5.1.2. Gene expression was transient ........................................................... 69 5.1.3. Extrahepatic apo E expression resulted in elevated plasma cholesterol levels ... 69

5.2. Articles II and III .........................................................................................70 5.2.1. Liver-specific lentiviral vectors were functional in vitro........................... 70 5.2.2. Liver-directed gene transfer resulted in a long-term therapeutic effect and

stable transgene expression in WHHL rabbits ........................................... 71 5.2.3. Transgene expression was liver-specific............................................... 73 5.2.4. Liver-directed in vivo gene therapy proved safe.................................... 74

5.2.4.1. Animal well-being and survival................................................ 74 5.2.4.2. Liver function and histology after gene transfer ......................... 74 5.2.4.3. Pathology, SAE...................................................................... 74 5.2.4.4. Biodistribution ....................................................................... 76 5.2.4.5. Provirus integration and possibility of insertional mutagenesis .... 76

5.3. Article IV ...................................................................................................77 5.3.1. Dox-regulated HIV-1 vector system showed tight control of gene expression.... 77

5.4. Aspects of the future development of gene delivery strategies ..........................78

6. SUMMARY AND CONCLUSIONS........................................................................79

7. REFERENCES.....................................................................................................80

Appendix: Original publications (I – IV)

15

1. INTRODUCTION

The development of safe, efficient and versatile gene therapy tools and methodology for the treatment of various diseases caused by a single gene defect or more complex multifactorial diseases has been the aspiration of numerous studies ever since the early history of gene therapy. Familial hypercholesterolemia (FH) was among the first monogenic diseases treated with gene therapy. This metabolic disorder is caused by the inherited deficiency of the low density lipoprotein (LDL) –receptor (LDLR); and in the homozygous form is a lethal disorder obstinate to other treatments, such as LDL apheresis and liver transplantation (Goldstein et al., 2002). The first protocol for FH gene therapy, initially utilized in animal models (Wilson et al., 1990; Chowdhury et al., 1991; Raper et al., 1992), and later in humans (Grossman et al., 1994; Grossman et al., 1995), was an ex vivo approach in which recombinant amphotropic retroviral vectors carrying the LDLR gene were used to transduce autologous hepatocytes which were subsequently transplanted back into the liver via the portal circulation. The method was both laborious and time consuming, and resulted in only a modest lipid-lowering effect. Even though further developments have been reported in ex vivo gene transfer methods (Nguyen et al., 2002; Giannini et al., 2003), the direct in vivo approach offers an attractive alternative for liver gene therapy (Ylä-Herttuala and Martin, 2000). In addition to being less invasive, in vivo gene therapy benefits from recent advances in targeted vector development (Lundstrom, 2003).

In vivo targeting to the liver has been performed by injecting DNA or viral vectors into the liver parenchyma (Kuriyama et al., 2000), splenic capsule (Chen et al., 2000), hepatic artery (Raper et al., 2002), or portal vein (Kozarsky et al., 1994; Pakkanen et al., 1999b). In the study of Pakkanen et al. (Pakkanen et al., 1999b) a maximum of 35% reduction in total plasma cholesterol levels was achieved 2 – 3 months after Moloney murine leukaemia virus (MMLV) –based retrovirus-mediated in vivo gene transfer via portal vein when a combination of 10% liver resection and thymidine kinase – ganciclovir treatment was used to stimulate hepatocyte proliferation prior to gene transfer. In contrast to MMLV-retroviruses, lentiviruses are capable of integrating into the chromosomes of non-dividing hepatocytes leading to long-term transgene expression without the need for target cell proliferation induction (Kafri et al., 1997). Hence, they are considered a valuable candidate for liver gene therapy.

In this study we aimed to evaluate the potential of stable gene expression from MMLV-based retroviral vectors and human immunodeficiency -1 (HIV-1) –based and feline immunodeficiency (FIV) –based lentiviral vectors to treat FH in a hypercholesterolemic rabbit model after vascular ex vivo gene transfer of human apolipoprotein (apo) E3 and after in vivo injection of LDLR gene into the liver via the portal vein. To improve safety and to overcome the constraint of non-specific and uncontrolled gene expression, a third-generation self-inactivating (SIN) HIV-1 lentiviral vector containing several enhancer and liver-specific promoter elements was produced for targeted transgene expression, and a doxycycline (Dox)-regulated SIN lentiviral vector system was constructed for regulated expression of the transgene.

16

Our results suggest that adventitial ex vivo gene therapy may be utilized for targeting local vascular phenomena during surgical procedures as well as for systemic delivery of gene products. Our results also indicate that MMLV-retroviral vectors as well as third-generation liver-specific lentiviral vectors have potential for the safe and long-term amending of LDLR deficiency in Watanabe Heritable Hyperlipidemic (WHHL) rabbits, an animal model for human FH. Furthermore, liver-specific lentiviral vectors resulted in efficient gene expression in the liver without the need for liver resection. Dox-regulated lentiviral vectors show potential for improving the safety of in vivo gene therapy.

17

2. REVIEW OF THE LITERATURE

2.1. Cholesterol metabolism

Cholesterol is an important structural component of cell membranes and a precursor molecule for the synthesis of steroid hormones, bile acids and vitamin D (Tabas, 2002). The cellular requirement for cholesterol is satisfied either by de novo synthesis within the cell (Fig. 1) (Liscum, 2002), or by being supplied from extra-cellular sources. Cholesterol accumulating within the cell above the amount capable of being utilized by the cell is esterified with a long-chain fatty acid and stored within the cytoplasm as cholesteryl ester droplets. Efflux of excess cholesterol from the peripheral tissues occurs via reverse cholesterol transport, a pathway necessary to maintain cellular cholesterol homeostasis (Groen et al., 2004).

Lipoproteins Both de novo synthesized cholesterol and cholesterol derived from the diet are transported in the plasma predominantly as cholesteryl esters associated with lipoprotein particles. Lipoprotein particles are spherical with a central core of nonpolar lipids (primarily triglycerides and cholesteryl esters) and a surface monolayer of polar lipids (primarily phospholipids) and noncovalently bound apoproteins (Havel and Kane, 2002). Lipoproteins are classified by the type and ratio of protein and lipids that they contain, which determines their size and density (Table 1).

Cholesterol absorption from diet: chylomicron pathway Dietary triglycerides and cholesterol are transported from the site of absorption (small intestine) to liver and peripheral tissues within chylomicrons (Fielding and Firlding, 2002). In the capillaries of adipose tissue and muscle, lipoprotein lipase catalyzes the hydrolysis of the triglycerides resulting in the formation of chylomicron remnants. Because of lipolysis, the surface of the particles is reorganized to consist primarily of apo B-48, apo E, and the apo Cs. These partially triglyceride-depleted, cholesterol-enriched particles are rapidly and efficiently cleared from the circulation by the liver, through the interaction of apo E with LDLR family (Mahley and Rall, Jr., 2002) (see Chapter 2.2.4.2).

2 Acetyl-CoA ↓

Acetoacetyl-CoA ↓

HMG-CoA ↓ HMG-CoA reductase Mevalonate ↓ ↓

Isopentenyl pyrophosphate (IPP) ↓ ↓

Farnesyl pyrophosphate ↓

Squalene ↓

Lanosterol ↓ demethylation, ↓ decarboxylation, migration, ↓ reduction of double bonds Cholesterol ↓

Steroids, Bile acids, Membrane biogenesis

FIG. 1 Cholesterol biosynthesis

2 Acetyl-CoA ↓

Acetoacetyl-CoA ↓

HMG-CoA ↓ HMG-CoA reductase Mevalonate ↓ ↓

Isopentenyl pyrophosphate (IPP) ↓ ↓

Farnesyl pyrophosphate ↓

Squalene ↓

Lanosterol ↓ demethylation, ↓ decarboxylation, migration, ↓ reduction of double bonds Cholesterol ↓

Steroids, Bile acids, Membrane biogenesis

FIG. 1 Cholesterol biosynthesis

18

TABLE 1. Composition of the major human plasma lipoproteins

Lipo-protein

Source Apolipoproteins %

Protein

Core lipids

%TG / %CE

Diameter (nm)

Density (g/ml)

Chylo-microns

Intestine A (I,II,IV), B-48, C (I,II,III), E

2 86 / 3 75 – 100 <0.95

VLDL Liver B-100, C (I,II,III), E 8 55 / 12 30 – 80 0.93 – 1.006

IDL VLDL B-100, C (I,II,III), E 19 23 / 29 25 – 35 1.006 – 1.019

LDL VLDL B-100 22 6 / 42 18 – 25 1.019 – 1.063

HDL2, HDL3

intestine, liver: chylomicrons, VLDL

A (I,II,IV), C (I,II,III), D, E

40-55 3 – 5 / 13 – 17

5 – 12 1.063 –

1.21

VLDL and LDL pathway Cholesterol synthesized by the liver, or dietary cholesterol reaching the liver via chylomicron pathway, is packaged by hepatocytes into very low density lipoprotein (VLDLs) and secreted into the blood (Fielding and Firlding, 2002). In the circulation VLDL undergoes a lipolytic cascade and is either directly cleared by the liver or converted to progressively smaller and cholesterol-enriched intermediate density lipoproteins (IDLs) and finally LDLs. In humans, about half of the VLDL remnants are eventually converted to LDL. During lipolysis, VLDL remnants become relatively depleted in all protein components except apo B-100, leaving apo B-100 as the exclusive protein component of LDL. LDLs are taken up by cells via LDL receptor-mediated endocytosis (see Chapter 2.2.4.3). The uptake of LDL occurs predominantly in liver (75%), adrenals and adipose tissue.

Reverse cholesterol transport: HDL pathway Reverse cholesterol transport allows excess peripheral cholesterol to be returned to the liver for excretion into the bile (Groen et al., 2004). Lipid-poor apo A-I promotes efflux of cholesterol and phospholipids found in plasma membranes via interaction with the adenosine triphosphate– binding cassette protein A1. The lecithin-cholesterol acyltransferase enzyme converts unesterified cholesterol into cholesteryl ester within high-density lipoproteins (HDLs). Selective uptake of high density lipoprotein (HDL) cholesteryl esters by the liver is mediated by the scavenger receptor class BI. In exchange for triglycerides, the cholesteryl esters can be transferred from HDL to VLDLs and LDLs via the action of HDL-associated cholesteryl ester transfer protein. Ultimately, cholesterol is excreted in the bile as free cholesterol or as bile salts after conversion to bile acids in the liver. From the intestine cholesterol can either be reabsorbed or excreted in the feces. On average, about half of all cholesterol entering the intestine is absorbed, but the fractional absorption rate varies significantly among individuals.

19

2.1.1. LDL-cholesterol and atherosclerosis

The presence of LDLR and reverse (HDL) cholesterol transport pathways allows for a sensitive regulation of cellular cholesterol content throughout the body. Unfortunately, this regulation is not always flawless. Absorption of excess cholesterol can potentially increase the amount of cholesterol stored in the liver. This, in turn, can result in increased VLDL secretion, and subsequent LDL formation, and also down regulation of hepatic LDLR activity (Turley, 2004). Such events will potentially increase plasma LDL-cholesterol levels. Defects in the cholesterol metabolism can further induce accumulation of cholesterol in the periphery causing cardiovascular disease.

Atherosclerosis is a life-long process that begins with innocuous fatty streaks in childhood (Ylä-Herttuala et al., 1986; Stary, 2000) and progresses through several stages of plaque formation and gradual narrowing of the large arteries to subsequent heart attacks, strokes and peripheral vascular disease (Lusis, 2000). As a major cholesterol-carrying lipoprotein in human plasma, LDL plays a major role in the development of atherosclerosis and coronary heart disease (CHD). The central process in the development of atherosclerosis is the infiltration of atherogenic cholesterol-rich lipoproteins, including LDL and VLDL, into the artery wall where subendothelial macrophages are activated by oxidized LDL particles via the scavenger receptor pathway (Steinberg, 2002). Total cholesterol levels of >6mmol/l in the circulation are associated with substantially increased risk of CHD. According to the current hypotheses, a priming factor in the development of atherosclerotic plaques is endothelial dysfunction due to oxidative stress, inflammation, infectious micro-organisms, or shear stress (Ross, 1999).

Generally atherogenesis is considered a polygenic disease and numerous candidate genes are proposed (Novelli et al., 2003; Chaer et al., 2004). In addition to environmental factors such as hypertension, diabetes, cigarette smoking and obesity, gene mutations affecting any of the metabolic pathways involved in the development of atherosclerosis may contribute to the risk of CHD. Not all cardiovascular diseases are polygenic in nature, and among patients with CHD onset before the age of 55, about 5% of cases are attributable to heterozygous FH.

2.2. Familial hypercholesterolemia

2.2.1. Clinical features

FH was the first genetic disease of lipid metabolism to be clinically and molecularly characterized (Goldstein and Brown, 1974). It is a dominantly inherited autosomal disease characterized by extremely high levels of plasma cholesterol and LDL, which contribute to the formation of cutaneous and tendon xanthomas, arcus corneae and premature cardiovascular disease. Clinically identified FH usually results from defects in the LDLR gene (see Chapter 2.2.4). Homozygous deficient patients with two abnormal LDLR genes, either identical or different mutant genes, typically exhibit life-threatening coronary atherosclerosis and subsequent myocardial infarction before age 30 (Goldstein et al., 2002).

20

Plasma lipids Deficiency of LDLR in FH patients results in accelerated cholesterol synthesis in cells and delayed clearance of LDL from the blood circulation (Goldstein et al., 2002). The mean plasma cholesterol level in FH heterozygotes is on average 9mmol/l. However, great biochemical and clinical variability is present among FH heterozygotes, even within a single family. In FH homozygotes the mean value of plasma cholesterol ranges from 15mmol/l to 30mmol/l. The concentration of LDL cholesterol found in homozygotes is about two to three times that found in heterozygotes, and six times higher than in normal subjects whereas HDL cholesterol levels are slightly lower in FH patients than in normal subjects. The mean value of plasma triglycerides in FH heterozygotes or homozygotes is not significantly different from that of the general population.

2.2.2. Phenotypic variation

Mutation heterogeneity of the LDLR (see Chapter 2.2.5.2) causes phenotypic variation in FH homozygotes. The severity of the homozygous disease can be classified according to the amount of functional LDLR activity. In the most severe form, less than 2% of normal receptor activity is detected in the patients’ cultured fibroblasts, coronary deaths are most frequent, and untreated patients rarely survive beyond the second decade of life (Goldstein et al., 2002).

In FH heterozygotes such genotype–phenotype correlation is less clear. In heterozygous patients, clinical expression of coronary disease is influenced by, besides the LDLR gene defect, behavioral, environmental and genetic factors (Jansen et al., 2002). Age, male gender, cigarette smoking, hypertension, western-type diet, severe maternal hypercholesterolemia and infection or inflammation have been associated with increased risk of lethal cardiovascular heart disease in FH heterozygotes (Pimstone et al., 1998; Kontula et al., 1999; Vuorio et al., 2001). While a common polymorphism of apo E (see Chapter 2.2.4.2) accounts for considerable variability in plasma LDL levels and therefore affects the risk of CHD (Eichner et al., 2002), the role of apo E polymorphism as a risk factor of CHD in FH is, to some extent, controversial. Apo E4 phenotype has in some studies been associated with elevated plasma LDL levels (Eto et al., 1988) and lower HDL cholesterol levels (Wiegman et al., 2003b), and apo E2 allele with increased plasma triglyceride levels (Hopkins et al., 1991; Vuorio et al., 1997c) in FH patients. However, many others claim that there is no statistically significant difference in plasma LDL cholesterol levels or coronary disease in the frequency of any of the apo E2, apo E3, or apo E4 alleles between heterozygotes and the control population (Berglund et al., 1993; Ferrieres et al., 1995; Mozas et al., 2003). Further, a high level of lipoprotein (a), an LDL particle bearing an additional apo (a) protein attached by a disulfide bond to the apo B component, has been suggested to be a potential factor affecting the incidence of myocardial infarctions in FH heterozygotes (Seed et al., 1990; Wiklund et al., 1990; Wiegman et al., 2003a). However, contradictory results have also been presented (Mbewu et al., 1991; Carmena et al., 1996; Mozas et al., 2003). Moreover, several other common genetic variables have been associated with the lipid phenotype and the risk of CHD in FH heterozygotes (Tai et al., 2003; Bertolini et al., 2004).

21

2.2.3. Prevalence of FH

FH is the most common and most severe form of monogenic hypercholesterolemia. In most countries the prevalence of the heterozygous form of FH, in which a defective gene for the LDLR is inherited from one parent and a normal gene from another, is 1:500 and that of the homozygous form of FH is 1:1,000,000 individuals, which renders FH probably the most common disease caused by a single-gene mutation in humans (Goldstein et al., 2002). It has been estimated that worldwide there are 10,000,000 people with FH of whom less than 10% are diagnosed, and less than 25% treated with LDL-lowering drugs (Civeira, 2004). In many cases the diagnosis is missed until a dramatic clinical event occurs.

In a small number of genetically relatively isolated communities the prevalence of heterozygous FH is much higher than in most populations. In these populations, few DLR mutations predominate. Increased prevalence of FH due to the founder effect can be detected in such populations as Ashkenazi Jews, Afrikaans-speaking white South Africans, French Canadians, Lebanese Christian Arabs, Icelanders and Finns (Austin et al., 2004).

2.2.4. Molecular bases

2.2.4.1. LDL receptor

FH is caused by a mutation in the gene coding for the LDLR. The 45kb human LDLR gene contains 18 exons and 17 introns (Südhof et al., 1985) and is mapped to chromosome 19 (Francke et al., 1984) in bands p13.1-13.3 (Lindgren et al., 1985) (Fig. 2). The 5.3kb human LDLR mRNA codes for a ubiquitous 115-kDa transmembrane glycoprotein of 839

amino acids (Yamamoto et al., 1984). The translation of LDLR mRNA into the polypeptide chain for the receptor protein takes place on the surface-bound ribosomes of the rough endoplasmic reticulum (ER) (Hobbs et al., 1990; Goldstein et al., 2002). The precursor-protein with added immature O-linked carbohydrate chains is transported from the rough ER to the Golgi complex, where the O-linked sugar chains are elongated. The signal sequence encoded by exon 1 is cleaved from the protein during translocation into the ER, and about 45 min after synthesis, LDL receptors appear on the cell surface, where they gather in clathrin-coated pits (see Chapter 2.2.4.3).

The LDLR protein consists of five distinguishable domains (Figs. 2 and 3). The 292 amino acid ligand-binding domain at the amino-terminal end of the receptor is assembled from seven imperfect cysteine-rich tandem repeats of the 40 amino acids involved in apo B

LDLR gene on chromosome 19

5’ 3’

EXONS 1 2 3 4 65 7 8 9 10 1112 1314 15 18

Signal sequence

Ligandbinding

EGF p recursorhomology O-liked sugars

TransmembraneCytoplasmic

RNA = 5.3kbm

45kb

DOMAINS

1716

FIG. 2 LDLR gene and functional domains encoded by exons 1 -18.

22

and apo E binding. The epidermal growth factor (EGF) precursor homology domain, encoded by exons 7 to 14, is responsible for the acid-dependent dissociation of the receptor from its ligand, its subsequent recycling and also the correct positioning of the ligand-binding domain on the cell surface. It consists of a β-propeller region containing the consensus sequence Tyr-Trp-Thr-Asp flanked with EGF repeats (Jeon et al., 2001). The serine/threonine-linked (O-linked) sugar domain located just outside the plasma membrane serves as an attachment domain for numerous O-linked carbohydrates. The functional importance of this glycosylated domain is unclear; however, one role of glycosylation is thought to be the stabilization of the receptor proteins (Kingsley et al., 1986). The hydrophobic membrane-spanning domain anchors the receptor to the cell surface. The short stretch of 50 amino acids in the cytoplasmic domain is involved in the targeting of the receptor protein to coated pits and the receptor basolateral targeting in the liver.

LDLR sequence and structure are highly conserved. The cDNA sequence of the mouse LDLR (Polvino et al., 1992) and hamster LDLR (Bishop, 1992) shows 78% homology with the human gene. The most conserved domain is the cytoplasmic domain, which shows homologies of up to 90% between humans and other species (Russell et al., 1983; Yamamoto et al., 1986; Lee et al., 1989; Mehta et al., 1991; Hoffer et al., 1993; Hummel et al., 2003).

2.2.4.2. Ligands for LDLR

LDLR belongs to the LDLR gene family, a multifunctional and evolutionarily conserved group of cell-surface receptors, which, in addition to other roles in various cellular processes including signal transduction, mediate the cellular uptake of a diverse spectrum of extra-cellular ligands, including lipoproteins (Schneider and Nimpf, 2003). The primary role of LDLR is to remove cholesterol carrying lipoproteins, particularly LDL arising from the lipolysis of VLDL, from plasma circulation (Brown and Goldstein, 1986). The majority of the LDL is removed from circulation by the liver through the LDLR-mediated endocytosis (see Chapter 2.2.4.3), and, to a lesser extent, via other receptor and non receptor-mediated pathways (see Chapter 2.2.4.4). The LDLR binds with high affinity both apo B, a high molecular mass (550kDa) protein, containing LDL-particles, and apo E containing VLDL, IDL and chylomicron remnant particles (Rudenko and Deisenhofer, 2003). Multiple copies of lipoproteins containing apo E bind to LDLR with up to 20-fold higher affinity than

Ligand-bindingdomain

O-linked sugars

Transmembranedomain

Cytoplasmic domain

β-propeller

EGF-repeat

EGF-repeats

NH3+

COOH

R1

R2

R3

R4

R5

R6

R7

LDL

ApoB-100

FIG. 3 LDLR protein and ligand binding

23

LDL containing only one copy of apo B (Mahley, 1988). Binding involves Ca2+ -dependent proper folding and disulphide bond formation within the conserved acidic residues of the LDLR ligand binding domain characterized by a tryptophan and a stacking of histidine residues (Prevost and Raussens, 2004). It is suggested that the resulting hydrophobic concave face on the opposite side of the Ca2+ cage interacts with the basic amino acids of the lipoproteins.

Four other mammalian receptors of the LDLR family have been recognized to bind apo B or apo E containing lipoproteins with high affinity. These are the VLDL receptor (VLDLR) (Takahashi et al., 1992), apo E receptor 2 (Kim et al., 1996), the LDLR related protein (LRP) (Beisiegel et al., 1989; Kowal et al., 1989), and megalin (LRP-2) (Willnow et al., 1992; Stefansson et al., 1995).

Apolipoprotein E Human apo E regulates multiple metabolic pathways and plays an important role in the transportation and redistribution of lipoproteins by mediating the binding of lipoproteins containing apo E, i.e. chylomicron and its remnant, VLDL, IDL and a subclass of HDL, with different families of receptors including the LDLR family and cell-surface heparan sulfate proteoglycans (Mahley and Huang, 1999). The 34kDa apo E protein contains two independently folded functional domains separated by thrombin cleavage (Weisgraber, 1994). The 22-kDa N-terminal domain contains the receptor-binding region. The 10-kDa C-terminal domain is responsible for lipoprotein binding resulting in conformational change and greater positive electrostatic potential (Raussens et al., 2003), which probably explains the prerequisite of lipid association for high affinity binding to the LDLR (Innerarity et al., 1983).

Human apo E gene is composed of 299 amino acids and is located on chromosome 19 (Olaisen et al., 1982; Das et al., 1985). It exists in three common isoforms, apo E2, apo E3, and apo E4, arising from polymorphism of the apo E gene (Zannis and Breslow, 1981; Davignon et al., 1988). This polymorphism has profound effects on the biological functions of apo E and is associated with variations in plasma cholesterol level. The apo E2 allele exhibits defective binding to the LDLR and is associated with type III hyperlipo-proteinemia (HLP) (Kypreos et al., 2003), while apo E4 allele is associated with high plasma cholesterol level, with an increased risk for CHD (Chen et al., 2003) and Alzheimer’s disease (Weisgraber and Mahley, 1996).

Apo E is synthesized mainly in the liver hepatocytes and brain, but also in other tissues including the kidney and adrenal glands; and by many different cell types including parenchymal cells, differentiated macrophages, monocytes, astrocytic glial cells, ovarian granulosa cells, smooth muscle cells and keratinocytes (Mahley, 1988). Apo E synthesized locally by monocytes and macrophages in vessels appears to protect against the development of atherosclerosis (Bellosta et al., 1995; Shimano et al., 1995; Fazio et al., 1997; Hasty et al., 1999). This is possibly achieved by the modulation of cholesterol efflux and cholesterol ester hydrolysis (Lin et al., 1999; Langer et al., 2000), the restriction of platelet aggregation (Riddell et al., 1997; Riddell et al., 1999), inhibiting smooth muscle cell (SMC) proliferation (Ishigami et al., 2000), the prevention of oxidation (Miyata and Smith, 1996; Tangirala et al., 2001) and through anti-inflammatory actions (Stannard et al., 2001).

24

2.2.4.3. Receptor-mediated endocytosis of LDL

The process of LDLR-mediated endocytosis (Fig. 4) involves the recognition and binding of an LDL particle from the extracellular membrane and internalization of the receptor-ligand complex in endocytic vesicles assembled from clathrin-coated pits (Defesche, 2004). Following uncoating of the vesicle, the ligand/receptor complex is transported intracellularly to endosomes where the ligand is released. The acidic environment in the endosome makes it possible for the β-propeller region of the EGF precursor domain to function as an alternate substrate for the ligand-binding domain, thereby promoting the release of pH-regulated LDLR from its lipoprotein ligand (Rudenko et al., 2002). Thereafter, the receptor is rapidly recycled back to the cell surface for several subsequent rounds of receptor-mediated endocytosis, and the ligand, LDL, is delivered to a lysosome and degraded by acid hydrolytic enzymes and proteases. The resulting unesterified cholesterol crosses the lysosomal membrane and enters the cellular compartment (Simons and Ikonen, 2000), where it is used for the synthesis of membranes, steroid hormones, and bile acids, and also as a regulator of intracellular cholesterol homeostasis (see Chapter 2.2.4.5). Excess intracellular cholesterol is re-esterified by acyl-CoA-cholesterol acyltransferase (ACAT), for intracellular storage.

Clathrin- coated pit

GOLGI

IDLE

EE

LDLRLigand-

EGF repeats

COOH

O-linkedsugars

NH3

domainbinding

Endosome

C

C

C

C C

C C

C

C

C

C

C

CCE

ApoB

Lysosome

C

C

VLDL

E

E

EE

E

VLDL

E

E

EE

E

IDL

E

EE

LDL

LDL

CC

C

C

C

Cell membrane CC CC

CECE

A-1

LCAT

C

CC

CECE

CE

CC

C

C

CE

LDL

SYNTHESIS1

rER

2 TRANSPORT

3 LIGAND BINDING

INTERNALIZATION4

5RECYCLING

ACATHMG-CoAreductase

C

C

CC

C CC

CC

C

CC

C CCC

CC

C

CCC

C

FIG. 4 LDLR synthesis and receptor-mediated endocytosis of LDL

25

2.2.4.4. LDL uptake via LDLR independent pathway

The liver takes up approximately 70% of LDL particles, mainly through LDLR –mediated endocytosis. The remainder are cleared by means of low affinity, non-specific mechanisms. The receptor-independent pathway, which is considerably less efficient than the receptor-dependent pathway, is alone responsible for the clearance of LDL in null-allele homozygous FH patients and for clearing about half of plasma LDL in heterozygous patients (Goldstein et al., 2001). In WHHL rabbits the receptor-independent LDL uptake is divided equally between the liver and the extrahepatic tissues (Pittman et al., 1982; Spady et al., 1987). Some of the LDLR-independent clearance of LDL occurs in splenic macrophages, hepatic Kuppfer cells, histiocytes of the reticuloendothelial system and other scavenger cells in numerous organs either through receptor-mediated endocytosis (i.e. scavenger receptor, LRP) or by a mechanism resembling phagocytosis (Rhainds and Brissette, 1999; van Berkel et al., 2000; Rhainds and Brissette, 2004).

2.2.4.5. Regulation of cellular cholesterol levels

At the cellular level, de novo cholesterol synthesis and uptake of lipoprotein cholesterol are regulated at multiple steps through a negative feedback mechanism that responds to the free cholesterol derived from the lysosomal hydrolysis of LDL cholesteryl esters (Goldstein et al., 2002). First, the elevation in intracellular cholesterol level decreases endogenous cholesterol production by suppressing activity and inducing rapid degradation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, the rate limiting enzyme in cholesterol biosynthesis (see Fig. 1). Second, cholesterol activates the storage of esterified cholesterol by inducing ACAT. Third, the cholesterol down-regulates LDLR expression, thereby preventing further LDL entry (Fig. 4).

To prevent cytotoxicity due to accumulation of excess cholesterol, liver X receptors and the farnesoid X receptor, together with other members of the nuclear receptor superfamily, promote the storage, transport, and catabolism of sterols and their metabolites (Ory, 2004). These metabolic receptors play a central role in bidirectional flux of cholesterol between the liver and peripheral tissues, and in hepatic excretion of cholesterol, dietary sterols, and sterol metabolites.

SREBP pathway A family of membrane-bound transcription factors, sterol regulatory element (SRE) –binding proteins (SREBPs) are responsible for the sterol-mediated transcriptional regulation of the HMG-CoA reductase and LDLR genes, as well as of more than 30 other genes involved in the synthesis of cholesterol and fatty acids and their receptor-mediated uptake from plasma lipoproteins (Horton et al., 2003). When cellular cholesterol levels are normal, SREBP and SREBP cleavage-activating protein (SCAP), together with one of a pair of ER retention proteins called insulin-induced gene 1 (INSIG-1) and 2 (INSIG-2), form a macromolecular complex in the ER (Yabe et al., 2002; Yang et al., 2002a). This prevents the exit of SCAP-SREBP complexes from the ER, thereby reducing the ability of SREBPs to activate transcription of target genes. The block in SREBP export is achieved through sterol-induced binding of SCAP to the INSIG’s (Radhakrishnan et al., 2004). When cholesterol level in the ER is lowered, release of INSIG from the complex is stimulated allowing SCAP to escort SREBP to Golgi complex where the NH2-terminal transcription factor of the

26

inactive SREBP precursors is released by a two-step proteolytic process. The released sterol-binding element then migrates to the nucleus and activates transcription by binding to nonpalindromic SREs in the promoter/enhancer regions of the cholesterol-regulated target genes.

In addition to binding to SCAP, INSIG’s regulate lipid synthesis by binding in a sterol-dependent fashion to HMG-CoA reductase. Sterol-stimulated binding of INSIG’s to HMG-CoA reductase leads to its ubiquitination and proteosomal degradation (Sever et al., 2003). Unlike the sterol-mediated regulation of HMG-CoA reductase and LDLR, ACAT activity is not regulated by the SREBP pathway. Instead, ACAT activity is allosterically regulated at the post-translational level by membrane cholesterol content in the ER (Chang et al., 1997).

2.2.5. Gene defects

2.2.5.1. Gene defects associated with monogenic hypercholesterolemia

FH is one of the genetically heterogeneous autosomal diseases that are characterized by an elevation of total plasma cholesterol associated with increased LDL particles (Pullinger et al., 2003). In addition to mutations in LDLR, other gene loci have been linked as causing a disorder clinically indistinguishable from FH. The molecular basis of FH is characterized by high allelic heterogeneity. More than 800 molecular defects have been identified in the LDLR (see Chapter 2.2.5.2). Furthermore, few specific mutations in the apo B-100 gene, and in the FH3 genomic locus at 1p34.1–p32 proprotein convertase subtilisin/kexin type 9 gene (Abifadel et al., 2003) that encodes for neural apoptosis regulated convertase, a newly identified human subtilase that contributes to cholesterol homeostasis (Seidah et al., 2003), have been characterized. Mutations in the apo B-100 gene induce familial ligand-defective apo B (FLDB) by failure of LDL binding to its receptor and by secondary plasma LDL-cholesterol elevation (Whitfield et al., 2004). Evidence for a milder biochemical phenotype in patients with FLDB than in patients with FH has been presented (Pimstone et al., 1997). In addition, autosomal recessive forms of hypercholesterolemia have been identified. In autosomal recessive hypercholesterolemia, hepatic LDL degradation is markedly reduced owing to disrupted internalization of LDLR (Wilund et al., 2002). In cholesterol 7α-hydroxylase deficiency the patients are hypertriglyceridemic as well as hypercholesterolemic because of decreased bile acid production (Pullinger et al., 2003). Patients with sitosterolemia show strikingly low rates of cholesterol synthesis but increased absorption of dietary sterols and a defective ability to secrete sterols into the bile, resulting in the accumulation of both animal and plant sterols in the blood and body tissues (Berge, 2003).

2.2.5.2. Functional defects of LDLR

The vast variety of LDLR mutations can either destroy or significantly impair the proper functioning of the receptor. The most frequent mutations, point mutations such as missense, non-sense and splice site mutations, have been described in all of the 18 exons. Deletions and duplications account for ~5% of the LDLR mutations found in a genetically heterogeneous population of FH patients (Austin et al., 2004). Many of the major rearrangements have occurred in recombination between Alu sequences that are more

27

frequently present in chromosome 19 and the LDLR gene than in the average region of the genome (Venter et al., 2001; Lander et al., 2001) and represent 65% of LDLR intronic sequence (Amsellem et al., 2002).

Five major classes of LDLR mutations have been defined on the basis of their functional consequences (Goldstein et al., 2001). The mutation classes, the nature of the mutations and affected domains are listed in Table 2. Besides the distinct mutation classes, many LDLR alleles are derived from more than a single class. In addition, deletions in the transcriptional regulatory elements in the promoter of the LDLR gene have been identified. These promoter mutations can decrease the LDLR transcriptional activity.

TABLE 2. Major LDLR mutation classes based on functional defects

Class of mutation

Nature of mutation Affected domains

1

Null alleles: failure to produce immunoprecipitable LDLR protein due to deletions in the promoter; production of truncated LDLR mRNA via splicing mutations or large deletions; reduced concentration of mRNA caused by nonsense and frameshift mutations; or accelerated degradation of the receptor protein.

LDLR promoter; all domains

2 Transport-defective alleles: abnormal folding of the LDLR protein results in defects in the LDLR precursor transport from ER to Golgi complex.

Ligand binding domain; EGF precursor homology

domain

3 Binding-defective alleles: LDLR protein is synthesized and transported to the cell surface normally but fails to bind ligand (LDL).

Ligand binding domain; EGF precursor homology

domain

4

Internalization-defective alleles: LDLR is capable of binding the ligand but is not able to cluster on cell surface coated pits and therefore cannot transport the bound ligand into the cell.

Cytoplasmic domain; Membrane-spanning

domain

5

Recycling-defective alleles: LDLR is able to bind and internalize the ligand in coated pits, but fails to release the ligand in endosome or recycle back to the cell surface.

EGF precursor homology domain

2.2.5.3. FH in Finland

In the genetic isolate of the Finnish population (Peltonen et al., 1999), the majority of FH cases consist of a handful of founder gene mutations that occur rarely elsewhere in the world. Twenty-four different LDLR gene mutations have been identified in Finns to date (Vuorio et al., 2001; http://www.ucl.ac.uk/fh/). Two of these mutations, namely FH-Helsinki (Aalto-Setälä et al., 1989) and FH-North Karelia (FH-NK) (Koivisto et al., 1992) are responsible for over 65% of the Finnish FH cases. In the FH-Helsinki mutation, a 9.5kb deletion from intron 15 to exon 18 of the LDLR gene results in defects in receptor-mediated binding and internalization (Class 3/4 phenotype). The FH-Helsinki mutation is

28

most common in Central and Northern Finland, being responsible for over 50% of the variety of mutations, whereas the FH-NK mutation accounts for nearly 85% of the FH cases in North Karelia and represents the highest local enrichment of a single FH mutation (Vuorio et al., 2001). The ancestors of 18 families carrying the FH-NK mutation, a seven nucleotide deletion in the exon 6 of the LDLR gene resulting in defects in ligand binding (Class 3 phenotype), have been traced to a single couple who lived in the Polvijärvi region in the late 17th century (Vuorio et al., 1997c).

Other common LDLR gene mutations, FH-Turku and FH-Pori point mutations (Koivisto et al., 1995) are responsible for over 5% of FH cases in Finland, while in South-Western Finland they cover almost 25% of the mutation spectrum (Vuorio et al., 2001). A single nucleotide change in the FH-Turku mutation affects the sequence encoding the putative basolateral sorting signal of the LDL receptor protein and results in mistargeting of the mutant receptor to the apical surface in epithelial cells and reduced endocytosis of LDL from the basolateral/sinusoidal surface (Koivisto et al., 2001). FH-Pogosta mutation, a single nucleotide alteration in exon 12, is responsible for 2% of FH cases in Southern Finland and North Karelia (Vuorio et al., 2001). Of the other less common FH mutations in Finland, some represent a mild phenotype with moderately elevated cholesterol levels (Koivisto et al., 1993; Koivisto et al., 1997; Vuorio et al., 1997a).

2.2.6. Diagnosis and current treatment methods

Clinical diagnostic definition of FH is based on criteria for markedly elevated cholesterol levels together with the presence of tendon xanthomata in the patient or first degree relative, and family (or personal) history of premature coronary heart disease or elevated cholesterol (Civeira, 2004). Blood lipid levels, or more specifically LDL cholesterol levels, can also be used for diagnosing heterozygous FH already at birth (Vuorio et al., 1997b). Molecular PCR-based testing is feasible in populations where particular LDLR mutations are frequent; however, in most populations the multitude of LDLR mutations prevent direct DNA-based diagnosis unless a distinct mutation is presumed (Marks et al., 2003).

Strategies for treating patients with FH are directed at lowering the plasma level of LDL (Table 3). Therapeutic lifestyle changes are not sufficiently effective for the treatment of heterozygous or homozygous FH, whereas heterozygous FH patients respond well to statin (HMG-CoA reductase inhibitor) therapy (Rodenburg et al., 2004). However, statin treatment alone often fails to reduce plasma LDL levels sufficiently. Combination therapy of statins together with cholesterol absorption inhibitors or bile acid sequestrants can further reduce plasma LDL cholesterol levels (Civeira, 2004).

LDLR deficient homozygous FH show little response to statins or combination therapy even at high doses (Naoumova et al., 2004). Cosequently, drug therapy alone is insufficient treatment for homozygous FH patients. The recommended current treatment method for homozygous FH, as well as for heterozygous patients suffering from CHD who do not sufficiently respond to the primary lipid lowering regimen, is LDL apheresis (Thompson, 2003). However, the procedure is time-consuming and expensive, and because of rapid re-accumulation of the LDL, the procedure must be repeated every 1 – 2 weeks to maintain the lowered LDL cholesterol levels. A more direct approach to correcting the hepatic LDLR deficiency is to transplant a liver that expresses normal levels of LDLR (Naoumova et al., 2004). However, as a major operation, liver transplantation carries a significant morbidity and mortality risk. Moreover, even when the transplantation is

29

successful, the undesirable co-treatment of lifelong immunosuppressant to prevent organ rejection is necessary. The latest addition to the subordinate repertoire of FH treatment methods is gene therapy (see Chapter 2.3.7).

TABLE 3. Treatment strategies for FH

Response to treatment Treatment strategy

Mechanism of action heteroz. homoz.

Healthy lifestyle

Improved carbohydrate metabolism, lower blood pressure, greater antioxidant protection, inflammatory and thrombo-genic process regulation

++ 18-21%

-

HMG-CoA reductase inhibitors (Statins) block HMG-CoA enzyme and thereby inhibit intracellular cholesterol synthesis, and upregulate normal LDLR allele

+++ 20-58%

- /+ 5%

Lipid-lowering drugs Combination therapy: statins + intestinal cholesterol

absorption inhibitors (Ezetimibe, plant stanols); or bile acid sequestrants (Colesevelam) that prevent the absorption of bile acids from the ileum and increase cholesterol catabolism in liver

++++ up to 70%

++ 20%

LDL apheresis combined with healthy lifestyle + lipid-lowering drugs

LDL particles are selectively removed from circulation through extracorporeal binding to affinity columns containing anti-apo B antibodies or dextran sulphate; heparin precipitation; or hemoperfusion from whole blood using polyacrylate-coated polyacrylamide beads

NR +++ 50-68%

Liver transplantation

Liver transplant that express normal levels of LDLR NR ++++

Gene therapy Liver expressing normal LDLR from gene transfer vector

NR to be determined

NR: not recommended

2.2.7. Animal models of FH

WHHL rabbit is an authentic animal model for human FH (Watanabe, 1980) characterized by the lack of functional hepatic LDLR (Schneider et al., 1983). These rabbits exhibit symptoms similar to human FH including severe unprovoked hypercholesterolemia, increased levels of plasma LDL, diffuse atherosclerosis and skin xanthoma (Goldstein et al., 1983). The inborn mutation of the LDLR gene is a 12 nucleotide in-frame deletion eliminating four amino-acids from the ligand binding domain of the LDLR (Yamamoto et al., 1986). This leads to abnormal folding of the protein, which impairs the intracellular transport to the plasma membrane. The mutation also renders the receptor unable to bind LDL (Class 2/3 phenotype, see Table 2); however, the few receptors that reach the cell surface retain the ability to bind VLDL remnants. While LDL clearance is decreased,

30

synthesis of LDL is increased leading to hypercholesterolemia in WHHL rabbits (Aliev and Burnstock, 1998).

The initial mouse model for hypercholesterolemia was the LDLR knockout (LDLR-/-) mouse created by gene-targeting techniques (Ishibashi et al., 1993). These mice develop only a modest hypercholesterolemia when fed a normal diet, but are very susceptible to dietary modifications. On a high-fat diet the LDLR-/- mice develop atherosclerotic lesions throughout the aorta (Ishibashi et al., 1994; Tangirala et al., 1995). Although used as a phenotype model for FH, LDLR-/- mouse conveys fundamental differences in the lipoprotein metabolism when compared to humans. In the LDLR-/- mouse, as well as in wild-type mice, HDLs predominate in the plasma, whereas the main cholesterol carriers in humans are LDLs. Additionally, in the mouse liver apo B mRNA is extensively edited by apo B mRNA editing polypeptide 1 (apobec-1) generating apo B-48-containing lipoproteins (Greeve et al., 1993), whereas in rabbits, as well as in humans, the liver normally produces only apo B-100 mRNA and fails to edit endogenous hepatic apo B mRNA. Lipoproteins containing the truncated apo B-48 have high levels of apo E and can be cleared efficiently from the plasma with mechanisms other than the LDLR, such as LRP (Martins et al., 2000). The presence of extensive apo B editing in liver is associated with a less atherogenic lipoprotein profile in comparison with animals that have no liver editing activity.

A double knock-out mouse, deficient in both LDLR and the apobec-1 gene (LDLR-/-

apobec-/-), has lipoprotein profiles that mimic human FH with high apo B-100 containing LDL cholesterol levels, and exhibit atherosclerosis by 8-months of age without high-fat diet mirroring the pathophysiology of human FH (Powell-Braxton et al., 1998).

2.3. Gene therapy

2.3.1. Definition

Gene therapy is defined as the delivery of nucleic acids into somatic cells of an individual for the treatment of an inherited or an acquired disease. The primary goals of gene therapy are to correct a patient’s genetic defect via gene repair or gene replacement, or to overexpress proteins that are therapeutically useful, for example, for gene expression regulation, signal transduction, immune system manipulation, or destruction of malignant and other cells (Boulikas, 1998). Gene therapy represents a new, innovative drug delivery system with roots as far back as 1944, when Avery, MacLeod, and McCarthy discovered, that a gene could be transferred within nucleic acids (Avery et al., 2000); and to the prediction of Edward Tatum in 1966 that viruses could be used to transduce genes (Wolff and Lederberg, 1994). Gene therapy technology today makes use of current technical and scientific advances including microbiology, virology, organic chemistry, molecular biology, biochemistry, cell biology, genetics, and genetic engineering. It is a complex process, involving multiple steps from delivery of the gene transfer vector to organs, tissue targeting, cellular trafficking, the regulation of gene expression level and duration, the biological activity of therapeutic protein, and the safety of the vector and gene product.

2.3.2. Gene transfer vectors

Gene transfer vectors are the vehicles used to transfer the gene or genes of interest (transgene) to the target cells, which will then will go on to express the protein(s) encoded

31

by the transgene(s). The success of gene therapy is fundamentally dependent on the development of a gene transfer vector that can deliver a gene to target cells selectively and efficiently with minimal toxicity. Because gene therapy is implemented in a wide variety of inherited as well as acquired diseases, no one ideal universal vector is available for all gene therapy applications. Numerous viral and nonviral vectors have been designed. Vector designs depend on the size of the transgene, whether long-term or transient expression is required, whether constitutive or inducible activity of vector promoter is needed, whether particular tropism to the target cell population is important, whether repeated administrations of the vector are necessary, and whether vector-mediated target cell killing is of interest. Each gene delivery system has distinct characteristics and preferential applications in therapy.

2.3.2.1. Viral gene transfer vectors

Viruses are intra-cellular parasites, designed through the course of evolution to infect cells, often with great specificity for a particular host and cell type. The experimental technique of viral gene delivery was built on the natural ability of viruses to efficiently introduce and express their nucleic acid in all types of recipient cells, including plant, animal and human. Viruses offer many fundamental advantages for use as gene therapy vehicles, such as specific cell-binding and entry properties, efficient targeting of the transgene to the nucleus of the cell, and the ability to avoid intracellular degradation. Viral-mediated gene transfer involves the engineering of an intact wild-type virus to a recombinant viral particle that will deliver the gene of interest into cells by the process of infection. For example, modifying or deleting genes involved in viral replication from the vector backbone renders the recombinant virus replication defective, a feature most often required from a gene transfer vector. In general, it is considered that the more severely stripped the viral vector is from its wild-type state, the less detrimental the virus for use in gene therapy protocols. Several different viruses have been considered potential vehicles for gene therapy. The viral vectors in laboratory and clinical use are based on murine or human RNA- and DNA-viruses. The most commonly used viral vectors in clinical gene therapy are retroviruses and adenoviruses (Ad) (Thomas et al., 2003; http://www.wiley.co.uk/genmed/clinical/). Other viruses used as gene transfer vectors include adeno-associated virus (AAV); lentiviruses (HIV, FIV, Simian immunodeficiency virus [SIV], Equine infectious anemia virus [EIAV]); foamy virus; baculovirus; Simian virus 40 (SV40); Hepatitis B virus (HBV); herpes viruses (Herpes Simplex virus [HSV]-1, Epstein-Barr virus [EBV]); vaccinia virus; polyomavirus (BK virus); papillomavirus (Bovine papilloma virus-1); and alphaviruses (Semliki Forest virus, Sindbis virus). In addition, a variety of hybrid vectors composed of different viral elements has been developed. Characteristics of some viral gene transfer vectors are summarized in Table 4.

2.3.2.1.1. MLV retroviral vectors

Retroviruses are classified into two categories: simple retroviruses that encode only the Gag, Pol and Env gene products; and complex retroviruses that also encode an array of small regulatory proteins with a range of functions (Goff, 2001). Retroviruses are lipid-enveloped RNA viruses composed of a homodimer of linear, positive-sense, single-stranded RNA genomes of 7-13kb. The viruses reverse-transcribe their RNA genome into

32

linear double stranded proviral DNA that enters the nucleus, and stably and irreversibly integrates into the chromosomes of the infected cell via the function of viral integrase. This property, the permanent alteration of the characteristics and function of the cell, makes retroviruses suitable vectors for permanent genetic modification of cells. Both simple and complex retroviruses have been utilized for gene transfer vector development. Retroviral vectors currently in use for gene therapy are mostly derived from murine leukemia viruses (MLVs). They were also the first viral vectors to be used in a clinical gene therapy trial (Blaese et al., 1995).

MLVs are classified as simple retroviruses. They assemble at the plasma membrane and contain a central, symmetrically placed, spherical inner core. MLV consists of three structural genes: gag, pol and env, flanked by the viral long terminal repeats (LTR), which are responsible for the regulation and expression of the viral genome (Goff, 2001). Reverse transcription of viral RNA into DNA makes it possible to manipulate the viral genome, since the proviral DNA can be used as the basis for vector construction. The removal of structural genes from the viral vector and the packaging signal from the packaging vector are the basis for the safe and efficient production of the recombinant virus (Pages and Bru, 2004).

In the replication defective retroviral vector construct, the structural genes of the retrovirus are replaced with the therapeutic transgene(s). The transgene is either placed directly under the viral LTR promoter, or under an internal promoter where the gene of interest is expressed from an internal heterologous promoter, or, alternatively, a second transgene is placed under a putative internal ribosomal entry site (IRES) sequence that allows the ribosome to translate the second cistron independently. The advantages of IRES vectors are the possibility of including larger genes and the efficient gene expression of two or more genes (Li and Zhang, 2004). Also the packaging signal (Ψ), essential for viral RNA packaging, is incorporated into the vector construct. The whole vector is then flanked by the viral LTRs that are necessary for the integration of the transgene into the target cell genome.

An important goal for manufacturing retroviral vectors is the production of recombinant viral particles at very high titer. For the viral vector production, the viral structural genes are provided by helper cells or by transient transfection of a packaging construct to packaging cells. After replication defective retroviral vector DNA is introduced into the packaging cells, integrated stably into the host cell DNA and transcribed into genomic retroviral RNA, which is packaged as infectious virus because of to the constitutive expression of the Gag-Pol and Env proteins in these helper cells.

In the early retrovirus packaging cells, only the viral Ψ packaging signal was removed from the integrated helper virus sequence (Mann et al., 1983). In the classical PA317 packaging cell line further modifications were made in order to reduce the risk of recombination between the integrated helper virus genome and the viral vector (Miller and Buttimore, 1986). Since then, numerous packaging cell lines have been designed to minimize the risk of generating replication competent virus (RCV) and to improve retroviral infection (Yu et al., 2003b; Merten, 2004). Furthermore, it has been shown that by producing MLV vector particles in a human cell line, the destruction of viral particles by human serum complement can be avoided (Takeuchi et al., 1994; Cosset et al., 1995). Rendering the retroviral vector self inactivating by introducing a deletion into the 3’ LTR’s U3 promoter/enhancer sequences of the vector has provided an additional biosafety

33

feature to retroviral vector technology (Yu et al., 1986). The inactivation of the 3’LTR is copied to the 5’ LTR during reverse transcription leading to improved efficiency of the internal promoter due to the removal of the LTR interference. Furthermore, the integrated proviral genome of the SIN vector is incapable of insertional activation of genes in the host genome because of the lack of a 3’ promoter.

FIG. 5 Production of VSV-G pseudotyped retroviral vector particles.

Infectivity of the virus is mediated by the envelope protein and the host range is

determined by its receptor usage (Haynes et al., 2003). Amphotropic retroviruses are capable of infecting cells of murine and other species, including human, origin. In order to broaden the retroviral vector host range and to improve viral titers, envelope proteins of other viruses have been used to participate in the encapsidation of the vector genome and core components in a process referred to as pseudotyping. Specifically, the G-protein of Vesicular Stomatitis virus (VSV-G) has been shown to efficiently form pseudotyped virions with the genome and core components derived from MLV (Emi et al., 1991; Burns et al., 1993). These VSV-G pseudotyped retroviral vectors have a broad host range, increased infection efficiency and improved viral titers owing to protection of the virus particles from shedding during virus preparation and concentration. Because the VSV-G protein as such is cytotoxic to the cells, the VSV-G env gene is provided transiently via transfection of the helper cell (Fig. 5) or by controlling the expression of the gene using inducible expression strategies (Ory et al., 1996). Infectious VSV-G pseudotyped retroviral particles may also be produced by cell-free conversion of immature, noninfectious virus particles assembled in packaging cells by the addition of the VSV-G protein (Abe et al., 1998).

gag pol

LTR gene X RSV neo LTR

CMV VSV-G

LTR gene X RSV neo LTR

CMV VSV-G

ψ

Packaging cell

Viral RNA Replication defective viral particles

VSV-G protein

Viral core proteins

RT

nucleus

34

The advantages of standard MMLV retroviral vectors for use in gene therapy, in addition to the stable integration, are their nonimmunogenicity, a broad infectivity range of several target cell types, and the ability to carry reasonably large foreign genes (up to 8kb) (Miller, 1997; Boulikas, 1998). Among the disadvantages of standard MMLV retroviruses as vehicles for human gene therapy are the possibility of insertional mutagenesis in the target cell by random viral integration, the potential for generating RCV during virion packaging, the possibility of recombination between viral-based vectors and human endogenous retroviruses (HERVs), the instability of some retroviral vectors because of the inactivation of viral particles by human serum complement or by the phenomenon of transgene silencing, the lack of integration site specificity, low viral titers, and the inability of the simple retroviruses, derived from MLV, to productively infect non-dividing cells (Hansen and Pedersen, 2002).

2.3.2.1.2. Lentiviral vectors

Lentiviruses are complex retroviruses characterized by unique virion morphology with cylindrical or conical cores (Goff, 2001). They possess a complex genome composed of the structural genes common to all retroviruses. Matrix, capsid and nucleocapsid structural proteins are encoded by gag. pol encodes protease, reverse transcriptase, and integrase that are required for viral replication. env encodes for surface and transmembrane envelope glycoproteins. In addition, lentiviral genome encodes a plethora of regulatory and accessory genes involved in modulation of viral gene expression (tat, rev), assembly of viral particles (vif) and structural and functional alterations in the infected cell (nef, vpr, vpu) (Fig. 6). (Freed and Martin, 2001)

FIG. 6 HIV-1 and FIV proviral genome organization.

Lentiviruses are unique among retroviruses because of their ability to infect target cells independently of their proliferation status. They rely on active transport of the preintegration complex through the nucleopore by the nuclear import machinery of the target cell, which enables them to infect both dividing and non-diving cells (Bukrinsky et al., 1992; Lewis et al., 1992; Gallay et al., 1996). Furthermore, specific virus-encoded

LTR env

RR

vif

vpr

nef rev ψψ

gag pol LTR vpu

rev tat tat

HIV-1

LTR env

RRE

vif rev ψψ gag pol LTR rev

orf-2

FIV

35

proteins are responsible for lentivirus integration in the absence of cellular mitosis (Greene and Peterlin, 2002). This feature makes them a valuable tool for gene therapy applications in which the target cells are non-dividing, such as hepatocytes in liver gene therapy, or terminally differentiated cell populations, such as neuronal tissue, hematopoietic cells, myofibres etc (Trono, 2000). Thus, lentiviral vectors offer potential for treatment of a wide variety of syndromes including genetic metabolic deficiencies (adenosine deaminase [ADA] deficiency, cystic fibrosis, hematopoietic disorders, Gaucher’s disease, FH) and acquired diseases (HIV infection, Parkinson’s disease, cardiovascular disease, cancer).

HIV-1, the causative agent of acquired immunedeficinecy syndrome (AIDS), has been the most characterized lentivirus and the first lentiviral vector systems were based on this virus. As an alternative to the use of HIV-1 –derived vectors, other members of the lentivirus family have been used to generate vectors. These include HIV-2 (D'Costa et al., 2001), SIV (Kim et al., 2001), EIAV (O'Rourke et al., 2002), FIV (Sauter and Gasmi, 2001), and bovine immunodeficiency virus (Matukonis et al., 2002). These viral vectors may provide an added level of safety for human gene therapy. Furthermore, the non-human lentiviruses provide a tool for studying vector biosafety in the natural host.

HIV vectors Lentiviral vectors are engineered to be defective for replication, so that only the early steps of the lentivirus life cycle (i.e. attachment, entry, reverse transcription, nuclear transport and integration) encoded by a fraction of parental lentiviral genome need be maintained in a lentivirus vector. In the case of HIV-1 –based vectors, new minimal packaging constructs, with viral packaging genes located on two or three separate plasmids and only the transgene located on the lentiviral vector, have been generated to increase viral

biosafety (Fig. 7) (Kafri, 2001). In the third generation HIV-1 –based lentiviral vector, sequences coding for viral accessory proteins (vif, vpr, vpu, nef), critical only for the pathogenesis of the virus, have been deleted (Dull et al., 1998; Kim et al., 1998). The third generation packaging constructs express the HIV-1 gag and pol genes in the presence of the Rev protein, which is provided in trans by a separate non-overlapping construct. A strong constitutive promoter upstream of the vector transcriptional start site can replace the function of the regulatory protein Tat without reducing transduction efficiency of the vector.

∇

∇ LTR LTR LSP gene X

WPRE LE6

cppt

ΨΨ A

RRE

CMV pA gag pol

RSV rev HIVp

VSV-G CMV pA

B

C

D

Fig. 7 The third-generation SIN lentiviral vector system. A) Lentivirus vector construct; B-D) packaging constructs expressing gag, pol and RRE, rev, and VSV-G envelope protein.

36

These features result in an important biosafety gain because any RCV that could be generated during vector manufacturing would lack all factors essential for HIV-1 replication and virulence in vivo. Recently, a novel packaging system, the trans-lentiviral vector, has split the gag-pol component of the packaging construct into two separate parts thus further curtailing the possibility of RCV formation and retrovirus DNA mobilization for which functional gag-pol is absolutely required (Wu et al., 2000).

In the third generation lentiviral packaging system, the viral envelope, like all lentiviral proteins necessary for virus production, is supplied in trans by a separate plasmid (Fig. 7). This is necessary in order to evade the restricted host range of the HIV envelope. As with the retroviral vectors, VSV-G is the most often used envelope protein in lentiviral vectors. In addition, lentiviral vectors can be pseudotyped with numerous other viral surface glycoproteins, some of which may modulate the physicochemical properties of the vectors, their interaction with the host immune system as well as their host range (Verhoeyen and Cosset, 2004).

For the assembly and production of recombinant virus particles most of the lentiviral vector studies have used transient transfection protocol in human derived 293T cells. A number of different transfection protocols have been utilized since they provide flexibility in the type of lentivirus produced, including the choice of the envelope pseudotype, accessory proteins and also expression cassettes (Karolewski et al., 2003). However, the transient production protocol is not easily standardized, and the product may be contaminated from cellular debris. In an attempt to overcome the drawbacks of the transient system, stable producer cell lines have been generated. However, many of the proteins required to assemble lentiviral vectors are toxic to cells when overexpressed, including VSV-G (Burns et al., 1993), protease (Konvalinka et al., 1995), Rev (Miyazaki et al., 1995), Tat (Li et al., 1995a), and Vpr (Bartz et al., 1996). Consequently cell lines expressing the toxic components under an inducible promoter have been generated (Yu et al., 1996; Kafri et al., 1999; Klages et al., 2000; Pacchia et al., 2001). The most recent, the second generation packaging cell line (Xu et al., 2001) is constructed with a minimal set of HIV-derived genetic information and a tetracycline (Tc) -dependent system to control expression of packaging and envelope functions. The viral titers from this packaging cell line were the equivalent of the vector produced by transient transfection, and their transducing activity was indistinguishable from, or superior to, that of this vector.

A further improvement in the lentiviral vector system is an SIN vector. The SIN vectors contain a deletion in the 3’ LTR that results in transcriptional inactivation of the upstream 5’ LTR, thus diminishing substantially the risk of vector mobilization and recombination (Miyoshi et al., 1998; Zufferey et al., 1998; Bukovsky et al., 1999). In addition, the inclusion of the upstream central polypurine tract (cppt) element and the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) has improved the lentiviral vector system. The cppt allows internal initiation of second strand DNA synthesis and enhances the transport of the pre-integration complex to the nucleus (Follenzi et al., 2000; Zennou et al., 2000). The WPRE acts at the post-transcriptional level by promoting the nuclear export of transcripts and/or by increasing the efficiency of polyadenylation of the nascent transcript, thus increasing the total amount of mRNA in cells (Zufferey et al., 1999).

The most prominent limitation in the clinical use of HIV-based vectors is the biosafety consideration of introducing pathogen-derived sequences into humans (Debyser, 2003).

37

There is a possibility that a replication-competent virus might be generated through recombination with the packaging construct during vector production, or with HERVs in the target cell. Rescue of the integrated vector by a wild type helper virus resulting in vector spread is also a possibility. Indeed, development of highly specific and sensitive assays to detect RCV HIV in vector preparations is important. Furthermore, the possibility that vector preparations might be contaminated with HIV or a new virus which has incorporated an exogenous envelope, such as VSVG in vivo is of concern. In addition, the lack of an indisputable animal model for the human pathogen derived vector brings a challenge into the HIV-1 based vector development.

FIV Vectors FIV, a distant relative of primate lentiviruses (Olmsted et al., 1989; Talbott et al., 1989; Bachmann et al., 1997), is an appealing candidate for gene therapy as an alternative to the human pathogen, HIV-1, since neither seroconversion nor other detectable evidence of human infection has occurred (Lutz, 1990; Nowotny et al., 1995). FIV infects diverse Felidae, including the domestic cat and free-ranging populations of great cats worldwide (Olmsted et al., 1992). The infection and disease resembles HIV infection and AIDS; however, the speed of disease progression and overall mortality after FIV infection are not as rigorous as with HIV (Pedersen, 1993). The simple genome organization, which in addition to gag, pol and env contains only three rather than six non-structural genes (vif, rev, orf-2) (see Fig. 6), facilitates development of gene transfer vectors that can accommodate up to 8kb transgenes (Sauter and Gasmi, 2001). After the development and in vitro analysis of the first FIV –based VSV-G pseudotyped vectors (Poeschla et al., 1998) further improvements, following the general state-of-the-art design of HIV lentiviral vectors have been described with FIV vector systems (Johnston et al., 1999; Curran et al., 2000; Loewen et al., 2002). Furthermore, these FIV vector systems have been utilized for successful in vivo applications targeting cells in the brain, liver, muscle, pancreas, eye, airway and hematopoietic system (Saenz and Poeschla, 2004). The current FIV vector systems consisting of the gene transfer vector with minimal gag region, and one or two packaging components with an envelope glycoprotein of VSV (Song et al., 2003) or Ross river virus (RRV) (Kang et al., 2002) are replication-incompetent and limited to a single round of infection process in the target cell without spreading (Sauter et al., 2003).

2.3.2.1.3. AAV vectors

AAV is a small, non-enveloped, single-stranded DNA dependovirus which belongs to the family of parvoviridae. It requires a helper virus, preferably Ad or herpesvirus, or, alternatively, human papilloma virus or vaccinia virus to facilitate efficient, fully permissive AAV infection and replication (Bloom and Young, 2001). In the absence of helper virus, AAV establishes a latent infection and maintains itself as a latent provirus integrated into a unique site of human chromosome 19. AAV is able to efficiently infect a wide variety of cell types and also to infect both mitotic and post-mitotic, quiescent cells, through heparin sulphate proteoglycans and integrins (Summerford et al., 1999). AAV has not been associated with any human disease which substantially overcomes the safety concerns encountered with other vector systems.

38

Recombinant AAV vectors exhibit a broad host range and infect a variety of tissues and cells including liver (Snyder et al., 1997; Grimm et al., 2003; Harding et al., 2004), and vasculature (White et al., 2004; Gruchala et al., 2004a). The relatively simple genome of AAV can be easily manipulated to generate recombinant AAV vectors that lack all wild type coding sequences (Pfeifer and Verma, 2001) and therefore offer a reduced risk of undesirable host immune responses. The only cis-acting elements necessary for efficient encapsidation and integration are the inverted terminal repeats.

Up to 5kb (ideally between 4.1 – 4.9kb) expression cassettes can be accommodated by recombinant AAV particles (Dong et al., 1996), an obvious disadvantage of AAV vectors for wide spectrum of gene therapy applications. However, strategies have been developed to expand the transgene size limitation of AAV vectors. In a trans-splicing AAV vector system the transgene expression is driven from two independent AAV vectors (Duan et al., 2000; Nakai et al., 2000; Sun et al., 2000). Another approach to increase the packaging capacity of AAV vectors has been the generation of AAV-Ad (Goncalves et al., 2004) and AAV-HSV (Johnston et al., 1997) hybrid vectors which take advantage of the large cloning capacity of Ad or HSV.

Of the several serotypes of primate AAV (AAV-1 – AAV-8), AAV-2 is the best characterized and was both the first to be used (McLaughlin et al., 1988; Samulski et al., 1989), and today also the most commonly used in gene transfer vector technology. However, antibodies to AAV-2 are highly prevalent in humans. Cross-packaging AAV-2 particles with the capsids of other AAV serotypes, structurally and functionally different from AAV-2, has resulted in the escape of the anti-AAV-2 immune response (Grimm and Kay, 2003). The use of mutant AAV capsids has been shown to overcome major neutralizing effects of human AAV antisera (Buning et al., 2003). Recombinant AAV particles can also be derived from other AAV serotypes which may display some unique targeting capacities. For example vectors derived from the AAV serotype 8 can transduce the murine liver 100-fold more efficiently than AAV-2 viral vectors (Gao et al., 2002; Sarkar et al., 2004).

After infection the wild type AAV integrates into the human chromosome 19 (Huser et al., 2002), whereas the recombinant AAV has lost the site-specificity of integration because of the deletion of the rep gene in AAV vectors (Rutledge and Russell, 1997; Ponnazhagan et al., 1997). Random integration of AAV vector sequences is considered a risk involved with AAV-mediated gene therapy. However, episomal concatamers have been shown to predominate in vivo (Duan et al., 1998; Duan et al., 1999; Nakai et al., 1999) thus reducing the risk of insertional mutagenesis and activation of oncogenes (Tenenbaum et al., 2003). Some attempts have been made to restore the site-specific integration pattern of the AAV vector system by featuring the rep gene (Satoh et al., 2000; Huttner et al., 2003). Also, AAV-Ad, AAV-baculovirus and AAV-HSV hybrid vectors have been engineered to mimic the site-specific integration wild type AAV (Palombo et al., 1998; Recchia et al., 1999; Heister et al., 2002; Bakowska et al., 2003).

2.3.2.1.4. Adenoviral vectors

Human Ads belong to the family of adenoviridae and are associated with mild infections including upper and lower respiratory tract infections, epidemic conjunctivitis and infantile gastroenteritis in humans. They are non-enveloped, icosahedral double-stranded non-integrating DNA-viruses that remain as an extrachromosomal entity in the nucleus of the

39

host cell and are lost during cell division. To date, over 50 human Ad serotypes have been identified and classified into six subgroups, A to F, based on the percentage of guanine and cytosine in the DNA molecules and the ability to agglutinate red blood cells (Horwitz, 2001). Ad serotype 2 (Ad2) and Ad5, members of the C subgroup, are the most common serotypes to which most adults have been exposed. They are also the major Ad vectors currently used in clinical applications. However, other serotypes of human Ad as well as non-human Ads have been exploited for vector development in an attempt to avoid potential problems related to pre-existing immunity (Morral et al., 1999; Parks et al., 1999; Moffatt et al., 2000).

Replication-defective recombinant Ad-based vectors possess a very efficient nuclear entry mechanism which makes them attractive and widely used gene deliver vehicles for transduction of different cell types including quiescent, differentiated cells. The transduction efficiency of Ads is very high in almost all cell types compared with that of other viral vectors used for ex vivo or in vivo gene therapy. Ads are the second most commonly used viral vectors in gene therapy clinical trials today (Thomas et al., 2003; http://www.wiley.co.uk/genmed/clinical/). They exhibit low pathogenicity for humans, can be produced to high titers (1011 particles / ml), have a packaging capacity of over 30kb, and do not integrate into the host cell genome (Pfeifer and Verma, 2001).

A major disadvantage of using Ad as a gene transfer vector in vivo is the immune response, either an early innate inflammatory response or a later acquired immune response, induced against the viral vector, vector encoded proteins and infected cells resulting in the elimination of vector-transduced cells and inflammation (Tripathy et al., 1996; Kafri et al., 1998). Also, the length of the transgene expression is transient, a feature desirable for some applications such as cancer gene therapy; however, treatment of hereditary genetic disorders requiring long-term transgene expression is not efficiently achievable with the current Ad vectors. Furthermore, the high-titer recombinant Ads are potentially toxic, as exemplified in the death of an 18-year old patient with partial deficiency of ornithine transcarbamylase (OTC), after systemic inflammatory response in vascular endothelium and lung tissue leading to intravascular coagulation, acute pulmonary complications and multiorgan failure directly associated with a very high dose of second generation Ad vector administration (3.8 × 1013 particles) (NIH Report, 2002; Raper et al., 2003).

Recent advances in adenoviral vector development, including the high capacity or “gutless” Ad vector devoid of all coding viral genes (Parks et al., 1996; Kochanek et al., 2001), have substantially enhanced the properties of Ad vectors. Progress has been made on issues of immunogenicity and toxicity in vivo, long-term expression of the transgene, target cell specificity and tropism modification (Schagen et al., 2004). Several different generations of non-replicative and replicative Ad vectors are available today each of which will be most appropriate for certain applications (Volpers and Kochanek, 2004).

2.3.2.1.5. Other viral vectors

In addition to the most commonly used viral vectors described above, other viruses with specific features have been exploited for a variety of gene therapy purposes. SV40 based vectors can accommodate up to 4.7kb of exogenous DNA and are capable of integrating into both dividing and non-dividing cells thus exhibiting long-term transgene expression

40

(Strayer et al., 2002). They have been utilized in applications including gene therapy for inherited hepatic metabolic defect (Sauter et al., 2000) and gene therapy for HIV replication (Cordelier and Strayer, 2003). HBV-based vectors have been used for hepatocyte specific gene transfer because of their natural targeting to hepatocytes, efficiency of infection of quiescent hepatocytes, and the hepatocyte-specific promoter and enhancer elements they encompass (Klocker et al., 2003). HBV vectors lacking all viral protein expressing genes have been produced to high titer; however, the packaging capacity of the HBV vector is rather low, possibly only up to 1.6 kilobases (Untergasser and Protzer, 2004)

Recombinant baculoviral vectors have a substantial cloning capacity, and when controled by a promoter active in mammalian cells, efficiently deliver and express transgenes in numerous cell types of human, primate, and rodent origin in vitro and in vivo (Ghosh et al., 2002), with a strong preference for hepatocytes of different origin, specifically human hepatocytes (Sandig et al., 1996a). However, baculovirus-mediated gene transfer is strongly reduced in the presence of serum complement, resulting in poor in vivo gene transfer potential (Hofmann et al., 1998). By employing baculoviral vectors in tissues with minimal complement expression, such as periadventitial and central nervous system, efficient transduction can be achieved (Airenne et al., 2000; Lehtolainen et al., 2002). The recently developed complement-resistant baculovirus has been shown to enhance gene transfer in the livers of complement sufficient neonatal rats (Huser et al., 2001).

Foamy viruses constitute a subfamily of complex retroviruses, Spumaretrovirinae, (Goff, 2001) with a distinct replication pathway in which the virus reverse transcribes its genome into double stranded DNA before budding into the virus-producing cell (Delelis et al., 2003). Viral vectors derived from foamy viruses transduce efficiently non-dividing cells and so, are considered to be an alternative to lentiviral vectors for gene therapy applications. Foamy viral vectors can be concentrated by ultracentrifugation (Vassilopoulos et al., 2001), have broad tropism (Hill et al., 1999) and have been shown to transduce non-dividing cells more efficiently than oncoretroviral vectors (Russell and Miller, 1996), and at least as efficiently as VSV-G pseudotyped HIV-1 based lentiviral vectors (Leurs et al., 2003). Furthermore, resistance to human serum complement inactivation, and a high packaging capacity make them appealing alternatives for use in human gene therapy. Several versions of human foamy virus and simian foamy virus type 1 -based vectors have been designed (Mergia and Heinkelein, 2003). They feature a three plasmid packaging system that split gag, pol, and env onto separate expression cassettes for minimizing the potential for replication-competent virus production by recombination.

The large capacity HSV-1 vectors have been employed in several applications, including gene transfer protocols that target neuronal tissue, such as the treatment of Parkinson’s disease, malignant gliomas and cerebral ischaemia (Goins et al., 2004). HSV-1 vectors efficiently transduce a variety of cell types and maintain as an extra-chromosomal DNA element in the nucleus of host cells establishing a long-lived asymptomatic infection in the sensory neurons of the peripheral nervous system and in some central nervous tissue. Another member of the herpesviridae, the EBV with a double stranded DNA genome has been engineered to express large DNA fragments. Since EBV establishes a latent state as an extra-chromosomal circular plasmid in the host nucleus it is suitable for long-term retention in the target cell. Like EBV, other episomal virus-derived

41

vectors such as polyomaviruses and papillomaviruses do not integrate into the host genome and thus avoid the possibility of transformation features that may result in secondary cancers (Van Craenenbroeck et al., 2000).

Alphaviruses, such as Semliki forest virus and Sindbis virus with their single-stranded RNA genome, can mediate efficient cytoplasmic gene expression in a variety of mammalian cells. Alphavirus vectors have shown promise for the safe tumor-killing and tumor-specific immune responses in gene therapy studies of cancer (Yamanaka, 2004). Also the non-integrating Vaccinia virus vectors have been developed for cancer gene therapy (Zeh and Bartlett, 2002).

TABLE 4. Characteristics of some viral gene transfer vectors

Advantages Limitations, SAE

MLV

Stable integration, stable expression Low immunogenicity Broad tropism ≤8kb transgene capacity

Unable to transduce quiescent cells Low viral titers, low in vivo efficiency Inactivation by serum complement, transgene silencing Possibility of insertional mutagenesis Potential for pathogenic vector mutation

Lentivirus

Stable integration into quiescent cells Stable expression Low immunogenicity ≤8kb transgene capacity Wild-type virus (HIV-1) thoroughly characterized

Transient production protocol Lack of an indisputable animal model Possibility of insertional mutagenesis Potential for pathogenic vector mutation Potential for rescue of integrated vector

AAV

Transduce quiescent and dividing cells Stable / prolonged transgene expression Non pathogenic, low immunogenicity Broad tropism Simple genome easily manipulated

Small transgene capacity (<4.7kb) Possibility of insertional mutagenesis

Ad

Transduce quiescent and dividing cells High efficiency Broad host range >30kb transgene capacity Easy to produce in high titers

Transient expression Unable to integrate into host cell genome Repeated administration impossible Immunologic and inflammatory responses

Foamy virus

Transduce efficiently quiescent cells Resistant to inactivation by serum complement, broad tropism High transgene capacity ≥9kb

Low viral titer Not thoroughly characterized

SV40 Stable integration into dividing and non-dividing cells Long-term transgene expression

Small transgene capacity ≤4.7kb

Baculovirus

Strong preference for hepatocytes High transgene capacity Easy production Non-pathogenic

Transient expression Inactivation by serum complement

42

Since none of the currently available viral vectors can mediate targeted and efficient long-term gene transfer with no detrimental immune reactions, chimeric viral vectors featuring different viral and cellular elements are being developed (Lam and Breakefield, 2000; Mitani and Kubo, 2002). These hybrid vectors have potential to improve transduction efficiencies, alter the host range and entry specificity of virions, control the fate of transgenes in the host cells (integrating vs. non-integrating), and also regulate transgene expression.

2.3.2.2. Non-viral gene transfer vectors

Non-viral vectors have been generated to surmount some of the drawbacks associated with viral gene transfer vectors. Non-viral vectors are easy and less costly to manufacture in substantial quantities, more flexible in respect of transgene size and less immunogenic than their viral counterparts. Non-viral episomal vectors also avoid the potential risk of germline transmission or of random integration causing a deleterious or mutagenic effect. However, low transfection efficiency and transient transgene expression, the major disadvantages of using non-viral carriers, have hampered their clinical use (Schmidt-Wolf and Schmidt-Wolf, 2003).

Naked DNA The simplest approach to non-viral gene transfer is the delivery of naked plasmid DNA into the target organ or the systemic circulation. However, in systemic circulation naked DNA is rapidly cleared by the liver, or degraded by restriction nucleases. Interestingly, liver parenchymal cells have been suggested to internalize naked DNA via receptor-mediated endocytosis (Budker et al., 2000). A number of tissues, including muscle, skin and tumors, are susceptible to naked DNA-mediated gene transfer. Gene transfer efficiency of naked DNA can be enhanced by several physical approaches, including physical pressure, electroporation, gene gun and ultrasound. These methods allow direct penetration of DNA through the cell membrane, bypassing the endosome/lysosome compartment to avoid enzymatic degradation, and in some cases delivery of DNA directly to the nucleus. While fairly inefficient as an in vivo gene transfer vehicle for therapeutic transgene expression, naked DNA has been exploited as an immunotherapeutic vaccine to establish antiviral or antitumor immunity (Liu, 2003).

Lipoplexes For intravenous injection of plasmid DNA a carrier vector is necessary. A number of synthetic vectors primarily based on cationic lipids and –polymers have been developed. Cationic lipid-DNA complexes, lipoplexes, are easily manipulated and have the potential to deliver large polynucleotides into somatic cells (Tranchant et al., 2004). They form electrostatic complexes with the negatively charged DNA and can be taken up by cells. Lipoplexes have a limited capacity for systemic application because of their rapid clearance from plasma, accumulation in lung tissue and toxic side effects. Incorporation of PEG lipids into the lipoplex increases their circulation time. Direct in vivo application of lipoplex particles to the site of pathology has resulted in clinical response in human gene therapy trials for the treatment of cancer (Hortobagyi et al., 2001; Stopeck et al., 2001), cystic fibrosis (Hyde et al., 2000) and restenosis and myocardial and lower limb ischemia (Laitinen et al., 2000; Mäkinen et al., 2002).

43

Polyplex and lipopolyplex systems Polyplex systems consist of complexes formed by nucleic acid and a cationic polymer such as polyethylenimine, poly-L-lysine and cationic peptides (Brown et al., 2001). Compared to cationic lipids, cationic polymers are more efficient in condensing DNA and consequently in protecting DNA from nuclease degradation. Small size has also been associated with increased nuclear localization and transgene expression. The accessible free amino groups on these agents facilitate conjugation of a variety of targeting ligands such as galactose, asialorosomucoid, transferrin and monoclonal antibodies to enhance the transfection efficiency of the complex in specific cell types. To aid the escape of the DNA-cationic carrier complex from the endosome the polycation gene delivery systems are usually coupled with synthetic peptides mimicking viral fusogenic peptides, pH-responsive histidine-based systems, polycations with intrinsic endosomolytic activity based on a buffering effect, and polyanions mimicking the anionic amphiphilic peptides (Cho et al., 2003).

Lipopolyplex systems are hybrid complexes prepared by condensing DNA with a polycation and entrapping this polyplex within anionic or neutral liposomes (Brown et al., 2001). The method provides better protection from endonucleases and results in less toxic gene transfer when compared with cationic liposomes alone. Hybrid vectors that combine the merits of viral and non-viral gene transfer vectors have been generated to augment nuclear delivery and enhance transgene expression (Niidome and Huang, 2002; Schmidt-Wolf and Schmidt-Wolf, 2003).

2.3.3. Development of targeted and regulated gene transfer vectors

Viruses have adapted to overcome the barriers of strong containment of the genome, the natural barrier which all life has evolved to maintain the integrity of genetic information. For this reason, viruses appear to be the ideal natural gene delivery vehicles. Indeed, numerous viral features can be utilized for gene therapy purposes; however, in order to comply with the requirement of safe and efficient gene therapy, a number of factors must be taken into account while developing optimal viral vectors.

First, the choice of parental virus must be considered taking into account potential viral pathogenicity, toxicity and other factors hazardous to humans. The possibility of replication-competent virus formation should be eliminated, and also the possibility of recombination between viral-based vectors and human endogenous viruses should be minimized. The inclusion of selectable markers into the vector backbone should be evaluated because of their potential immunogenicity (Riddell et al., 1996). The vector infectivity and duration of transgene expression in the target tissue in each specific application should be considered. Where pertinent, features enabling controlled evasion of host defense systems such as the serum complement system and immune responses (against viral vector, proteins encoded by the vector, and the transduced cells) would be of interest for incorporation into the vector system. Targeting and specificity of the vector to desired tissues or organs should be contemplated in order to avoid unpredictable side effects due to ectopic expression of the transgene in normal tissues. The regulation and control of the transgene expression post-cell transduction should be considered in order to enable transgene activation when necessary for the maintenance of transgene expression within a therapeutic window, and for possibility of transgene silencing if that becomes

44

necessary. Many of these features have been meticulously studied in a number of viral vector systems.

2.3.3.1. Targeted vectors

The general applicability and safety of gene therapy depends on theefficiency of the gene transfer in directing a therapeutic gene specifically to a target tissue and/or cell. Furthermore, targeting the transgene to a specific locus in the host genome by homologous recombination would be of interest when correcting a genetic defect by gene therapy.

2.3.3.1.1. Targeting cell surface receptors

In order to redirect the viral host range and achieve specific binding of viral particles to the target cells in vivo, chimeric viral envelopes or capsids have been engineered. Natural ligands of surface molecules, antibody derivatives, and single-chain antibodies for the extra cellular domain of cell surface receptors, have been inserted into the receptor binding envelope or capsid subunit of the vector (Girod et al., 1999; Nguyen et al., 2003; Räty et al., 2004; White et al., 2004). However, the infection efficiency of such chimera has been poor, limiting their feasibility for clinical use (Zhao et al., 1999). Bridging the virus vector and the target cell by antibodies or ligands is another approach (Boerger et al., 1999; Korokhov et al., 2003). Further, the choice of the viral serotype has an effect on the tissue specificity of AAV vector (Buning et al., 2003), whereas, the choice of viral envelope has its impact on tissue specificity among retro- and lentiviral vectors (Kang et al., 2002; MacKenzie et al., 2002; Sung and Lai, 2002; Kahl et al., 2004). Indeed, viral envelope proteins derived from HBV (MLV vector) (Sung and Lai, 2002), and RRV (FIV vector) (Kang et al., 2002) have proven potential for liver-specific targeting.

Liver-targeted receptor-mediated endocytosis The asialoglycoprotein (ASGP) receptor, a high affinity cell-surface receptor exclusively expressed in hepatocytes, and ASGP receptor-mediated endocytosis have been widely used as a liver-targeting system in combination with non-viral vectors (Fukuma et al., 2000; Arangoa et al., 2003). The ASGP receptor-mediated endocytosis pathway was further exploited when the MMLV vector was pseudotyped with Sendai virus glycoprotein F (SV-F) (Spiegel et al., 1998). A unique feature of SV-F is its ability to function as a ligand for the hepatocyte-specific ASGP receptor, which resulted in enhanced expression in HepG2 cells in vitro after MMLV / SV-F transduction. The same approach has also proven functional in combination with lentiviral vectors in vitro (Kowolik and Yee, 2002). However, the transduction efficiency of the SV-F pseudotypes was relatively low possibly owing to inefficient release of the internalized vector from the endosome compartment. In addition, the recovery after concentration of the SV-F pseudotypes was reduced when compared to the VSV-G pseudotypes, but still 50 times higher than with MMVL env. SV envelope (F-virosome) has also been utilized in a viral – non-viral hybrid system in which the transgene was packed and delivered to hepatocytes in vivo within the F virosome (Ramani et al., 1998).

Another receptor-mediated targeted gene transfer was successfully manifested when a ligand derived from apo E was incorporated in an AAV vector (Loiler et al., 2003). The

45

mutant AAV – apo E capsid was shown to direct the vector particle to the endocytosis pathway mediated by LDLR or other receptors of the LDLR family.

2.3.3.1.2. Transcriptional targeting

Transcriptional targeting using a combination of cell-specific promoter/enhancer elements that exhibit cell-type specific gene expression is another approach to cell-specific targeting. Transcriptional targeting can be used to compensate for the lack of cell-type specificity of the vector thereby allowing efficient and stable expression of the transgenes. These include genes coding for proteins whose accurate performance is dependent on their synthesis in the correct cell type because of, for instance, the requirement for distinct post-translational modifications. With this technique, gene transfer can result in widespread vector assimilation, but gene expression is limited to the target cell population. Cell-type specific promoters have been used for a variety of targeted gene expression studies in numerous cell populations and tissues (Walther and Stein, 1996).

Liver-specific promoter/enhancer elements A number of natural liver-specific promoter / enhancer elements are known. These include phosphoenol-pyruvate carboxykinase (PEPCK), human α1-antitrypsin (hAAT), albumin, and transthyretin promoters (Guo et al., 1996; Walther and Stein, 1996; Papadakis et al., 2004). Several studies have been performed in which the liver-specificity of these and other liver-specific promoters has been demonstrated (Sandig et al., 1996b; Le et al., 1997; Koeberl et al., 1999). The major disadvantage of the use of the liver-cell specific promoters in gene therapy is their lower transcriptional activity by comparison with strong viral and cellular enhancers such as cytomegalovirus (CMV), LTR, SV40 viral enhancer, and human elongation factor 1α (Hafenrichter et al., 1994; Guo et al., 1996). However, their potency lies in the lower cellular and humoral immune responses in vivo, which is due to the lack of ectopic expression of the transgene in other tissues; and the resulting prolonged transgene expression (Ding et al., 2002; Follenzi et al., 2004).

Recently chimeric liver-specific promoters have been generated. With an AAV-2 vector expressing clotting factor IX (FIX) under the transcriptional control of a synthetic liver-specific promoter, liver-specific transgene expression was achieved in mice and dogs after portal vein or intravenous injection. The promoter contained the thyroid hormone-binding globulin (TBG) promoter sequences, two copies of a1-microglobulin/bikunin enhancer sequences (ABP), and a 71-base pair leader sequence) (Ill et al., 1997) alone (Wang et al., 1999) or in conjunction with cis-acting regulatory elements (β-globin intron and WPRE) (Harding et al., 2004). Further, a conglomerate of minimal regulatory sequences from the strong SV40 viral enhancer together with the liver-type pyruvate kinase promoter harboring its TATA box and a hepatocyte nuclear factor 1 α binding site, was shown to create a potent artificial tissue-specific promoter (Park et al., 2004).

In order to identify the most suitable combination of known liver-specific promoter and enhancer elements (i.e. alcohol dehydrogenase 6 (ADH6), hAAT, cholesterol 7alpha-hydroxylase, clotting FIX, apo E/C-I, and ABP) Gehrke et al. carried out a comparative investigation of a total of 25 synthetic hepatocyte-specific transcriptional control elements in vitro and in vivo. The conclusion was that a combination of the ADH6 basal promoter linked to two tandem copies of an apo EC-I enhancer element was found to be the strongest of those analyzed transcriptional control units for the liver-specific expression of

46

transgenes. This chimeric promoter led to 117-fold transcriptional activity in HepG2 human hepatoma cells in vitro, and 40- to 45-fold activity in mouse liver after intravenous plasmid DNA injection by comparison with the transcriptional activity achieved with the SV40 promoter (Gehrke et al., 2003).

A comparable study evaluated tissue specificity, activity, and length of gene expression driven by chimeric constructs merging regulatory sequences of the albumin, hAAT, HBV core protein, and hemopexin genes in vitro and in vivo (6h – 50 days) (Kramer et al., 2003). The results were compared to the transcriptional activity of CMV promoter, which was shown to be 10 times higher in comparison with the SV40 promoter. The hAAT promoter alone or when linked to the albumin or HBV enhancers was shown to be the most potent in directing stable gene expression in liver cells. Almost 40% of CMV activity (4-fold activity compared to SV40) was yielded when the hAAT promoter was used alone, and when used in combination with the HBV enhancer up to 253-fold enhancement was achieved yielding 180% of CMV activity in HepG2 cells. Furthermore, the in vivo transgene expression levels from the hAAT-HBV enhancer chimera were comparable to the expression levels from the CMV promoter for one week, after which the transgene expression levels from the CMV promoter decreased more than 100-fold, whereas the expression level from the hAAT-HBV was shown to be more stable. The results from these comparative studies, however, may not directly correlate with viral gene transfer (Miao et al., 2000) and further evaluation is needed to determine its feasibility with viral vector applications.

2.3.3.1.3. Gene targeting

Gene targeting, the use of homologous recombination to produce defined alterations to target cell genome, can lead to accurate, site-specific correction of genetic defects as well as constituent endogenous regulation of the “corrected” gene. Unlike viral-mediated gene insertion, gene repair causes no damage to improper regions of the genome nor does it produce deleterious mutations. Numerous gene targeting approaches have been attempted in vitro as well as in vivo employing chimeric RNA-DNA oligonucleotides or chimeraplasts, single-stranded oligonucleotides, triplex-forming oligonucleotides, small-fragment homologous replacement, and viral vectors with varying levels of success (Andersen et al., 2002; Hendrie et al., 2003; Liu et al., 2004b). However, the current gene targeting technology is too inefficient for in vivo use and further understanding of the cellular mechanisms involved in the activation of the endogenous repair pathways and the underlying protein factors, as well as further improvements and optimization in the gene targeting methodology, will be needed in order to fulfil the therapeutic potential of this strategy.

Liver-specific gene targeting Gene targeting can be utilized for gene repair of a number of single-nucleotide genetic disorders originating in the liver. Gene targeting utilizing chimeric RNA-DNA oligonucleotides and single-stranded oligonucleotides has been implemented in a few in vivo liver-directed gene therapy studies with varying success (Richardson et al., 2002; Lu et al., 2003). However, the methodology of gene targeting in vivo is still inefficient, and further developments are needed for it to become clinically applicable.

47

2.3.3.2. Transcriptionally regulated vectors

The ability to regulate the timing, duration and level of transgene expression in the target cell via exogenous stimuli facilitates the maintenance of a gene product within a therapeutic range, makes it possible to adapt to disease evolution via adjustments in the transgene expression, and broadens clinical efficacy and safety as well as the application range of gene therapy. The development of ligand-dependent transcriptional regulatory systems for use in gene therapy is therefore of great importance. For a pharmacologically regulated gene therapy vector, several criteria should be met: 1) the ligand should activate rather than silence the transgene expression in order to avoid prolonged exposure to the silencer drug, and avoid the delay in induction due to the rate of drug clearance from the body; 2) no interference should occur with endogenous metabolic pathways; 3) gene expression should be tightly regulated in a dose-dependent way by an orally bioavailable, well-tolerated inducer drug that penetrates all tissues; and 4) induction and repression of the gene expression should be fully and rapidly reversible. (Toniatti et al., 2004)

The first attempts to develop inducible transcriptional regulation of the transgene utilized inducible internal promoters responding to heat shock, heavy metal ions, steroid hormones (Yarranton, 1992) or radiation (Manome et al., 1998). These applications suffer from severe limitations such as pleiotropic activity of the inducing agent and high basal activity. Since then several inducible systems combining functional domains from prokaryotic, eukaryotic and viral proteins to create chimeric transactivators have been developed (Toniatti et al., 2004). However, the number of clinically applicable regulatory systems available is limited, and all such systems require significant improvements. Common to all current regulatory systems are the use of a chimeric ligand-dependent transcription factor, and an artificial inducible promoter, comprising multiple binding sites for the DNA-binding domain of the transcription factor followed by a minimal promoter. Upon interaction with the exogenously added drug or hormone such as Tc, mifepristone (a synthetic progesterone antagonist), tamoxifen, ecdysone (insect hormone), rapamycin, pristinamycin, and erythromycin the transcription factor is recruited to (or released from) the target sequences of the promoter resulting in activation or silencing of transgene transcription.

2.3.3.2.1. TetON, TetOFF

The Tc dependent transcriptional switch has major advantages over the other gene regulation systems. Its inducer drug, Dox, has a well-known safety profile, is well tolerated, is orally bioavailable, has germane half-life of 14 – 22 h, and demonstrates good tissue penetration of the inducer drug (Klein and Cunha, 2001). The most widely studied eukaryotic gene regulation systems are the Tet-OFF2 (Gossen and Bujard, 1992) and Tet-ON3 (Gossen et al., 1995) systems based on the Escherichia coli (E.coli)Tn10 Tc resistance repressor protein (tetR) that binds to specific operator sequences (tetO) of the Tc resistance operon with high specificity (Orth et al., 2000). The interaction between tetR and tetO is prevented by Tc or its more potent analog, Dox. Dox binds to the repressor protein and induces an allosteric change resulting in the release of the repressor from its target DNA sequence.

48

In the TetOFF system, transcription activation from a Tc-responsive promoter results from binding of the Tc-regulated transactivator (tTA), a fusion protein of tetR and the VP16 activation domain of HSV, in the absence of the ligand (Dox) (Baron and Bujard, 2000). The TetOFF system has been widely used in animal gene therapy studies; however, due to its unfavorable kinetic properties (the drug is used to silence the transgene), it is unlikely to be implemented in clinical gene therapy applications.

In the reverse Tc-regulated TetON system, addition of the ligand (Dox) induces transcription activation via binding of a reverse Tc-transactivator (rtTA) on its target promoter (Fig. 8). The major drawbacks of the original TetON system, i.e. the requirement for high Dox doses for activity, the low intrinsic background activity due to residual affinity of the rtTA to tetO in the absence of Dox, and the instability of the rtTA (Baron and Bujard, 2000), were dramatically improved when two novel rtTA variants, rtTA-S2 and rtTA-M2, were isolated. Following the generation of these variants by random mutagenesis of the Tc repressor gene and screening for alleles with reverse binding properties, the variants were fused with three minimal activation domains, instead of the VP16, and engineered into the synthetic transactivators, rtTA2S-S2 and rtTA2S-M2, by gene optimization. These variants have highly improved properties with respect to basal activity, inducibility, Dox responsiveness and stability thus allowing stringent regulation of target genes in stably transfected eukaryotic cells. While functioning at 10-fold lower Dox concentrations than the original rtTA, rtTA2S-M2, the most promising new transactivator, exhibits no basal activity in the OFF state, and is more stable in eukaryotic cells (Urlinger et al., 2000).

FIG. 8 The TetON transcriptional regulation system.

Both novel transactivators have been shown to be capable of tightly controlling transcription of various transgenes after delivery to a number of tissues in vivo with diverse vectors (Aurisicchio et al., 2001; Lamartina et al., 2002). However, utilization of high vector doses resulted in partial slackening of the stringency of transcription control, which demonstrated an upper limit to the amount of vector that can be delivered.

Another strategy to circumvent the high basal activity of the rtTA system is to incorporate the Tc-responsive transcriptional silencer (tTS) in the TetON system (Freundlieb et al., 1999). In the absence of Dox tTS binds the promoter responsive for rtTA and inhibits basal transcription, whereas on addition of Dox, tTS dissociates from the tetO and

gene X tetO TATDox -

Dox + activation

gene X tetO TAT

rtTA2S-M2 rTetR-M2 VP1

transcription activator

reverse repressor

rtTA responding promoter

49

activation of rtTA initiates transcription. Using an optimized vector (Ad; AAV) the combination of rtTA/tTS was shown to significantly reduce the basal activity in vivo (Mizuguchi and Hayakawa, 2001; Rendahl et al., 2002). Furthermore, combining the rtTA2S-S2 or rtTA2S-M2 with the tTS has resulted in more stringent control than when either is used alone (Lamartina et al., 2003; Mizuguchi et al., 2003).

2.3.4. Gene transfer techniques

Two main gene therapy approaches for somatic cells have been pursued. First, ex vivo gene therapy involves removal of a segment of a specific organ, tumor or blood cells of an individual and the isolation of syngeneic cells to be grown in primary cell culture and subjected to gene transfer in vitro. These genetically altered cells are then transplanted back into the body where they produce the therapeutic protein. The benefits of the ex vivo approach include targeted transduction of a specific cell type and the possibility of avoidong vector particle inactivation by the active complement present in the host serum. Another method for delivering genes to the body is the direct in vivo injection of gene transfer vectors, thus eliminating the cumbersome steps of explanting, cultivating and transplanting the cells. The in vivo approach is usually less invasive than any procedure that entails surgery. During in vivo delivery, however, the gene transfer vehicles, whether viral or non-viral, may be attacked by components of immune system present in the blood before they have a chance to reach the target cell membrane. Furthermore, the in vivo setting offers less control over which cells are exposed to the gene transfer vector. However, with targeted and tissue specific vectors transduction can be limited to target cells.

A newly evolved approach, prenatal in utero gene therapy, may provide an alternative for a variety of hereditary and acquired diseases. It is based on the concept that application of gene therapy vectors to the fetus in utero may prevent the development of severe clinical disease by early intervention, allow targeting of otherwise inaccessible organs, tissues and stem cell populations with relatively low vector doses, avoid immune reaction against gene transfer vector and transgene protein because of the prenatal tolerance of the immature immune system, and provide postnatal tolerance against the therapeutic transgenic protein (Coutelle and Rodeck, 2002). However, in utero somatic gene therapy is still an experimental concept and insufficient data is available to date to ensure the safety of this procedure or to proceed to human clinical trials. A preliminary stage to in utero gene therapy might be the pre-natal cell transplantation procedures for the treatment of severe combined immunodeficiency disease (SCID) fetuses (Westgren et al., 2002; Peranteau et al., 2004).

2.3.4.1. Vascular gene transfer

The principal methods of introducing genetic material into blood vessels include in vivo gene transfer into the vascular wall and ex vivo gene transfer to vessel segments. Gene transfer into the artery wall can be accomplished from the lumen and from adventitia (Ylä-Herttuala, 1997). After the initial double-balloon catheter-mediated retroviral gene transfer to porcine ileofemoral arteries (Nabel et al., 1990) a number of intra-luminal catheter- and stent-based delivery methods have been generated for local in vivo gene transfer into the vessel wall (Gruchala et al., 2004b). Intra-vascular gene transfer has potential during

50

angioplasty and other intravascular manipulations (Ylä-Herttuala and Martin, 2000). Recently, adventitial gene transfer has shown promise as an alternative route for delivery of therapeutic genes into the artery wall (Laitinen and Ylä-Herttuala, 1998).

Adventitial gene transfer Adventitial gene transfer, in contrast to intra-arterial gene transfer, circumvents the physical barrier of the endothelium, internal elastic lamina and atherosclerotic lesions and avoids interrupting blood flow and plasma interference (Fig. 9). In addition,

inflammatory reaction against the vector may be diminished (Schneider et al., 1999) and systemic distribution of the gene transfer vector is reduced when periadventitial vector delivery is employed (Hiltunen et al., 2000). Biodegradable polymers mixed with antisense oligonucleotides (Simons et al., 1992), plasmid DNA (Indolfi et al., 1995) and Ad vectors (Feldman et al., 1997) have been used for gene transfer to the outer surface of vessels. Vector solutions have also been injected directly into the adventitia (Rios et al., 1995; Schneider et al., 1999) or into isolated adventitial space within silastic (Laitinen et al., 1997; Turunen et al., 1999; Airenne et al., 2000) and biodegradable collars (Pakkanen et al., 2000) or within biodegradable gel (Siow et al., 2003). Vector producing encapsulated cells have also been used for adventitial implantation (Armeanu et al., 2001). Adventitial gene transfer can be used for the delivery of diffusible or secreted therapeutic products into the arterial wall during such surgical procedures as coronary artery bypass surgery, peripheral vascular graft surgery, prosthesis and anastomosis surgery and endarterectomy (Ylä-Herttuala and Martin, 2000). Indeed, gene expression appears stronger after plasmid-liposome-mediated adventitial gene transfer than after intra-luminal gene transfer to canine saphenous vein grafts (Kalra et al., 2000).

Cell-based vascular gene transfer Another approach for vascular gene therapy is cell based gene transfer, which requires harvesting of vascular cells, ex vivo transduction and subsequent re-implantation. By this method a specific cell type can be isolated, gene transfer efficiency can be optimized and gene expression confirmed prior to re-implantation. Both of the major vascular wall cell types; SMCs and endothelial cells, have been utilized for cell-based vascular gene transfer (Clowes, 1997; Parikh and Edelman, 2000). SMCs have many properties that make them reliable for cell-based vascular gene transfer. In culture conditions these well-differentiated cells are robust and simple to handle with no stringent growth requirements, and also relatively easy to transduce. A number of different vectors have been used to transduce vascular SMC, including MMLV retroviral vectors (Clowes, 1997; Beltrao-Braga et al., 2002), Ad vectors (Ribourtout et al., 2003), AAV vectors (Lynch et al., 1997) and lentiviral vectors (Dishart et al., 2003). Moreover, including an SMC-specific promoter together with enhancer elements in the vector has been shown to increase transgene expression in

Fig. 9 Schematic diagram of arterial layers

INTIMA

MEDIA SMC

endothelium

ADVENTITIA

lumen

internal elastic lamina

external elastic lamina

51

vascular SMCs (Appleby et al., 2003). Transduced SMCs do not appear to be transformed and are long-lived after implantation. After the initial demonstration of SMC-based intravascular gene transfer (Plautz et al., 1991) a number of SMC-based applications have been reported for endovascular remodeling after injury (Clowes et al., 1994; Ribourtout et al., 2003), for biological lining of vascular grafts (Geary et al., 1994; Eton et al., 2004) and for systemic delivery of gene products (Osborne et al., 1995). Systemic delivery has also been accomplished after adventitial delivery of transduced SMCs (Beltrao-Braga et al., 2002), and after subcutaneous and intraperitoneal transplantation of transduced vascular SMCs within a bioisolator device (Yanay et al., 2003).

2.3.4.2. Liver-directed gene transfer

The liver is one of the most attractive sites for gene transfer because of its major role in many metabolic processes and involvement in a large variety of diseases. The liver fulfills many vital processes in mammals. It is the central organ of energy metabolism, biotransformation of xenobiotics, and synthesis of plasma proteins under physiological and pathophysiological conditions. The liver is the organ that synthesizes most of the body’s circulating plasma proteins, including lipoproteins. In addition to other functions, such as degradation of drugs and toxins, uptake, processing and storage of several vitamins and iron, the liver is involved in many important metabolic pathways, including lipid metabolism. Thus, hepatic gene therapy may provide an approach to therapy for various diseases of hepatic function, inherited as well as acquired or multifactorial. By means of gene therapy, the liver hepatocytes may also be used as bioreactors to secrete therapeutic proteins into the blood.

2.3.4.2.1. Delivery route

Gene transfer into mammalian hepatocytes has been accomplished using both ex vivo and in vivo (Ghosh et al., 2000) and also in utero (Lipshutz et al., 1999; MacKenzie et al., 2002) approaches. Hepatocytes are easily accessible to vectors injected into the circulation through large pores in liver capillaries (Fraser et al., 1995). Liver-directed gene therapy has been studied for the treatment of several diseases like dyslipidemia (Oka and Chan, 2002), hemophilia A and B (Van den Driessche et al., 2003), lysosomal storage disordes (Cheng and Smith, 2003), and diabetes mellitus (Nett et al., 2003). In vivo targeting to the liver has been performed by injecting DNA or viral vectors into the liver parenchyma (Kuriyama et al., 2000), splenic capsule (Chen et al., 2000), isolated liver lobes via portal vein or bile duct (Zhang et al., 2001), hepatic artery (Raper et al., 2002), or portal vein (Kozarsky et al., 1994; Pakkanen et al., 1999b) or through bile duct or portal vein perfusion of the liver (De Godoy et al., 2000). The development of a safe and efficient gene transfer vector has been a major challenge in liver-directed gene therapy. None of the currently available means of gene transfer to the liver is optimal for all types of applications. Several viral and non-viral vectors have been generated for liver gene therapy for use in specific situations.

52

2.3.4.2.2. Vectors for liver-directed gene transfer

Long-term correction of the genetic diseases affecting the liver will require stable integration of the therapeutic gene into the host genome. This has been accomplished by a number of gene transfer vectors.

Injection of naked plasmid DNA under the transcriptional control of a liver-specific promoter into mouse tail vein has resulted in low level episomal transgene expression of up to 1.5 years from mouse livers (Zhang et al., 2000; Miao et al., 2001; Miao et al., 2003). This is not surprising, since episomal persistence of DNA has been used in nature by viruses to establish a latent state in host cells conferring life-long expression of some genes from the viral genome (Goins et al., 1994). Recent innovations including mechanically massaging the liver (Liu et al., 2004a), and plasmid DNA delivery into the rabbit portal vein via a balloon occlusion catheter (Eastman et al., 2002) have further enhanced the level of gene expression after intravenous injection of naked plasmid DNA. In addition, a hammering bullet gene gun instrument (Kuriyama et al., 2000), microencapsulation of recombinant cells (Sun et al., 1986; Hortelano et al., 1999), nanoparticles (Yamada et al., 2003), and utilization of transposon technology (Yant et al., 2000; Mikkelsen et al., 2003) have shown potential for liver gene therapy. Short term efficient gene transfer has been accomplished by these methods; however, further development is needed before implementation in human gene therapy.

First-generation Ads as well as the newly developed helper-dependent gutless Ad vectors have been shown to transduce a significant proportion of hepatocytes after intravenous delivery in animal models (Connelly, 1999; Ehrhardt et al., 2003). The longevity of the adenoviral transgene expression in the liver has been improved by incorporating liver-specific promoters in the vector (Pastore et al., 1999; Oka et al., 2001; Van Linthout et al., 2002).

AAV virus based vectors have yielded promising results in hepatic gene transfer (Koeberl et al., 1997; Snyder et al., 1999; Mount et al., 2002; Mochizuki et al., 2004). Successful results in animal models of hemophilia B have prompted the initiation of human clinical trials of direct AAV vector delivery to the liver via a catheter to the hepatic artery (High, 2001). However, there are indications that in some settings, the AAV vector may initiate a detectable cellular and humoral immune response to the transduced gene product in vivo (Brockstedt et al., 1999). By using alternatives to AAV-2 serotype based AAV vectors or pseudotype AAV vectors it may be possible to evade the immune response to the AAV-2 capsid protein as well as enhance liver directed gene transfer (Mingozzi et al., 2002; Grimm et al., 2003; Sarkar et al., 2004). Furthermore, incorporation of a liver-specific promoter into the vector backbone has been shown to improve the potency of the AAV vector to transduce hepatocytes in vivo after delivery into the mouse liver (Xiao et al., 1998; Nakai et al., 1998; Wang et al., 1999). In the study of Harding et al. tail vein injection of an AAV-2 vector into mice resulted in 20-30% lower transgene expression than portal vein injection; however, when an AAV-2 vector under a liver-specific promoter was used 25.6 ± 12.6% of hepatocytes stained positive for the transgene, whereas a vector under a ubiquitous promoter led to 5.2 ± 3.2% transduction efficiency (Harding et al., 2004).

53

Hepatocyte transduction with retroviral vectors has been performed on cultured primary hepatocytes in vitro (Wolff et al., 1987; Armentano et al., 1990; Grossman et al., 1991) and ex vivo (Grossman et al., 1992; Kay et al., 1992), and also in vivo after hepatocyte stimulation either by partial hepatectomy (up to 70%) alone (Ferry et al., 1991; Cai et al., 1998; Podevin et al., 2000) or in combination with thymidine-kinase – ganciclovir pre-treatment (Pakkanen et al., 1999a; Pakkanen et al., 1999b), by toxic gene products (Lieber et al., 1995) and by hepatocellular mitogens (Bosch et al., 1996; Patijn et al., 1998; Xu et al., 2003). The use of the traditional MMLV-based vectors has resulted in modest gene transfer efficiency, rarely exceeding 1%. Pseudotyping the standard MMLV retrovirus with VSV-G envelope protein resulted in improved and prolonged transgene expression in rat and in WHHL rabbit liver (Shiraishi et al., 1999; Pakkanen et al., 1999a). Hepatocyte transduction has also been enhanced by complete vascular exclusion and in situ perfusion of the liver with retrovirus-containing solution after partial hepatectomy (Ferry et al., 1991; De Godoy et al., 2000). However, the need for major surgery or liver damage before integrative gene transfer with retroviruses is clinically undesirable.

HIV-1 based lentiviral vectors have been shown to transduce stably quiescent hepatocytes in vivo and ex vivo (Kafri et al., 1997; Nguyen et al., 2002); however, some studies have shown that lentivirus-mediated gene transfer to liver is greatly enhanced when provided during hepatocellular cycling (Park et al., 2000a) or regeneration induced by partial hepatectomy or direct hyperplasia (Park et al., 2000b; Ohashi et al., 2002). Further improvements to the vector backbone, however, reduced the need for cell cycle progression for lentiviral vectors to transduce quiescent hepatocytes in vivo (Park and Kay, 2001; Pfeifer et al., 2001; Follenzi et al., 2002; Tsui et al., 2002; Van den Driessche et al., 2002; Giannini et al., 2003). Incorporation of a liver specific promoter to drive the lentiviral expression cassette has been shown to restrict the transgene expression to hepatocytes and to alleviate the activation of the host immune system (Follenzi et al., 2002; Oertel et al., 2003; Park et al., 2003). Pseudotyping of a lentiviral vector with SV-F (Kowolik and Yee, 2002) or RRV glycoproteins (RRV-G) (Kang et al., 2002) conferred hepatocyte specificity on the vectors. RRV-G also caused less cytotoxicity in comparison to the more common VSV-G. Furthermore, lymphocytic choriomeningitis virus glycoprotein pseudotyped lentiviral vectors have been shown to result in minimal hepatic injury compared to the VSV-G pseudotyped lentiviral vector in mice (Beyer et al., 2002).

2.3.5. Apolipoproteins in gene therapy for hyperlipidemia

2.3.5.1. Apo E

Apo E is considered to have therapeutic potential for improving lipoprotein metabolism based on its physiological role in mediating the interaction of lipoproteins with cell surface receptors, both LDLR and LRP, and thereby modulating the in vivo catabolism of various lipoproteins, including the atherogenic, cholesterol-rich VLDL and chylomicron remnants. Furthermore, its molecular properties, namely stability, water solubility, and simultaneous binding of lipids and other molecules, make it an attractive molecule for therapeutic purposes. In order to evaluate the potential of apo E in gene therapy for hyperlipidemia and atherosclerosis, several studies have been performed using a variety of animal models.

54

Among the first pieces of evidence of the potential of apo E in treating hyperlipidemia were the results from direct injections of apo E protein into the circulation of WHHL rabbits. Up to 60% reductions in plasma cholesterol levels, mostly owing to an accelerated plasma clearance of remnant lipoproteins, were detected after intravenous injection of recombinant apo E in WHHL and cholesterol fed rabbits (Mahley et al., 1989; Yamada et al., 1989). Sustained administration (3 times a week for 8.5 months) of purified rabbit apo E had no effect on plasma cholesterol levels but was shown to prevent the progression of atherosclerosis in WHHL rabbits (Yamada et al., 1992). Moreover, hepatic overexpression of rat apo E reduced plasma cholesterol levels and suppressed diet-induced hypercholesterolemia as well as atherosclerosis in the absence of functional LDLR in transgenic LDLR-/- mice (Osuga et al., 1998). More recently, hepatic overexpression of human apo E3 (20 – 43mg/dl) has been shown to induce highly significant regression of pre-existing advanced atherosclerosis without marked changes in total plasma cholesterol levels or lipoprotein composition after adenoviral gene transfer in LDLR-/- mice (Tangirala et al., 2001).

Generation of the apo E knockout mouse (apoE-/-) (Plump et al., 1992; Zhang et al., 1992) provided the basis for many studies regarding the anti-atherogenic potential of apo E. The severely hypercholesterolemic phenotype and spontaneous atherosclerosis of the apoE-/- mouse (Nakashima et al., 1994; Reddick et al., 1994) can be prevented by bone marrow transplantation (Linton et al., 1995; Hasty et al., 1999), and macrophage-specific expression of the human apo E transgene (Bellosta et al., 1995; Gough and Raines, 2003). Macrophage-derived apo E has been suggested to delay the development of atherosclerosis through a receptor-dependent pathway (Yoshida et al., 2001). Several studies have shown that the anti-atherogenic nature of apo E functions via the plasma compartment as well.

Therapeutic apo E expression has been achieved after intradermal engraftment of murine embryonic yolk sac endothelial cells (Cioffi et al., 1999), and naked DNA, adenovirus and AAV-mediated gene transfer to liver and muscle (Kashyap et al., 1995; Tsukamoto et al., 1999; Rinaldi et al., 2000; Tangirala et al., 2001; Harris et al., 2002b). Direct comparison of two non-macrophage-specific delivery routes, the intramuscular and systemic delivery (liver-targeting) showed that liver-specific expression of apo E (but not muscle-derived expression) resulted in normalization of plasma cholesterol levels and retarded progression of early atherosclerosis and regression of late atherosclerotic plaques after adenovirus-mediated gene transfer of apo E (7.5±0.98mg/dl) (Harris et al., 2002a). However, the low transduction efficiency of muscle, possibly due to the 100 times lower levels of coxsackie and adenovirus receptors in muscle tissue than in liver tissue, probably affected the outcome of the treatment.

Apo E3, the most common fully functional apo E isoform, has been shown to be more potent than apo E2 or apo E4 for gene therapy of hyperlipidemia and for regression of both early atherosclerotic lesions and advanced complex lesions. A direct comparison of the apo E isoforms by adenoviral gene transfer into the liver of apoE-/- mice demonstrated the impaired ability of apo E2 to clear VLDL, IDL and remnant lipoproteins from the circulation. Moderate levels of apo E3 and apo E4 expression lead to normalization of the hypercholesterolemia and a dose-dependent, but moderate increase in serum triglyceride levels (Tsukamoto et al., 1997; Tsukamoto et al., 1999). However, apo E2 and apo E4 exhibit residual anti-atherogenic activity and have been shown to prevent the

55

progression of early atherosclerosis, but not advanced complex lesion regression (Tsukamoto et al., 1999; Athanasopoulos et al., 2000).

An optimal level of apo E is required for lipoprotein clearance from the circulation. Normal cells maintain optimal apo E level via apo E recycling (Heeren et al., 1999b; Swift et al., 2001). Genetic deficiency or the presence of dysfunctional forms of apo E generally cause hypercholesterolemia or type III HLP with marked increase in VLDL and IDL levels and premature atherosclerosis both in humans (Mahley et al., 1999) and in mice (Plump et al., 1992; Zhang et al., 1992). At physiological concentration apo E promotes efficient clearance of apo E-containing lipoprotein remnants (van Dijk et al., 1999). However, marked overexpression of human apo E3 causes massive hypertriglyceridemia (HTG) in transgenic mice (Huang et al., 1998), and HTG together with hypercholesterolemia in transgenic rabbits, apoE-/- knockout mice and apoE-/-LDLR-/- double knockout mice (Huang et al., 1999; van Dijk et al., 1999; Maugeais et al., 2000). Further, a subtle to moderate increase in apo E expression results in accumulation of LDL cholesterol in plasma of transgenic rabbits (Fan et al., 1998).

Major contributors to the apo E induced hyperlipidemia are apo E-dependent stimulation of hepatic VLDL production, enhanced VLDL clearance and interference with apoC-II-dependent VLDL lipolysis (van Dijk et al., 1999; Tsukamoto et al., 2000a). The carboxy-terminal segment of apo E has been associated with the increased production rate of VLDL (Kypreos et al., 2001b). Therefore, the hypertriglyceridemic effect of apo E overexpression can be surmounted by deletion of the C-terminal lipid binding domain of apo E (Kypreos et al., 2001a; Gerritsen et al., 2003).

Low plasma apo E levels independent of delivery route appear to possess therapeutic potential in limiting the progression of the early stages of atherogenesis without normalizing the plasma concentration of atherogenic remnant lipoprotein particles (Hasty et al., 1999; Athanasopoulos et al., 2000; Thorngate et al., 2000; Harris et al., 2002b). It has been suggested that the low level of apo E present in the circulation may prevent the accumulation of remnant lipoproteins on the vessel wall, a development of atherosclerotic lesions that precedes the attachment of monocytes, and thus protect against early lesion development. Other anti-atherogenic properties of apo E may also be involved in the apo E-mediated prevention of atherosclerosis.

2.3.5.2. ApoA-I, apoA-IMilano

Another anti-atherogenic apolipoprotein is the apolipoprotein A-I (apo A-I), the major protein constituent of HDL. HDL is one of many factors that participate in the regulation of the atherosclerotic process and reduced levels of HDL are associated with higher incidence of CHD (Young et al., 2004). In addition to its antioxidant, anti-inflammatory, and anti-thrombotic properties HDL mediates reverse cholesterol transport from peripheral tissues, including the arterial wall, to the liver for excretion. This feature of HDL is considered responsible for the strong inverse correlation between plasma HDL levels and CHD. As demonstrated by numerous in vivo experiments apo A-I seems to carry the major responsibility in the anti-atherogenic activity of HDL. Overexpression of human apo A-I leads to an increase in the number of circulating HDL particles and a decrease in diet- or gene-induced atherosclerosis in transgenic mice and rabbits (Paszty et al., 1994; Duverger et al., 1996). In humans an infusion of apo A-I – phospholipid complexes has been shown to lead to an increased cholesterol efflux with production of small HDLs, and to enhanced

56

bile acid and neutral sterol excretion (Eriksson et al., 1999; Nanjee et al., 1999). An apo A-I –mediated protective effect on the arterial wall has also been reported after gene transfer to apoE-/- and LDLR-/- mice (Kawashiri et al., 2001; Pastore et al., 2004).

Apo A-IMilano, a natural variant of human apo A-I (Weisgraber et al., 1980) originally described in a population with low cardiovascular risk (Franceschini et al., 1980), has been shown to confer on its carriers significant protection against vascular disease despite their reduced HDL levels (Sirtori et al., 2001). The HDL fraction of individuals with the apo A-IMilano variant and another cardioprotective apo A-I isoform, the apo A-IParis, has been shown to consist primarily of the small HDL-3 (Bruckert et al., 1997). Unlike the larger HDL-2 particles, HDL-3 have been associated with a reduced risk of progression of CHD (Yu et al., 2003a) and inhibition of LDL oxidation (Kontush et al., 2003). Also, both apo A-I variants, apo A-IMilano and apo A-IParis have been reported to exhibit more potent antioxidant activity than the wild type apo A-I (Bielicki and Oda, 2002). Moreover, repeated systemic infusions or a single localized injection of recombinant apo A-IMilano (Calabresi et al., 1994) – phospholipid complexes have been shown to produce vasculoprotective effects via rapid mobilization of cholesterol from existing atherosclerotic plaques in rabbits and pigs after arterial injury (Chiesa et al., 2002; Kaul et al., 2003), and in cholesterol-fed apoE-/- mice (Shah et al., 2001). In humans short term weekly infusions of apo A-IMilano – phospholipid complexes have resulted in an average reduction of 4.2% in the volume of coronary atheroma (Nissen et al., 2003). Although the preliminary data appears promising, more data from larger clinical trials will be needed to confirm the effects of apo A-IMilano in reducing atherosclerotic plaque burden.

2.3.5.3. Apobec-1

Given that apo B-100 –associated lipoproteins (VLDL and LDL) are much more atherogenic than apo B-48 –associated lipoproteins (chylomicrons and their remnants and VLDL), apobec-I, the catalytic subunit of apo B editing enzyme, has been considered potentially useful for gene therapy of hyperlipidemia. It was shown to limit the generation of atherogenic apo B-100 –containing lipoproteins and to significantly reduce plasma LDL-cholesterol levels in rabbits (Greeve et al., 1996; Kozarsky et al., 1996a). However, uncontrolled transgenic expression of apobec-I leads to nonspecific editing of mRNAs and hepatocellular dysplasia and carcinoma in transgenic mice and rabbits (Yamanaka et al., 1995). While no adverse effects were observed when apobec-I was expressed at low or moderate levels (Qian et al., 1998), the possibility of using apobec-I directly as a therapeutic agent through a protein transduction domain of HIV-1 Tat protein has been suggested, as in this way precisely controlled levels of the transgene induction were transiently maintained in primary rat hepatocytes in vitro (Yang et al., 2002b).

2.3.6. Human gene therapy

Human gene therapy is a complex, multiphase process involving the identification of genes causing or related to disease, development, in vitro testing and manufacturing of the gene transfer vectors, preclinical testing and toxicology studies in animal models, and clinical development of gene therapy products through the three phases of clinical trials. Many metabolic diseases are potential candidates for treatment with gene therapy. Candidate diseases include those caused by a single gene defect such as SCID and FH, more

57

complex multifactorial diseases, including diabetes mellitus and atherosclerosis, and acquired diseases like AIDS.

The first phase 1 gene therapy clinical trial, which aimed to provide detailed information on the safety and feasibility of the gene therapy procedure, began on September 14, 1990 when a 4-year-old girl with SCID was injected with autologous T cells transduced ex vivo with a retroviral vector containing the human ADA cDNA (Blaese et al., 1995). A 12-year follow-up of that study has been reported, which has shown that, ten years after the last ex vivo transduced cell infusion, approximately 20% of the patients lymphocytes still carry and express the retroviral gene; however, the expression was not considered sufficient to allow withdrawal of the supplementary PEG-ADA treatment (Muul et al., 2003). Two other patients, treated with the same transduction protocol (Blaese et al., 1995; Onodera et al., 1998), developed precipitating antibodies against fetal bovine serum, present in the infused cell suspension. Antibodies to MMLV p30 core protein were also detected from the patients following the cell infusions. One patient was positive for p30 antibodies as long as eight years after the final cell infusion (Muul et al., 2003).

Subsequently, successful gene therapy after retroviral ex vivo gene transfer to the autologous hematopoietic stem cells of nine out of eleven infants with sustained (up to over four years) correction of SCID phenotype has been reported (Cavazzana-Calvo et al., 2000; Hacein-Bey-Abina et al., 2002; Hacein-Bey-Abina et al., 2003b). Unfortunately, almost three years after completing therapy, two children developed T cell leukemia, possibly owing to insertional mutagenesis associated with retrovirally mediated gene transfer (Hacein-Bey-Abina et al., 2003a; Hacein-Bey-Abina et al., 2003b). Another adverse event, systemic inflammatory response syndrome, leading to the death of an 18-year-old male who participated in a safety study of E1,E4 deleted Ad-mediated gene transfer of human OTC into the right hepatic artery at high dose, has been reported (Raper et al., 2003). Despite these drawbacks, human gene therapy clinical trials are ongoing and success has been achieved e.g. in the treatment of malignant glioma (Sandmair et al., 2000). More than 900 gene therapy phase I to III clinical trials have been approved worldwide during the last 15 years. The majority (66%) of these trials were directed towards the fight against cancer, about 10% to the treatment of monogenic diseases and 8% to the treatment of vascular diseases (http://www.wiley.co.uk/genmed/clinical/).

2.3.7. FH gene therapy

2.3.7.1. Ex vivo approach

The first gene therapy technique developed for FH utilized the ex vivo approach. In it recombinant amphotropic retroviruses carrying the LDLR gene were used to transduce hepatocytes in WHHL rabbits (Wilson et al., 1990; Chowdhury et al., 1991), in baboons (Grossman et al., 1992), and eventually in the first human FH gene therapy clinical trial (Grossman et al., 1994; Grossman et al., 1995). Prior to use in human clinical trials, the techniques of hepatocyte delivery were refined using dogs and baboons (Grossman et al., 1992; Grossman et al., 1993). In the procedure, the patients underwent hepatic resection and placement of a portal vein catheter. Primary hepatocyte cultures were prepared from the resected liver and transduced with the retrovirus. The autologous hepatocytes were subsequently transplanted back into the donor liver via the portal circulation. In human

58

clinical trials, the technique was feasible and relatively safe. Nevertheless, it was laborious, difficult and time consuming, and resulted in only a modest lipid-lowering effect (Raper et al., 1996) probably owing to the difficulty of stably reimplanting a sufficiently high number of engineered hepatocytes to produce LDLR. In addition to autologous hepatocytes, human amniotic epithelial cells (HAEC) have been utilized for ex vivo gene transfer of LDLR cDNA in an adenoviral vector to WHHL rabbits (Takahashi et al., 2001). The genetically modified HAEC were transplanted to the liver of the rabbits and substantial, but transient (< 3 weeks) decreases in serum cholesterol were observed.

2.3.7.2. In vivo approach

Even though further developments have been reported in the ex vivo gene transfer methods utilizing lentiviral vectors (Nguyen et al., 2002; Giannini et al., 2003; Oertel et al., 2003), the direct in vivo approach offers an attractive alternative for liver gene therapy. In addition to being less invasive, in vivo gene therapy benefits from recent advances in targeted vector development (Lundstrom, 2003). Moreover, the generation of a non-invasive method utilizing a scintillation camera for monitoring successful liver-directed gene transfer of LDLR (Tietge et al., 2004) provides for further advances in the gene therapy methodology available for clinical gene therapy trials of FH.

Non-viral vectors An in vivo approach, utilizing a DNA–protein complex capable of targeting LDLR genes to hepatocytes, temporarily reconstituted hepatic LDLR activity after intravenous infusion into WHHL rabbits (Wilson et al., 1992), thus demonstrating the potential of in vivo gene transfer for developing non-invasive approaches to liver-directed gene therapies. Another non-viral approach for FH gene therapy was represented in the study of Parise et al. (Parise et al., 1999), in which a soluble chimera of LDLR and transferrin fusion protein was shown to bind LDL specifically and was internalized by WHHL rabbit fibroblasts in vitro. The chimera was also shown to produce a transient physiological effect in LDLR-/- mice after naked plasmid injection in vivo (Razzini et al., 2004). However, in order to obviate the potential undesired cholesterol accumulation in the extrahepatic tissues mediated by the ubiquitous representation of the transferrin receptor, LDLR should be bound to a ligand protein that is preferentially bound by a liver-specific receptor, such as the asialoglycoprotein (Wu et al., 2002). In another study transferrin served as an intravenous delivery vehicle for a cationic liposome rabbit LDLR cDNA complex to the leukocytes of WHHL rabbits (Shichiri et al., 2003). The method demonstrated a significant, but temporary (up to 3 weeks) decrease in plasma LDL cholesterol in rabbits.

Adenoviral vectors expressing LDLR, VLDLR, apobec-1 In vivo administration of the first generation, E-1 deleted Ad vectors resulted in efficient, yet transient (<3 weeks), LDLR gene transfer effect in LDLR-/- mice (Ishibashi et al., 1993) and in WHHL rabbits (Kozarsky et al., 1994; Li et al., 1995b; Cichon et al., 2004). Owing to the induction of humoral and cellular immune responses to the LDLR protein, a neoantigen in LDLR-deficient animals, overexpressing human VLDLR [94% homologous to the mouse protein (Gafvels et al., 1993)], instead of human LDLR [77% homology to the mouse counterpart (Polvino et al., 1992; Hoffer et al., 1993)], was considered as an alternative. It was hypothesized that ectopic VLDLR expression in liver would reduce serum cholesterol levels by catabolizing LDL precursors. Indeed, the use of VLDLR in an adenoviral vector led

59

to more prolonged metabolic correction in LDLR-/- mice, partly because of the less immunogenic nature of the transgene protein in the LDLR-/- mouse model (Kobayashi et al., 1996; Kozarsky et al., 1996b). Despite being more protracted, the transgene expression lasted only 3 – 9 weeks. This was not unexpected, because the first generation Ad vector, used in the studies, has been shown to induce inflammation and an immune response (Yang et al., 1994a; Yang et al., 1994b). Amelioration, although modest and transient (up to three weeks), of lipoprotein profile in the liver of WHHL rabbits was also obtained by recombinant Ad-mediated expression of apobec-1 (Kozarsky et al., 1996a).

The new gutless Ad vector, devoid of all viral coding regions, was shown to be less immunogenic than the first generation E-1 deleted Ad vector. Hence, gene transfer of the VLDLR under transcriptional control of a liver-specific PEPCK promoter (Short et al., 1992) within the new gutless Ad vector exhibited prolonged transgene expression of over six months in LDLR-/- mice (Oka et al., 2001). Also blocking of a CD40 ligand has resulted in inhibition of immune-mediated loss of transgene expression enabling long-term (≥ 3 months) reduction in plasma cholesterol levels after Ad-LDLR gene transfer to LDLR-/- mice (Stein et al., 2000). However, the chromosomal integration of Ad vectors is extremely rare (Harui et al., 1999) and therefore Ad vectors may not provide the best tool for stable amelioration of a genetic defect. Furthermore, Ad vectors have shown evidence of a potential to cause a fatal inflammatory immune response in the recipient (Lehrman, 1999; Marshall, 1999; Anonymous, 2002).

AAV vectors AAV vectors have shown the potential for stable transgene expression after intrasplenic injection of VLDLR in LDLR-/- mice where Chen and coworkers (Chen et al., 2000) demonstrated transgene stability over a period of seven months with a 40% reduction in plasma cholesterol levels. Moreover, serotypes AAV-7 and AAV-8 have been shown to be more potent in normalizing serum lipids and preventing atherosclerosis than the traditional AAV-2 serotype after LDLR gene transfer to the portal vein of LDLR-/- mice (Lebherz et al., 2004).

The outcomes of the LDLR-/- mouse studies, however, are unpredictable in humans since the LDLR-/- mouse does not strictly reflect the human disease. The lipoprotein metabolism of mice is inherently different from humans (Rader and FitzGerald, 1998; Daugherty, 2002), and unlike humans, LDLR deficient mice have only a mild elevation of serum cholesterol and little atherosclerosis. The double knock-out (LDLR negative and apobec-1 negative) mice would represent a better model of the human disease because they exhibit elevated serum LDL cholesterol and develop severe atherosclerosis (Powell-Braxton et al., 1998). Moreover, the WHHL rabbit provides a unique animal model for FH gene therapy because of the human-like distribution of their cholesterol between lipoprotein subclasses (LDL:HDL ratio) and because of their susceptibility to spontaneous atherosclerosis without high-fat challenge (Watanabe, 1980).

Retroviral and lentiviral vectors In order to improve the efficiency of the in vivo retrovirus-mediated gene transfer, stimulation of hepatocyte proliferation by partial liver resection and cytotoxic thymidine kinase – ganciclovir treatment were combined with repeated injections of retroviral vectors, carrying the LDLR cDNA, into the portal vein of WHHL rabbits (Pakkanen et al., 1999b). This led to a maximum of 35% decrease in total plasma cholesterol levels 2 – 3 months

60

after the gene transfer. However, when amphotropic retroviruses are used the need of stimuli for hepatocyte proliferation renders the method invasive and laborious. Subsequently lentiviruses have provided a new tool for liver-directed gene transfer. In contrast to retroviruses, lentiviruses are capable of integrating into chromosomes of non-dividing cells, such as hepatocytes, leading to long-term transgene expression thus making them a valuable candidate for liver gene therapy (Kafri et al., 1997). The ex vivo and in vivo gene therapy studies for treating FH are summarized in Table 5. TABLE 5. Summary of ex vivo and in vivo FH gene therapy studies

VECTOR TRANS-GENE ANIMAL

PHYSIO-LOGICAL EFFECTS

REF.

WHHL (Wilson et al., 1990; Chowdhury et al., 1991)

baboon (Grossman et al., 1992) retrovirus LDLR

HUMAN

modest (Grossman et al., 1994; Grossman et al., 1995)

EX VIVO

adenovirus LDLR WHHL transient (Takahashi et al., 2001)

DNA-protein LDLR WHHL transient (Wilson et al., 1992)

liposome-DNA transferrin

LDLR WHHL efficient, transient

(Shichiri et al., 2003)

transferrin fusion protein

LDLR LDLR-/- mice transient (Razzini et al., 2004)

LDLR-/- mice (Ishibashi et al., 1993) LDLR

WHHL efficient, <3wk (Kozarsky et al., 1994; Li

et al., 1995b)

VLDLR LDLR-/- mice 3-9wk (Kobayashi et al., 1996; Kozarsky et al., 1996b)

apobec WHHL modest, <3wk (Kozarsky et al., 1996a)

LDLR LDLR-/- mice ≥ 3 months (Stein et al., 2000)

LDLR-/- SCID mice

efficient, chol crystals, <4mo

Adenovirus

LDLR WHHL efficient, chol

crystals, <3wk

(Cichon et al., 2004)

gutless Ad VLDLR (PEPCK)

LDLR-/- mice significant, > 6mo

(Oka et al., 2001)

AAV-2 VLDLR LDLR-/- mice - 40 % chol > 7mo

(Chen et al., 2000)

AAV-7,AAV-8 LDLR LDLR-/- mice significant, ≥ 20wk

(Lebherz et al., 2004)

IN VIVO

retrovirus LDLR WHHL - 35 % chol > 1y

(Pakkanen et al., 1999b)

61

Gene transfer of LDLR locus The most recent development in FH gene therapy utilized a high-capacity HSV based amplicon vector for gene transfer of a complete 135kb LDLR genomic locus containing all 18 exons, introns and the native promoter (Wade-Martins et al., 2003). Efficient expression was detected in human and rodent cells in vitro for over three months; and the infectious LDLR locus retained the classical expression regulation by sterol levels in human cells. Regulation of LDLR expression at physiologically relevant levels may prove essential in FH gene therapy since high levels of unregulated LDLR expression may be toxic to cells. Indeed, it has been shown that high, unregulated levels of LDLR expression lead to a massive buildup of extracellular lipids and a formation of cytotoxic cholesterol-derived precipitates and crystals (Cichon et al., 2004).

62

3. AIMS OF THE STUDY

This study was implemented to analyze and improve the efficacy and safety of the currently available retroviral and lentiviral gene transfer vectors and technology for use in gene therapy of FH first in cell culture studies in vitro, and thereafter, in a rabbit and rat models in vivo. A further objective was to evaluate the potential of retroviral and lentiviral vectors for vascular ex vivo gene therapy in a rabbit model. More specifically, the following issues were addressed:

→ Can VSV-G pseudotyped MMLV-retrovirus and FIV-lentivirus based vectors be used for ex vivo gene transfer of rabbit vascular SMC? Can autologous SMCs be re-implanted back to the adventitial surface of rabbit carotid artery using a collar model? Can apo E be used as a therapeutic agent in the adventitial ex vivo gene therapy approach? Can the adventitial ex vivo gene therapy approach be exploited for FH gene therapy?

→ Can HIV-1 based third-generation lentiviral vectors under the transcriptional control

of a liver-specific promoter be used for in vivo gene therapy of FH without the need for liver resection?

→ Are traditional MMLV-retroviral and third generation HIV-1 based lentiviral vectors

safe for use in liver gene therapy?

→ Is the novel improved version of the reverse Tc-regulated TetON system feasible (functional, tightly regulated, dose-dependent, effective for several switch-on/off cycles) in conjunction with the third-generation HIV-1 based lentiviral vectors for in vitro and in vivo gene transfers?

63

4. MATERIALS AND METHODS

The materials and methods used in articles I-IV are summarized below and described in detail in the indicated publications. TABLE 6. Methods used in this study

Method Description Used in

DNA cloning Lentiviral vector design and construction II, IV Retroviral vector production and concentration I, III FIV vector production and concentration I

Production of viral vectors

HIV-1 vector production and concentration II, III, IV Retroviral vector titer determination: transduction I, III Lentiviral vector titer determination: transduction, ELISA (p24)

II, III, IV Analysis of recombinant viral vectors

Replication competent virus detection II, III LDL isolation and labeling (DiI; Na125I) I, II Lipoprotein

preparation Lipoprotein deficient serum (LPDS) preparation I, II Primary cell isolation and culture I Cell culture Transduction I, II, IV Immunocytochemistry I ELISA (apo E) I Fluorescence microscopy II Flow cytometry II 125I-LDL degradation assay II DiI-LDL binding and uptake assay II LacZ activity assay (x-gal staining, luminescence assay) I, IV

In vitro analysis

DNA, RNA isolation; PCR, RT-PCR I, II Anesthesia, sacrificing, tissue sample collection I, II, III, IV Periadventitial collar implantation I Portal vein surgery II, III Stereotactic intracranial injection IV

In vivo procedures

Blood sample collection I, II, III Clinical chemistry assays of plasma samples I, II, III ELISA (apo E) I Immunohistochemistry I, II, III, IV DNA, RNA isolation (Trizol / QiaAmp) I, II, III PCR, RT-PCR I, II, III, IV

Analytical methods

Veterinarian pathologist examination II, III mean ± SEM or SD I, II, III, IV

Statistical analysis ANOVA I, II, III

64

TABLE 7. Plasmids used in this study

Plasmids Description Source Used in

pCMV-G VSV-G envelope expression plasmid

T. Friedmann, UCSD, La Jolla, CA, USA

I, IV

pCF1∆env FIV vector packaging plasmid E. Poeschla & F. Wong-Staal, UCSD, La Jolla, CA, USA

I

pMDLg/pRRE Packaging plasmid encoding HIV-1 gag-pol

I. Verma, Salk Institute, La Jolla, CA, USA

II, III, IV

pRSV-Rev Packaging plasmid encoding HIV-1 rev

I. Verma, Salk Institute, La Jolla, CA, USA

II, III, IV

pMD.G VSV-G envelope expression plasmid

I. Verma, Salk Institute, La Jolla, CA, USA

II, III

pHIV-CS

SIN HIV-1 vector (U3 region of the 5’LTR replaced with CMV promoter; 133bp deletion in U3 region of the 3’LTR) used as a backbone for HIV-rtTA2S-M2 and HIV/TRE/LZ vectors

I. Verma, Salk Institute, La Jolla, CA, USA

IV

pUHrT61-1 hCMV – rtTA2S-M2 cDNA containing expression plasmid

H. Bujard, ZMBH, Heidelberg, Germany

IV

pTRE2 TRE expression plasmid Clontech, Palo Alto, CA, USA IV TABLE 8. Cell lines used in this study

Cell line Description Source Used in

SMC Primary rabbit vascular SMCs central ear artery of WHHL, NZW rabbits

I

293GP Human embryonal kidney epithelial cells expressing MMLV gag and pol genes

T. Friedmann, UCSD, La Jolla, CA, USA

I

293T Human embryonic renal epithelial cells expressing SV40 large T antigen

ATCC I, II, III, IV

NIH3T3 Mouse fibroblasts ATCC I HT1080 Human fibrosarcoma ATCC I WHHL Primary WHHL rabbit skin fibroblasts WHHL rabbit skin II

PA317 Mouse fibroblasts T. Friedmann, UCSD, La Jolla, CA, USA

III

209F Rat fibroblasts T. Friedmann, UCSD, La Jolla, CA, USA

III

CHO Chinese hamster ovary cells ATCC IV HepG2 Human hepatocellular carcinoma ATCC II SupT1 Human T-lymphoblasts ATCC II

EAhy926 Human endothelial hybridoma cells C-J. Edgell, UNC, Chapel Hill, NC, USA

IV

TABLE 9. Viral vectors used in this study

TABLE 10. Vector production protocols used in this study

Vector backbone

Vector (plasmid code)

Promoter Transgene Other

elements Source

Used in

retro-lacZ (pBAG) lacZ C. Cepko, Harvard Medical School, Boston, MA, USA I LTR-LDLR (pLDRNL) human LDLR T. Friedmann, UCSD, La Jolla, CA, USA MMLV

LTR-lacZ (pLZRNL)

MMLV-LTR

lacZ

RSV / neo

T. Friedmann, UCSD, La Jolla, CA, USA III

FIV-lacZ (pCTRZLb) lacZ E. Poeschla & F. Wong-Staal, UCSD, La Jolla, CA, USA FIV

FIV-apoE3 CMV

human apoE3 -

A. Miyanohara & T. Friedmann UCSD, La Jolla, CA, USA I

CMV-LDLR rabbit-LDLR CMV-GFP

CMV GFP

HIV-1 cppt; WPRE

LSP-LDLR rabbit-LDLR HIV-1 / SIN

LSP-GFP LSP

GFP HIV-1 cppt; WPRE; LE6

Hanna Kankkonen, University of Kuopio, Finland and /or R. Marr & I. Verma, Salk Institute, La Jolla, CA, USA

II, III

HIV-TRE-LZ TRE/CMV lacZ HIV-1 / SIN HIV-rtTA2S-M2 CMV rtTA2S-M2

- J. Koponen, University of Kuopio, Finland IV

Vector Envelope Packaging plasmids

Packaging cells

Production protocol Concentration method Titered on /

method Titer

TU/ml Used

in retro-lacZ VSV-G pCMV-G 293GP CaPO4 transfection 50000g, 4°C, 2h NIH3T3 / x-gal 1 × 108 I

LTR-LDLR LTR-lacZ

MMLV env - PA317 packaging cell PEG precipitation 209F / neo 1 × 105 III

FIV-lacZ FIV-apoE3 VSV-G

pCMV-G CF1∆env

293T CaPO4 transfection 50000g, 4°C, 2h HT1080 / x-gal 7.5 × 105 I

CMV-LDLR CMV-GFP LSP-LDLR LSP-GFP

VSV-G 3.5 × 109 II, III

HIV-rtTA2S-M2 HIV-TRE-LZ

VSV-G

pMD.G (or pCMV-G)

pMDLg/pRRE pRSV-Rev

293T

CaPO4 transfection

(or FUGENE 6 transfection)

68,000g, RT, 2h + 59000g, RT, 2h

(or 50000g, 4°C, 2h)

HIV p24 ELISA

and / or 293T / FCM

5 × 108 IV

65

TABLE 11. PCR primers used in this study

Vector – gene PC

R

Forward Primer Reverse Primer Fragm. Length

bp

Anneal Temp.

0C

Mg2+

Conc. mM

Cycles Used in

Retro – lacZ

1 5’ – GGATTGGTGGCGACGACT – 3´ 5’ – GGGGCGGGACTATGGTTG – 3´ 317 60 1.5 35 I

1 5’ – GCACAATGCCCACCACCACC – 3’ 5’ – GCGCAGGTAATCCCAAAAGC – 3’ 491 68 1.5 38 I FIV – ApoE3

2 5’ – GGAAGACTTAAGGCAGCGGC – 3’ 5’ – CCGCTTGCTCCACCTTGGCC – 3’ 293 68 1.5 38 I

1 5’ – CCAGTGGCCCAATGGCATCACC – 3’ 5’ – GCAATAGCATGATACAAAGGC – 3’ 1069 64.5 1.5 36 II LSP– rabbit LDLR 2 5’ – GGACAAAGTGTTCTGGACG – 3‘ 5’ – GCAGCGTATCCACATAGCG – 3’ 877 64.5 1.5 38 II

rabbit GAPDH

1 5’ – TGGTCACCAGGGCTGCTTTTAACT – 3’ 5’ – GCTAAGCAGTTGGTGGTGCAGGA – 3’ 424 60 3 35 III

LTR – human LDLR

1 5’ – TAAGGACACAGCACACAACCAC – 3’ 5’ – CCGTCTGTTGCCTTCCTAATAA – 3’ 563 56 2.5 35 III

LTR – control

1 5’ – CCTGAAAATGACCCTGTACC – 3’ 5’ – GGCACGAGAACTACAAACAC – 3’ 937 56 1.5 40 III

1 5’ – ACCCCGACCACATGAAGCAGC – 3’ 5’ – CGTTGGGGTCTTTGCTCAGGG – 3’ 417 60 1.5 35 III LSP – GFP

2 5’–ACGACGGCAACTACAAGACC – 3’ 5’ – ACCTTGATGCCGTTCTTCTG – 3’ 184 60 1.5 20 III

1 5’ – TGACCTCCATAGAAGACACC – 3’ 5’ – TGAGGGGACGACGACAGTAT – 3’ 463 58 4 40 IV HIV – TRE/LZ

2 5’ – GGGATCCTCTAGTCAGC – 3’ 5’ – GGGATCCTCTAGTCAGC – 3’ 329 58 4 40 IV

HIV-rtTA2S-M2

1 5’ – GAGCAAAGTCATAAACGGCGC – 3’ 5’ – CGCGATGTGAGAGGAGAGCA – 3’ 267 58 4 40 IV

66

67

TABLE 12. Animals used in this study

All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Kuopio, Kuopio, Finland. TABLE 13. Antibodies and their ligands used in this study

Primary antibody

Target Dilution Appli- cation

Source Used in

HHF-35 SMC 1:500 ICC, IHC EnzoDiagnostics, Farmingdale, NY, USA

I

anti-β-gal lacZ 1:100 IHC Sigma, St. Louis, MO, USA I

9-H8 Apo E 1:200 ELISA Cappel/ICN Pharmaceuticals, Aurora, OH, USA

I

RAM-11 Macro-phages

1:50 – 1:1000

IHC Dako, Hamburg, Germany I, II, III

MCA-805 T-cells 1:10 IHC Serotec Inc., Raleigh, NC,USA I, II, III

JL-8 GFP 1:100 ICC, IHC BD Biosciences, Palo Alto, CA, USA II MCA-812 B-cells 1:10 IHC Serotec Inc., Raleigh, NC,USA III

2AB02B rabbit IgG

1:100 IHC Serotec Inc., Raleigh, NC,USA III

Animal model # of animals Target tissue / delivery route Transgene Used in

8 lacZ-retro NZW rabbit

6 carotid artery / ex vivo

FIV-lacZ I

6 FIV-apo E3 WHHL rabbit

6 carotid artery / ex vivo

FIV-lacZ I

13 LSP-LDLR 10 LSP-GFP WHHL rabbit

3

liver / portal vein

CMV-GFP

II, III

7 LTR-LDLR WHHL rabbit

3 liver / portal vein

LTR-control III

WHHL rabbit 9 - - III

Wistar rat 20 brain / direct injection HIV/rtTA2S-M2 + HIV/TRE/LZ

IV

68

5. RESULTS AND DISCUSSION

Gene therapy provides an attractive alternative for the treatment of FH when compared to the more traditional treatment methods, which are time consuming and expensive (LDL apheresis) or involve a significant morbidity and mortality risk (liver transplantation). The choice of an optimal gene transfer vector expressing an appropriate transgene and necessary regulatory elements is crucial for safe and successful somatic gene transfer. Furthermore, understanding the pathophysiology of the disease is essential for accurate tissue targeting and for selecting the pathway to introduce the gene.

5.1. Article I

5.1.1. Adventitial ex vivo gene transfer resulted in efficient gene expression

Gene transfer into the arterial wall provides an alternative for the treatment and prevention of vascular diseases. However, development of safe and efficient gene transfer vectors together with targeted delivery to the vascular wall has presented substantial challenges over the last decade (Ylä-Herttuala and Martin, 2000). We developed a novel local adventitial cell grafting system for use in vascular medicine. In our model, genetically engineered vascular SMCs were transplanted onto the adventitial surface of the rabbit carotid arteries using a silicone collar or biodegradable collagen sheet. In comparison to the intra-arterial vascular SMC transplantation based on endothelial scraping of the carotid artery (Clowes, 1997), or direct injection of transduced SMCs into the adventitia (Beltrao-Braga et al., 2002), our model provides a less aggressive method.

Vascular SMCs were chosen for the delivery target because they are well-differentiated cells which are easy to manipulate in vitro and relatively susceptible to transduction. In our study SMCs were also easily obtained from the rabbit ear artery. Vascular SMCs could also be derived from veins. In addition, adventitial fibroblasts could serve as target cells. However, they are usually less well defined than vascular SMCs. Other cell types prospective for ex vivo vascular gene therapy include vascular precursor or stem cells and leukocytes.

In our study, the vascular SMCs transduced with high efficiency with MMLV-retroviral and FIV-lentiviral vectors, and grafted around the rabbit carotid artery using a silicone collar or a biodegradable collagen sheet. The transduced cells were shown to reside in the adventitia within the encapsulated space of the collar during the whole follow-up period (up to 47 weeks). In this study, we used a non-degradable collar for cell grafting but collars can also be made of biodegradable materials (Pakkanen et al., 2000). On the other hand, if necessary a non-degradable collar containing the transduced cells can later be removed surgically. Even though positioning of a silicone collar around the carotid artery has been shown to induce vascular injury and hindrance of transmural flow, resulting in intimal thickening (De Meyer et al., 1997), no substantial intimal thickening at the site of cell implantation or SMC migration into the intima was observed in our study at any time point.

69

5.1.2. Gene expression was transient

Owing to their integration into the host cell genome, retroviral and lentiviral proviruses are highly influenced by the host-cell gene-regulation machinery. Thus, retroviral vector constructs with a variety of strong viral or cellular promoters are vulnerable to silencing effects that interfere with the promoter activity.

In vivo silencing of retroviral transcription is a well-documented phenomenon in a wide variety of cell types. Moreover, lentiviral vectors have been shown to suffer from promoter silencing even though lentiviral vectors have shown more resistance to in vivo silencing than classical MLV-based vectors (Blömer et al., 1997; Kafri et al., 1997; Gerolami et al., 2000; Indraccolo et al., 2002). The mechanism of provirus silencing is controversial and considerable diversity in variables affecting the transgene expression has been reported. The decrease of gene expression in retroviral systems has been suggested to be due to methylation of cytosine residues in retroviral LTR, and to occur through a two-step mechanism whereby methylation of transcriptional elements is followed by repressive alterations in chromatin structure (Pannell and Ellis, 2001). Moreover, the lack of transcription factors and presence of some cytokines have been shown to inhibit gene expression from the CMV promoter (Gribaudo et al., 1993; Svoboda et al., 2000). The mechanisms of lentiviral gene expression inefficiency have been suggested to be integration site-dependent shutdown (Jordan et al., 2001), species-restricted lower transcriptional levels (Price et al., 2002) and vector specific mRNA instability (O'Rourke et al., 2002). Species-specific, post entry barriers have also been shown to affect lentiviral gene transfer efficiency (Hofmann et al., 1999).

In our study, the transgene expression from the transplanted SMCs transduced ex vivo with retrovirus or FIV vectors declined after a few months or weeks (respectively). The apparent difference in the transgene silencing behavior between the retroviral and lentiviral vectors in our study may be due to the divergent promoter sequences of the vector constructs. The retroviral vector under the transcriptional control of retroviral LTR may not be as prone to silencing as the CMV-driven FIV vector. Indeed, a widely used CMV promoter is particularly prone to expression shutdown in the in vivo environment. It has been shown to be active only in cell types naturally infected by CMV (Baskar et al., 1996). Since the removal of all viral transcriptional elements from the viral LTR has been shown to circumvent retroviral vector shutdown (Prasad Alur et al., 2002), one approach to overcome the LTR or CMV-originated silencing of gene expression could be to produce vectors with an internal physiological tissue-specific promoter.

5.1.3. Extrahepatic apo E expression resulted in elevated plasma cholesterol levels

Treatment of FH by LDLR or VLDLR gene therapy requires the delivery of these genes to the liver. However, secreted therapeutic proteins, like LDLR-transferrin (Parise et al., 1999) may have potential in treating FH when expressed from a non-hepatic source. Apo E derived from hepatocytes has been shown to be more effective than non-hepatocyte derived apo E in plasma cholesterol clearance in the presence of LDLR (Raffai et al., 2003). However, the significance of hepatic vs. extrahepatic expression of apo E3 in

70

cholesterol clearance from plasma in the absence of functional LDLR is unclear, and controversial results have been reported (Linton et al., 1998; Yu et al., 2000).

In our study human apo E3 expressed and secreted from an extrahepatic source, namely the genetically engineered SMCs implanted around the carotid artery of WHHL rabbits, resulted in impaired cholesterol homeostasis with elevated plasma cholesterol levels. This could be due to interference or blockade of LDL uptake, by large apo E rich remnant particles competing with LDL for binding to hepatic lipoprotein receptors, like LRP, and by non-lipoprotein bound apo E. Despite the increased plasma cholesterol levels, possible beneficial effects on atherosclerotic vascular disease cannot be excluded after vascular expression of apo E3. In fact, in an early study of Yamada et al. repeated intravenous injections of purified apo E to WHHL rabbits reduced atherosclerosis while plasma cholesterol levels remained unaffected (Yamada et al., 1992). Also physiological levels of macrophage apo E in the vessel wall have been shown to have anti-atherogenic properties in the absence of functional LDLR, and to affect later stages of plaque development (Fazio et al., 2002). However, a conflicting report demonstrated that elimination of macrophage-derived apo E from LDLR-/- mice reduced atherosclerosis by slowing hepatic VLDL production (Shi et al., 2004).

Functional LDLR has been demonstrated to be essential for efficient removal of extrahepatic (macrophage-derived) apo E-enriched lipoprotein remnants from the circulation, and consequently for normalization of plasma cholesterol levels and protection against atherosclerotic lesion development in apoE-/- mice (Van Eck et al., 2001). Hepatic apo E3 overexpression, on the other hand, has been shown to significantly inhibit the progression of atherosclerosis in LDLR-/- mice with little effect on plasma cholesterol levels (Thorngate et al., 2000; Tsukamoto et al., 2000b; Tangirala et al., 2001). Amelioration of hypercholesterolemia has been reported after moderate increase in liver-derived apo E3 levels in LDLR-/- mice (Osuga et al., 1998). Therefore, hepatic expression of exogenous apo E3 may be more likely to have therapeutic effects in the absence of functional LDLR.

Co-expression of LDLR and apo E has been shown to result in a substantial increase in large apo E-rich HDL particles; however, no additive effects of expression of the LDLR and apo E on cholesterol lowering or atherosclerosis reduction could be demonstrated (Kawashiri et al., 2001). Thus, apo E3 gene therapy may be beneficial only for FH patients with dysfunctional apo E.

5.2. Articles II and III

5.2.1. Liver-specific lentiviral vectors were functional in vitro

Third-generation SIN lentiviral vectors expressing rabbit LDLR or GFP under the transcriptional control of a synthetic liver-specific promoter (LSP) or a CMV promoter were produced to high titers and were shown to be free of replication-competent virus particles. Cell type specificity, transgene expression and LDLR functionality from the provirus were analyzed on HepG2 cells and WHHL rabbit skin fibroblasts transduced with LSP-LDLR, CMV-LDLR, LSP-GFP, and CMV-GFP. Vectors under the LSP promoter were shown to express transgenes only in the liver cells, whereas the CMV-driven lentiviral vectors transduced efficiently both liver cells and skin fibroblasts. The LDLR in the transduced cells was shown to be functional by 125I-LDL degradation and DiI-LDL uptake assays. RT-PCR

71

analysis confirmed the transgene expression in the CMV-LDLR and LSP-LDLR-transduced HepG2 cells and CMV-LDLR transduced WHHL fibroblasts 4 weeks after transduction.

5.2.2. Liver-directed gene transfer resulted in a long-term therapeutic effect and stable transgene expression in WHHL rabbits

Several research groups have demonstrated the therapeutic effects of LDLR gene transfer for hypercholesterolemia in animal models (see Chapter 2.3.7). Many of them showed short-term amelioration of hypercholesterolemia in WHHL rabbits and LDLR-/- mice after in vivo LDLR gene transfer using non-viral vectors and first generation Ad vectors (see Table 5). We were the first to show the therapeutic effect of lentivirus-mediated gene transfer of LDLR in a rabbit model. In our studies marked long-term reductions in plasma cholesterol levels were detected in WHHL rabbits treated with in vivo intraportal injections of LSP-LDLR and LTR-LDLR. Seventy percent (9/13) of the LSP-LDLR treated rabbits demonstrated a positive treatment effect with lowered plasma cholesterol levels (25 ± 8%) during the first 4 weeks (Article II). An additional 23% of the LSP-LDLR treated rabbits (3/13) responded to the treatment only after 4 weeks, which may be related to late integration and expression of the provirus. One of the 13 LSP-LDLR-treated rabbits failed to respond to the LDLR treatment. In all the LSP-LDLR treated rabbits 44 ± 8% and 34 ± 10% decreases were detected in the plasma cholesterol levels at the 1-year and 2-year time points, respectively (Fig. 10). At the end of the 3-year follow-up period the plasma cholesterol levels of LSP-LDLR and LTR-LDLR treated rabbits were 26.5% and 20% (respectively) below the age-adjusted mean values of our WHHL rabbit colony (Article III). The CMV-GFP and LSP-GFP treated control animals followed the steady cholesterol-declining pattern typically observed in our WHHL colony (population control) (Fig. 10).

FIG. 10 Changes in total plasma cholesterol levels in WHHL rabbits after retrovirus (LTR-LDLR, n=7) and lentivirus (LSP-LDLR, n=13; LSP-GFP, n=10) –mediated gene transfer to the liver. Data are expressed as percentage (mean ± SD) changes in comparison with the pretreatment values in each treated animal. Dashed line (--) indicates the values (+SD / -SD) of age-matched control population (n=38).

In order to achieve long-term amelioration of FH, sustained production of therapeutic

protein is fundamental. The ability of retroviral and lentiviral vectors to integrate into the host genome facilitate stable long-term expression of the transgene. In our study, the transgene expression was detected from liver for at least one year after the gene transfer.

72

WHHL rabbits that carry LDLR gene defect causing class 2/3 phenotype are a receptive animal model for FH gene therapy by LDLR gene transfer. However, patients with class 1 phenotype susceptible to immune reaction against transduced LDLR may benefit from overexpression of the other LDLR family receptors that bind apoB containing lipoproteins with high affinity. Also the anti-atherogenic apolipoproteins: apo A-I, apo A-IMilano, and apobec-1 may have therapeutic potential for gene therapy of hypercholesterolemia and subsequent atherosclerosis.

Prolonged correction of hyperlipidemia has also been demonstrated after gutless Ad vector and AAV-2 –mediated gene transfer of VLDLR to LDLR-/- mice (Chen et al., 2000; Oka et al., 2001). Even though the gutless Ad vector is capable of producing highly efficient gene transfer to the mouse liver with >95% hepatocytes transduced after tail vein injection of 3⋅1011 Ad particles, its extremely low rate of chromosomal integration eventually results in marked reduction in transgene expressing hepatocytes. The in vivo predominating episomal concatamer forms of AAV have been shown to convey the potential of long term transgene expression in quiescent and slowly dividing cells (Duan et al., 1998) thereby reducing the risks involved in chromosomal integration (Tenenbaum et al., 2003) and signifying the potential of AAV as gene delivery vector for FH gene therapy. Moreover, the novel AAV serotypes 7 and 8 have been shown to be potent vehicles for liver-targeted gene therapy (Gao et al., 2002). In the study of Lebherz and coworkers, vectors based on AAV-7 and AAV-8 were shown to be able to mediate up to 85% gene transfer efficiency and stable transduction of hepatocytes in vivo (Lebherz et al., 2004). Intraportal injection of 1·1012 genome copies of AA-7 and AAV-8 vectors expressing LDLR under a liver-specific promoter resulted in significant and sustained (at least 20 weeks) reductions in plasma cholesterol levels in LDLR-/- mice.

In our study, the transduction efficiency in the rabbit liver after intraportal injection of 1⋅109 TU of LSP-GFP vector was modest with fewer than 0.01% of the liver cells expressing the GFP transgene. In comparison, the transduction efficiency achieved after LTR-lacZ gene transfer (7.5⋅105 TU) to hepatectomized and thymidine-kinase – ganciclovir treated WHHL rabbit liver was at least two times higher (Pakkanen et al., 1999b). Partial hepatectomy may have potential in increasing the transduction efficiency of the liver-directed lentiviral vectors; however, cellular damage induces the immune response to antigens associated with injured cells (Shi et al., 2003) and may therefore reduce overall transduction efficiency. By optimizing the vector dose corresponding to animal species and target tissue size, gene transfer efficiency may be markedly enhanced without the need for extensive surgery. Indeed, an equivalent dose (109 TU) of third-generation lentiviral vectors injected into the tail vein or portal vein of mice, an animal 100 times smaller than the rabbit, has been reported to result in markedly higher transduction efficiency (an average of 5%) in hepatocytes (Pfeifer et al., 2001; Follenzi et al., 2002; Tsui et al., 2002; Van den Driessche et al., 2002). The functionality and purity of the virus preparation may also affect the saturation and toxicity levels of transduction efficiency as well immune response against transduced cells. Therefore, the toxicity of vector preparations related to the presence of viral proteins, or of compounds derived from the production system, should be minimized, or ideally eliminated.

Viral titer has been considered the main obstacle in efficient retroviral gene transfer (Bowles et al., 1996; Kitten et al., 1997; De Godoy et al., 1999). A model of an in vivo, in situ perfusion of regenerating rat livers after partial hepatectomy has demonstrated

73

limited extrahepatic diffusion and improved retroviral transduction efficiency with up to 34.4% hepatocytes transduced (De Godoy et al., 2000). With this model the limits of a single passage through the liver via portal vein injection, namely the limited viral volume and thus the limited number of infectious viral particles delivered into the liver, and the limited duration (20 min) of portal vein clamping, could be diminished. In addition, the unsolicited leakage to the systemic circulation and possible biodistribution of the viral vector to other organs could be reduced.

5.2.3. Transgene expression was liver-specific

In addition to expressing the transgene on a long-term basis, an optimal gene transfer vector for the treatment of FH should be able to transfer genes specifically to the liver. Even though ex vivo gene therapy provides a means of specifically targeting isolated hepatocytes, direct in vivo gene therapy provides a less invasive method when compared to the in vitro transduction and subsequent transplantation of isolated and cultured hepatocytes. However, systemic delivery of the third generation lentiviruses containing ubiquitous promoters has been shown to result in transduction of and transgene expression from liver, spleen, and bone marrow in mice (Pfeifer et al., 2001; Tsui et al., 2002; Van den Driessche et al., 2002; Kootstra et al., 2003; Follenzi et al., 2004).

We demonstrated liver targeting by physical targeting of vector preparations through direct in vivo injection into the portal vein, and by transcriptional targeting. In vivo injection of the HIV-lentiviral vectors (LSP-LDLR, LSP-GFP) under the transcriptional control of a synthetic liver-specific ABP/TBG enhancer/promoter resulted in long-term liver-specific expression of the transgenes with no transgene expression in other tissues. However, in some animals, spleen, lung, heart, and muscle samples were positive for provirus DNA (1 – 15 months time points). In comparison, Follenzi and coworkers demonstrated in mice that gene transfer of a third-generation lentiviral vector containing a liver specific albumin promoter restricted the transgene expression to hepatocytes while spleen and bone marrow were also transduced (Follenzi et al., 2002).

The major advantage of the liver-specific promoters over the ubiquitous promoters is the lack of ectopic expression of the transgene in other than the target tissues, and the resulting prolonged transgene expression due to lower cellular and humoral immune responses in vivo (Follenzi et al., 2004). However, most of the liver-specific promoters lack the high transcriptional activity of the strong viral and cellular enhancers (Kramer et al., 2003). Constitutive highly active transgene expression, on the other hand, may not be imperative for gene therapy of FH. It has been suggested that non-physiological overexpression of LDLR from adenoviral vectors driven by strong viral promoters (RSV, CMV) induces an imbalance between the LDL uptake and metabolism rates leading to pathological accumulation of lipids and cholesterol in transduced cells in vitro and in vivo (Inoue et al., 1991; Heeren et al., 1999a; Cichon et al., 2004). Moreover, overexpression of LDLR in transgenic mice with human apo E4 has caused severe atherosclerosis with marked elevation of plasma cholesterol on a Western-type diet (Malloy et al., 2004). Therefore, a physiologically controlled expression element driving the transgene expression from the gene transfer vector may be vital for FH gene therapy.

74

5.2.4. Liver-directed in vivo gene therapy proved safe

5.2.4.1. Animal well-being and survival WHHL rabbits treated with liver-directed gene transfer of MMLV retroviral vectors (6.5 – 7.5×105 TU) or HIV-1 based liver-specific lentiviral vectors (1×109 TU) tolerated the gene transfer procedure well and recovered from the operations without any problems, however three animals were lost due to surgery-related technical complications within 4 weeks of the gene transfer. All of the retrovirus-treated rabbits that were not sacrificed according to the study protocol (n=10) (Pakkanen et al., 1999b), and all the LSP-LDLR lentivirus-treated rabbits that were not sacrificed according to the study protocol, survived over two years (n=5) after the gene transfer. Meanwhile, 42% of the non-treated control rabbits died of natural causes (atherosclerotic stroke, n=1; intestinal fur ball blockade, n=2) before the age of 2 years. Two LSP-GFP treated rabbits died of atherosclerotic stroke before the 2 year time point (age 20.2 and 26.7 months), and one CMV-GFP treated rabbit died of acute necrotic colitis at the 30 months time point (age 35.8 months). One LSP-LDLR treated rabbit died of a parasitic fever (caused by Encephalitozoon cuniculi) at 26 months (age 30.4 months). The number of sacrificed animals by age, their cause of death and pathological findings are listed in Table 14.

5.2.4.2. Liver function and histology after gene transfer In the follow-up of clinical chemistry parameters (CRP, ASAT, ALAT, AFOS), no permanent changes were detected during the three-year follow up of WHHL rabbits treated with MMLV-retroviral or lentiviral gene transfers, while normal liver function was observed with no sign of infection or inflammatory changes. Liver biopsy operation was shown to elevate the plasma ASAT and ALAT levels which returned to baseline levels within a week. No signs of inflammatory responses were detected in liver biopsy samples taken 2–4 weeks after the gene transfer as judged by general histology and immunostainings for macrophages and T cells. Veterinarian pathological examination revealed modest to frequent periportal lymphocyte infiltration and centrilobular vacuolization of the liver tissue in most of the rabbits in all the groups in this study, including the non-treated control group. No signs of inflammatory responses were detected from postmortem liver samples as judged by immunostainings for macrophages and T-cells.

5.2.4.3. Pathology, SAE Veterinarian pathologist examination of the euthanized rabbits revealed symptoms related mainly to atherosclerosis. In all the groups in this study the heart contained scarred areas, some rabbits had atheroma plaques in coronary and pulmonary arteries and in most rabbits in all the groups the aorta was severely atherosclerotic with mineralization. Few rabbits had cholesterol accumulation or cholesterol clefts in heart valves, kidney medulla, and choroids plexus. In one rabbit cholesterol accumulation was found also in eyes (Fig. 11). One LTR-LDLR treated rabbit (age 33 months) showed decreased activity of testis (Fig. 11) and a few MMLV-retrovirus or lentivirus treated rabbits (age 30 – 41 months) showed uterine cystic hyperplasia or endometritis. Four rabbits were diagnosed with a neoplasm (Table 14). Of the other sacrificed, non-symptomatic animals, veterinarian pathologist examination revealed no obvious gene-transfer-related pathological findings.

75

TABLE 14. Number and age of WHHL rabbits sacrificed in the liver-directed gene transfer studies, cause of death and SAE of individual animals

Cause of death: A) Atherosclerosis; C) Surgery related complication; S) Sacrificed according to study protocol; ND) Not determined; Encephalitis; Necrotic colitis; Intestinal blockade. List of pathological findings: Lowered activity of testis; Uterine adenocarcinoma; Lymphoma; Nephroblastoma; Trichoepithelioma; Eyes filled with cholesterol.

FIG. 11 Pathological findings of WHHL rabbits 14 – 27 months after retrovirus and lentivirus –mediated gene transfer to the liver. (A) Lowered activity of testis. Note atrophic seminiferous tubules. Lowered activity [L], normal activity [N] (LTR-LDLR rabbit, age 33 months); (B) Ocular accumulation of cholesterol crystals and lipophages accompanied by chronic inflammatory reaction and multinucleated cells. Lens [L], vitreaous body [VB] (LSP-GFP rabbit, age 26.7 months).

Animals sacrificed / died at age (months) Virus Vector Rabbits

0-11 12-23 24-35 36-47 48-60

LTR-LDLR

7 0 0 1S

Lowered activity of testis

2S 1S

1ND

1S

1S Uterine adenocarcinoma

MMLV retro

LTR-control

3 0 0 0 2S 1Lymphoma

LSP-LDLR

13 2C

4S 2S

1Encephalitis

1S

3S 0

LSP-GFP

10 1C

5S

1A; Nephro-blastoma

2S 1A; chol. eyes 0 0

HIV-1 lenti

CMV-GFP

3 0 1S 1S 1 Necrotic

colitis 0

none none 9 0 2S

1 Intestinal block

1A;Tricho-epithelioma

1 Intestinal block

1A

3S 0

76

5.2.4.4. Biodistribution

5.2.4.5. Provirus integration and possibility of insertional mutagenesis Although retroviral and lentiviral vectors facilitate long-term transgene expression in vitro and in vivo, the chromatin milieu at the semi-random proviral integration sites (Bushman, 2002; Bushman, 2003) modulates all aspects of transgene expression, including the length of expression and expression level (Jordan et al., 2001). While MLV-retroviral vectors have been shown to prefer integration near the start of transcriptional units (Wu et al., 2003), HIV-1 targets active genes (Schröder et al., 2002). These distinct integration schemes of MLV-retroviruses and HIV-1-lentiviruses may result in different biosafety risk profiles of these vectors.

Insertion of a vector into a gene required for cell viability, especially if the cell contains only one functional copy of the gene, could lead to cell death. Viral-mediated gene integration can also result in significant changes in genome-wide methylation (Muller et al., 2001), which could result in epigenetic gene silencing and tumorigenesis (Baylin et al., 2001). Furthermore, the potential for abnormal regulation of cell growth resulting from retroviral, or lentiviral vector insertion into the host genome and the subsequent development of malignancy poses a major concern.

Replication-defective retrovirus –induced insertional mutagenesis has generally been assumed to be extremely rare. However, it has been reported in mice after ex vivo gene transfer of a marker gene to bone marrow (Li et al., 2002) and in two of eleven children treated with retroviral ex vivo gene transfer of γc gene to autologous hematopoietic stem cells (Hacein-Bey-Abina et al., 2003b). In the two children, retroviral integration in proximity to the LMO2 proto-oncogene promoter led to high-level of LMO2 expression and development of T-cell lymphoproliferation and leukemia. The LMO2 targeting was hypothesized to be due to a physical hotspot at the LMO2 locus or to growth advantage of the activated LMO2 mutants. Also the transgene, γc gene, has been suggested to act as a synergistic factor in driving the proliferation of a rare cell with the LMO2 targeted integration, and to induce leukemia (Baum et al., 2004; Dave et al., 2004).

In our long-term study of MMLV-retroviral and HIV-1 lentiviral gene transfer to the liver of WHHL rabbits four of 33 rabbits were diagnosed with neoplasms, of which three were malignant (Article III). Even though the overall frequency (12%) is rather high compared to the average frequency (2.6%) of neoplasms found in rabbits (Weisbroth, 1994) all the neoplasm forms found from in the rabbits in our study groups have been previously described in rabbits (Greene, 1959; Ingals et al., 1964; Altman et al., 1978; Weisbroth, 1994; Shibuya et al., 1999; Gomez et al., 2002). Especially uterine adenocarcinoma, found in a 4.5 year old doe in the LTR-LDLR study group, has been observed in over 60% of female rabbits over four years of age. The only neoplasm found positive for provirus DNA was the nephroblastoma isolated from an 11.5 month old male rabbit 6.5 months after the LSP-GFP mediated gene transfer. In addition to the nephroblastoma, liver, spleen and lung samples of the same rabbit were positive for provirus DNA. The relationship of the provirus to the development of the nephroblastoma currently remains unknown. However, a number of chromosomal loci involved in the development of human nephroblastoma have been identified (Dome and Coppes, 2002). Thus, the possibility that insertional mutagenesis may have been involved in the initiation of the nephroblastoma malignancy cannot be excluded. Therefore, it will be of interest to determine the flanking

77

DNA regions and the integration site of the provirus within the clonal composition of the nephroblastoma sample.

5.3. Article IV

5.3.1. Dox-regulated HIV-1 vector system showed tight control of gene expression

We generated a novel tightly regulated Dox–dependent lentiviral vector system that was shown to transduce both dividing and non-dividing cells in vitro and in vivo. Co-transduction of HIV/TRE/LZ and HIV/rtTA2S-M2 to CHO and EAhy926 cell lines resulted in Dox–dependent induction in both cell lines as measured by β-galactosidase activity. Transgene expression was detected by RT-PCR from co-transduced CHO cells after Dox-induction but not from uninduced cells. Provirus DNA was present in both induced and uninduced cells as determined by genomic PCR. In vivo gene transfer of the Dox- regulated lentiviral vectors to rat brain resulted in efficient gene transfer with all animals positive for both HIV/rtTA2S-M2 and HIV/TRE/LZ proviruses ten days after the transduction as detected by PCR. RT-PCR analysis showed the expression of the reverse transactivator in every animal. No lacZ transgene expression was detected in animals that were not treated with Dox (n=3) whereas rats receiving Dox (1 mg for 4 days) were found positive for lacZ expression by RT-PCR and X-gal staining.

The regulation was dose-dependent with below detection levels of β-galactosidase activity when no Dox was present and with full induction with Dox concentration of 500ng/ml. This suggests that the level of the therapeutic protein could be finely adjusted with Dox concentrations administered orally. Exposing of co-transduced CHO cells to cycles of Dox on/off inductions demonstrated the potential of rapid on/off switching of the transgene in long-term cultures. All three Dox-inductions during 13 cell passages after the co-transduction resulted in increases in the β-galactosidase activity.

In this study, we used a two-vector system in which the transgene under the inducible promoter and the construct driving the transactivator expression were supplied in separate vectors. However, for clinical trials, a single vector encoding both regulator and inducible genes would be preferable and of great interest with respect to safety and dosage control issues. Indeed, a number of expression cassettes coexpressing the transgene, the transactivator (rtTA2S-M2) and/or the tTS in a single vector have been constructed and their functionality has been demonstrated in vitro and in vivo (Lamartina et al., 2002; Salucci et al., 2002; Lamartina et al., 2003; Mizuguchi et al., 2003; Chenuaud et al., 2004; Vogel et al., 2004). In these vectors, optimal inducibility and minimal background activity in the absence of the inducer were achieved when the promoters driving the expression of the transgene and the rtTA2S-M2 transactivator were positioned apart from each other, but oriented in the same direction, or alternatively, when they were separated by a non-coding spacer independent of the orientation of the transcriptional unit. Combining the rtTA2S-M2 with the tTS was shown to result in more stringent control than with either alone; however, the maximum activity of rtTA2S-M2 was slightly reduced by co-expressed, IRES-dependent tTS (Lamartina et al., 2003). The lower maximum activity of IRES-based constructs was suggested to be due to a higher level of expression of the activator from monocistronic than from bicistronic transcripts.

78

Incorporating a liver-specific promoter into the regulated lentiviral vector system may further improve the vector safety for FH gene therapy. A combination of tight regulation and liver-specificity has been reported in conjunction with gutless adenoviral vectors containing a mifepristone-inducible system (Wang et al., 2004) and in a Dox-dependent (tetON) plasmid system containing the trans-activator and transgene under liver specific promoters in a single plasmid vector (Zabala et al., 2004). The Dox-dependent basal and final protein levels were shown to depend on the strength of the promoter that directs the transcriptional activator as well as on the relative orientation of the two genes in the same plasmid vector.

5.4. Aspects of the future development of gene delivery strategies

In this study, we have demonstrated the value of the current gene transfer vectors for FH gene therapy; however, the construction of vector systems directed towards targeted and regulated expression of a carefully chosen therapeutic gene from a distinct target organ, with accurate choice of gene delivery approach, will improve the safety and efficacy of gene therapy applications. In addition, the potential risks of insertional mutagenesis and germ-line alteration as well as issues concerning the possibility of mosaic virus generation, the possibility of the rescue of integrated vectors by wild type helper viruses, the possibility of replication-competent virus formation, and the potential for reactivation of dormant endogenous viruses should be taken into account in the development of new gene delivery strategies. Ultimately the applicability of gene therapy depends on the balance of risk over against alternative treatments.

79

6. SUMMARY AND CONCLUSIONS

1. We established a new ex vivo gene transfer technique for potential use in long-term local or systemic gene therapy applications during vascular surgery. VSV-G pseudotyped MMLV-retroviruses were potent vehicles for stable gene transfer to autologous rabbit SMCs transplanted around the carotid artery of a rabbit model. Transgene expression from FIV vectors under transcriptional control of CMV promoter were silenced more rapidly in vivo than transgenes expressed from MMLV vectors driven by viral LTR. FIV-mediated adventitial ex vivo gene transfer of human apo E3 resulted in efficient, albeit transient, apo E secretion into rabbit plasma with subsequent elevation in plasma cholesterol levels demonstrating the importance of careful evaluation of transgene properties and of the delivery route when the aim is to treat hypercholesterolemia.

2. We demonstrated the potential value of the third-generation self-inactivating liver-specific lentiviral vectors in the treatment of FH using direct intraportal liver gene therapy without the need for liver resection. Liver-specific HIV-1 based lentiviral vector –mediated gene transfer of LDLR to the liver of WHHL rabbits resulted in stable transgene expression and decrease in plasma cholesterol levels up to three years after the gene transfer (end of study). Normal liver function and morphology were reported and no signs of major infection or inflammatory changes were detected.

3. We demonstrated the long-term safety of MMLV-retroviral and HIV-1 lentiviral vectors as vehicles for liver-directed in vivo gene transfer. We demonstrated prolonged lifespan of rabbits treated with LDLR encoding vectors. No obvious gene transfer related pathological findings were detected in the treated WHHL rabbits up to four years after the gene transfer. However, four of the 33 treated and control rabbits were found to show neoplasms, one of which was positive for provirus.

4. We constructed a novel Dox–regulated self inactivating HIV-1 lentiviral vector system and showed its functionality and applicability in vitro and in vivo. We demonstrated that the dose-dependent and repeatedly inducible vector system was capable of efficient expression and explicit regulation of the transgene in rat brain in vivo.

In conclusion, we developed a novel adventitial ex vivo gene transfer technique for potential use in gene therapy applications during vascular surgery. We demonstrated the value of HIV-1 lentiviral vectors, and also the standard MMLV-retroviral vectors, in the treatment of FH in WHHL rabbits. We constructed a novel regulated lentiviral vector system that has potential in improving the vector safety in FH gene therapy.

80

7. REFERENCES

Anonymous (2002) NIH Report. Assessment of adenoviral vector safety and toxicity: report of the National Institutes of Health Recombinant DNA Advisory Committee. Hum.Gene Ther 13: 3-13.

Aalto-Setälä K, Helve E, Kovanen PT, and Kontula K (1989) Finnish type of low density lipoprotein receptor gene mutation (FH-Helsinki) deletes exons encoding the carboxy-terminal part of the receptor and creates an internalization-defective phenotype. J.Clin.Invest 84: 499-505.

Abe A, Chen ST, Miyanohara A, and Friedmann T (1998) In vitro cell-free conversion of noninfectious moloney retrovirus particles to an infectious form by the addition of the vesicular stomatitis virus surrogate envelope G protein. J Virol 72: 6356-6361.

Abifadel M, Varret M, Rabes JP, Allard D et al. (2003) Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat.Genet. 34: 154-156.

Airenne KJ, Hiltunen MO, Turunen MP, Turunen AM, Laitinen OH, Kulomaa MS, and Ylä-Herttuala S (2000) Baculovirus-mediated periadventitial gene transfer to rabbit carotid artery. Gene Ther. 7: 1499-1504.

Aliev G and Burnstock G (1998) Watanabe rabbits with heritable hypercholesterolaemia: a model of atherosclerosis. Histol.Histopathol. 13: 797-817.

Altman NH, Demaray SY, and Lamborn PB, Jr. (1978) Trichoepithelioma in a rabbit. Vet.Pathol. 15: 671-672.

Amsellem S, Briffaut D, Carrie A, Rabes JP et al. (2002) Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterolemia. Hum.Genet. 111: 501-510.

Andersen MS, Sorensen CB, Bolund L, and Jensen TG (2002) Mechanisms underlying targeted gene correction using chimeric RNA/DNA and single-stranded DNA oligonucleotides. J.Mol.Med 80: 770-781.

Appleby CE, Kingston PA, David A, Gerdes CA, Umana P, Castro MG, Lowenstein PR, and Heagerty AM (2003) A novel combination of promoter and enhancers increases transgene expression in vascular smooth muscle cells in vitro and coronary arteries in vivo after adenovirus-mediated gene transfer. Gene Ther 10: 1616-1622.

Arangoa MA, Duzgunes N, and Tros d, I (2003) Increased receptor-mediated gene delivery to the liver by protamine-enhanced-asialofetuin-lipoplexes. Gene Ther 10: 5-14.

Armeanu S, Haessler I, Saller R, Engelmann MG, Heinemann F, Krausz E, Stange J, Mitzner S, Salmons B, Gunzburg WH, and Nikol S (2001) In vivo perivascular implantation of encapsulated packaging cells for prolonged retroviral gene transfer. J.Microencapsul. 18: 491-506.

Armentano D, Thompson AR, Darlington G, and Woo SL (1990) Expression of human factor IX in rabbit hepatocytes by retrovirus-mediated gene transfer: potential for gene therapy of hemophilia B. Proc.Natl.Acad.Sci.U.S.A 87: 6141-6145.

Athanasopoulos T, Owen JS, Hassall D, Dunckley MG, Drew J, Goodman J, Tagalakis AD, Riddell DR, and Dickson G (2000) Intramuscular injection of a plasmid vector expressing human apolipoprotein E limits progression of xanthoma and aortic atheroma in apoE-deficient mice. Hum.Mol.Genet. 9: 2545-2551.

Aurisicchio L, Bujard H, Hillen W, Cortese R, Ciliberto G, La Monica N, and Palombo F (2001) Regulated and prolonged expression of mIFN(alpha) in immunocompetent mice mediated by a helper-dependent adenovirus vector. Gene Ther 8: 1817-1825.

Austin MA, Hutter CM, Zimmern RL, and Humphries SE (2004) Genetic Causes of Monogenic Heterozygous Familial Hypercholesterolemia: A HuGE Prevalence Review. Am.J Epidemiol. 160: 407-420.

Avery OT, Macleod CM, and McCarty M (2000) Studies on the chemical nature of the substance inducing transformation of pneumococcal types: Induction of transformation by a desoxyribonucleic acid fraction isolated from Pneumococcus type III. Oswald Theodore Avery (1877-1955). Clin.Orthop. S3-S8.

81

Bachmann MH, Mathiason-Dubard C, Learn GH, Rodrigo AG, Sodora DL, Mazzetti P, Hoover EA, and Mullins JI (1997) Genetic diversity of feline immunodeficiency virus: dual infection, recombination, and distinct evolutionary rates among envelope sequence clades. J Virol 71: 4241-4253.

Bakowska JC, Di Maria MV, Camp SM, Wang Y, Allen PD, and Breakefield XO (2003) Targeted transgene integration into transgenic mouse fibroblasts carrying the full-length human AAVS1 locus mediated by HSV/AAV rep(+) hybrid amplicon vector. Gene Ther 10: 1691-1702.

Baron U and Bujard H (2000) Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances. Methods Enzymol. 327: 401-421.

Bartz SR, Rogel ME, and Emerman M (1996) Human immunodeficiency virus type 1 cell cycle control: Vpr is cytostatic and mediates G2 accumulation by a mechanism which differs from DNA damage checkpoint control. J.Virol. 70: 2324-2331.

Baskar JF, Smith PP, Nilaver G, Jupp RA, Hoffmann S, Peffer NJ, Tenney DJ, Colberg-Poley AM, Ghazal P, and Nelson JA (1996) The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell type-specific expression in transgenic mice. J.Virol. 70: 3207-3214.

Baum C, von Kalle C, Staal FJ, Li Z, Fehse B, Schmidt M, Weerkamp F, Karlsson S, Wagemaker G, and Williams DA (2004) Chance or necessity? Insertional mutagenesis in gene therapy and its consequences. Mol.Ther 9: 5-13.

Baylin SB, Esteller M, Rountree MR, Bachman KE, Schuebel K, and Herman JG (2001) Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum.Mol.Genet. 10: 687-692.

Beisiegel U, Weber W, Ihrke G, Herz J, and Stanley KK (1989) The LDL-receptor-related protein, LRP, is an apolipoprotein E-binding protein. Nature 341: 162-164.

Bellosta S, Mahley RW, Sanan DA, Murata J, Newland DL, Taylor JM, and Pitas RE (1995) Macrophage-specific expression of human apolipoprotein E reduces atherosclerosis in hypercholesterolemic apolipoprotein E-null mice. J Clin Invest 96: 2170-2179.

Beltrao-Braga PC, Koh IH, Silva MR, Gutierrez PS, and Han SW (2002) Vascular adventitia is a suitable compartment to transplant transduced vascular smooth muscle cells for ex vivo gene expression. Cell Transplant. 11: 583-592.

Berge KE (2003) Sitosterolemia: a gateway to new knowledge about cholesterol metabolism. Ann.Med 35: 502-511.

Berglund L, Wiklund O, Eggertsen G, Olofsson SO, Eriksson M, Linden T, Bondjers G, and Angelin B (1993) Apolipoprotein E phenotypes in familial hypercholesterolaemia: importance for expression of disease and response to therapy. J.Intern.Med 233: 173-178.

Bertolini S, Pisciotta L, Di Scala L, Langheim S et al. (2004) Genetic polymorphisms affecting the phenotypic expression of familial hypercholesterolemia. Atherosclerosis 174: 57-65.

Beyer WR, Westphal M, Ostertag W, and von Laer D (2002) Oncoretrovirus and lentivirus vectors pseudotyped with lymphocytic choriomeningitis virus glycoprotein: generation, concentration, and broad host range. J.Virol. 76: 1488-1495.

Bielicki JK and Oda MN (2002) Apolipoprotein A-I(Milano) and apolipoprotein A-I(Paris) exhibit an antioxidant activity distinct from that of wild-type apolipoprotein A-I. Biochemistry 41: 2089-2096.

Bishop RW (1992) Structure of the hamster low density lipoprotein receptor gene. J.Lipid Res. 33: 549-557. Blaese RM, Culver KW, Miller AD, Carter CS, Fleisher T, Clerici M, Shearer G, Chang L, Chiang Y,

Tolstoshev P, and . (1995) T lymphocyte-directed gene therapy for ADA- SCID: initial trial results after 4 years. Science 270: 475-480.

Bloom ME and Young NS (2001) Parvoviruses. In: Fields Virology. Knipe, D. M. and Howley, P. M. (eds.) Philadelphia, PA, USA: Lippincott Williams & Wilkins, Chapter 70. pp. 2361-2380.

Blömer U, Naldini L, Kafri T, Trono D, Verma IM, and Gage FH (1997) Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector. J Virol 71: 6641-6649.

Boerger AL, Snitkovsky S, and Young JA (1999) Retroviral vectors preloaded with a viral receptor-ligand bridge protein are targeted to specific cell types. Proc.Natl.Acad.Sci.U.S.A 96: 9867-9872.

Bosch A, McCray PB, Chang SMW, Ulich TR, Simonet WS, Jolly DJ, and Davidson BL (1996) Proliferation induced by keratinocyte growth factor enhances in vivo retroviral-mediated gene transfer to mouse hepatocytes. J Clin Invest 98: 2683-2687.

82

Boulikas T (1998) Status of gene therapy in 1997: molecular mechanisms, disease targets, and clinical applications. Gene Ther.Mol.Biol. 1: 1-172.

Bowles NE, Eisensmith RC, Mohuiddin R, Pyron M, and Woo SL (1996) A simple and efficient method for the concentration and purification of recombinant retrovirus for increased hepatocyte transduction in vivo. Hum Gene Ther 7: 1735-1742.

Brockstedt DG, Podsakoff GM, Fong L, Kurtzman G, Mueller-Ruchholtz W, and Engleman EG (1999) Induction of immunity to antigens expressed by recombinant adeno-associated virus depends on the route of administration. Clin.Immunol. 92: 67-75.

Brown MD, Schatzlein AG, and Uchegbu IF (2001) Gene delivery with synthetic (non viral) carriers. Int.J.Pharm. 229: 1-21.

Brown MS and Goldstein JL (1986) A receptor-mediated pathway for cholesterol homeostasis. Science 232: 34-47.

Bruckert E, von Eckardstein A, Funke H, Beucler I, Wiebusch H, Turpin G, and Assmann G (1997) The replacement of arginine by cysteine at residue 151 in apolipoprotein A-I produces a phenotype similar to that of apolipoprotein A-IMilano. Atherosclerosis 128: 121-128.

Budker V, Budker T, Zhang G, Subbotin V, Loomis A, and Wolff JA (2000) Hypothesis: naked plasmid DNA is taken up by cells in vivo by a receptor-mediated process. J.Gene Med 2: 76-88.

Bukovsky AA, Song JP, and Naldini L (1999) Interaction of human immunodeficiency virus-derived vectors with wild-type virus in transduced cells. J Virol 73: 7087-7092.

Bukrinsky MI, Sharova N, Dempsey MP, Stanwick TL, Bukrinskaya AG, Haggerty S, and Stevenson M (1992) Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc.Natl.Acad.Sci.U.S.A 89: 6580-6584.

Buning H, Ried MU, Perabo L, Gerner FM, Huttner NA, Enssle J, and Hallek M (2003) Receptor targeting of adeno-associated virus vectors. Gene Ther 10: 1142-1151.

Burns JC, Friedmann T, Driever W, Burrascano M, and Yee JK (1993) Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc.Natl.Acad.Sci.U.S.A. 90: 8033-8037.

Bushman FD (2002) Integration site selection by lentiviruses: biology and possible control. Curr.Top.Microbiol.Immunol. 261: 165-177.

Bushman FD (2003) Targeting survival: integration site selection by retroviruses and LTR-retrotransposons. Cell 115: 135-138.

Cai SR, Kennedy SC, Bowling WM, Flye MW, and Ponder KP (1998) Therapeutic levels of human protein C in rats after retroviral vector-mediated hepatic gene therapy. J Clin Invest 101: 2831-2841.

Calabresi L, Vecchio G, Longhi R, Gianazza E, Palm G, Wadensten H, Hammarstrom A, Olsson A, Karlstrom A, Sejlitz T, and . (1994) Molecular characterization of native and recombinant apolipoprotein A-IMilano dimer. The introduction of an interchain disulfide bridge remarkably alters the physicochemical properties of apolipoprotein A-I. J Biol.Chem. 269: 32168-32174.

Carmena R, Lussiercacan S, Roy M, Minnich A, Lingenhel A, Kronenberg F, and Davignon J (1996) Lp(a) levels and atherosclerotic vascular disease in a sample of patients with familial hypercholesterolemia sharing the same gene defect. Arterioscler Thromb Vasc Biol 16: 129-136.

Cavazzana-Calvo M, Hacein-Bey S, de Saint B, Gross F et al. (2000) Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288: 669-672.

Chaer RA, Billeh R, and Massad MG (2004) Genetics and gene manipulation therapy of premature coronary artery disease. Cardiology 101: 122-130.

Chang TY, Chang CC, and Cheng D (1997) Acyl-coenzyme A:cholesterol acyltransferase. Annu.Rev.Biochem. 66: 613-638.

Chen Q, Reis SE, Kammerer CM, McNamara DM, Holubkov R, Sharaf BL, Sopko G, Pauly DF, Bairey Merz CN, and Kamboh MI (2003) APOE polymorphism and angiographic coronary artery disease severity in the Women's Ischemia Syndrome Evaluation (WISE) study. Atherosclerosis 169: 159-167.

Chen SJ, Rader DJ, Tazelaar J, Kawashiri M, Gao G, and Wilson JM (2000) Prolonged correction of hyperlipidemia in mice with familial hypercholesterolemia using an adeno-associated viral vector expressing very-low-density lipoprotein receptor. Mol.Ther. 2: 256-261.

83

Cheng SH and Smith AE (2003) Gene therapy progress and prospects: gene therapy of lysosomal storage disorders. Gene Ther 10: 1275-1281.

Chenuaud P, Larcher T, Rabinowitz JE, Provost N, Joussemet B, Bujard H, Samulski RJ, Favre D, and Moullier P (2004) Optimal design of a single recombinant adeno-associated virus derived from serotypes 1 and 2 to achieve more tightly regulated transgene expression from nonhuman primate muscle. Mol.Ther 9: 410-418.

Chiesa G, Monteggia E, Marchesi M, Lorenzon P et al. (2002) Recombinant apolipoprotein A-I(Milano) infusion into rabbit carotid artery rapidly removes lipid from fatty streaks. Circ.Res. 90: 974-980.

Cho YW, Kim JD, and Park K (2003) Polycation gene delivery systems: escape from endosomes to cytosol. J.Pharm.Pharmacol. 55: 721-734.

Chowdhury JR, Grossman M, Gupta S, Chowdhury NR, Baker Jr JR, and Wilson JM (1991) Long-term improvement of hypercholesterolemia after ex vivo gene therapy in LDLR-deficient rabbits. Science 254: 1802-1805.

Cichon G, Willnow T, Herwig S, Uckert W, Loser P, Schmidt HH, Benhidjeb T, Schlag PM, Schnieders F, Niedzielska D, and Heeren J (2004) Non-physiological overexpression of the low density lipoprotein receptor (LDLr) gene in the liver induces pathological intracellular lipid and cholesterol storage. J.Gene Med 6: 166-175.

Cioffi L, Sturtz FG, Wittmer S, Barut B et al. (1999) A novel endothelial cell-based gene therapy platform for the in vivo delivery of apolipoprotein E. Gene Ther 6: 1153-1159.

Civeira F (2004) Guidelines for the diagnosis and management of heterozygous familial hypercholesterolemia. Atherosclerosis 173: 55-68.

Clowes AW (1997) Vascular gene transfer using smooth muscle cells. Ann.N.Y.Acad.Sci. 811: 293-297. Clowes MM, Lynch CM, Miller AD, Miller DG, Osborne WR, and Clowes AW (1994) Long-term biological

response of injured rat carotid artery seeded with smooth muscle cells expressing retrovirally introduced human genes. J.Clin.Invest 93: 644-651.

Connelly S (1999) Adenoviral vectors for liver-directed gene therapy. Curr.Opin.Mol.Ther 1: 565-572. Cordelier P and Strayer DS (2003) Conditional expression of alpha1-antitrypsin delivered by recombinant

SV40 vectors protects lymphocytes against HIV. Gene Ther 10: 2153-2156. Cosset FL, Takeuchi Y, Battini JL, Weiss RA, and Collins MK (1995) High-titer packaging cells producing

recombinant retroviruses resistant to human serum. J Virol 69: 7430-7436. Coutelle C and Rodeck C (2002) On the scientific and ethical issues of fetal somatic gene therapy. Gene

Ther. 9: 670-673. Curran MA, Kaiser SM, Achacoso PL, and Nolan GP (2000) Efficient transduction of nondividing cells by

optimized feline immunodeficiency virus vectors. Mol.Ther. 1: 31-38. D'Costa J, Brown H, Kundra P, Davis-Warren A, and Arya S (2001) Human immunodeficiency virus type 2

lentiviral vectors: packaging signal and splice donor in expression and encapsidation. J.Gen.Virol. 82: 425-434.

Das HK, McPherson J, Bruns GA, Karathanasis SK, and Breslow JL (1985) Isolation, characterization, and mapping to chromosome 19 of the human apolipoprotein E gene. J.Biol.Chem. 260: 6240-6247.

Daugherty A (2002) Mouse models of atherosclerosis. Am.J.Med.Sci. 323: 3-10. Dave UP, Jenkins NA, and Copeland NG (2004) Gene therapy insertional mutagenesis insights. Science

303: 333- Davignon J, Gregg RE, and Sing CF (1988) Apolipoprotein E polymorphism and atherosclerosis.

Arteriosclerosis 8: 1-21. De Godoy JL, Malafosse R, Fabre M, Mehtali M, Houssin D, and Soubrane O (1999) In vivo hepatocyte

retrovirus-mediated gene transfer through the rat biliary tract. Hum Gene Ther 10: 249-257. De Godoy JL, Malafosse R, Fabre M, Mitchell C, Mehtali M, Houssin D, and Soubrane O (2000) A

preclinical model of hepatocyte gene transfer: the in vivo, in situ perfused rat liver. Gene Ther 7: 1816-1823.

De Meyer GR, Van Put DJ, Kockx MM, Van Schil P, Bosmans R, Bult H, Buyssens N, Vanmaele R, and Herman AG (1997) Possible mechanisms of collar-induced intimal thickening. Arterioscler.Thromb.Vasc.Biol. 17: 1924-1930.

84

Debyser Z (2003) Biosafety of lentiviral vectors. Curr.Gene Ther 3: 517-525. Defesche JC (2004) Low-density lipoprotein receptor--its structure, function, and mutations. Semin.Vasc.Med

4: 5-11. Delelis O, Saib A, and Sonigo P (2003) Biphasic DNA synthesis in spumaviruses. J Virol. 77: 8141-8146. Ding E, Hu H, Hodges BL, Migone F, Serra D, Xu F, Chen YT, and Amalfitano A (2002) Efficacy of gene

therapy for a prototypical lysosomal storage disease (GSD-II) is critically dependent on vector dose, transgene promoter, and the tissues targeted for vector transduction. Mol.Ther 5: 436-446.

Dishart KL, Denby L, George SJ, Nicklin SA, Yendluri S, Tuerk MJ, Kelley MP, Donahue BA, Newby AC, Harding T, and Baker AH (2003) Third-generation lentivirus vectors efficiently transduce and phenotypically modify vascular cells: implications for gene therapy. J.Mol.Cell Cardiol. 35: 739-748.

Dome JS and Coppes MJ (2002) Recent advances in Wilms tumor genetics. Curr.Opin.Pediatr. 14: 5-11. Dong JY, Fan PD, and Frizzell RA (1996) Quantitative analysis of the packaging capacity of recombinant

adeno-associated virus. Hum Gene Ther 7: 2101-2112. Duan D, Sharma P, Dudus L, Zhang Y et al. (1999) Formation of adeno-associated virus circular genomes is

differentially regulated by adenovirus E4 ORF6 and E2a gene expression. J Virol 73: 161-169. Duan D, Sharma P, Yang J, Yue Y, Dudus L, Zhang Y, Fisher KJ, and Engelhardt JF (1998) Circular

intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue. J.Virol. 72: 8568-8577.

Duan D, Yue Y, Yan Z, and Engelhardt JF (2000) A new dual-vector approach to enhance recombinant adeno-associated virus-mediated gene expression through intermolecular cis activation. Nat.Med 6: 595-598.

Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, and Naldini L (1998) A third-generation lentivirus vector with a conditional packaging system. J.Virol. 72: 8463-8471.

Duverger N, Kruth H, Emmanuel F, Caillaud JM, Viglietta C, Castro G, Tailleux A, Fievet C, Fruchart JC, Houdebine LM, and Denefle P (1996) Inhibition of atherosclerosis development in cholesterol-fed human apolipoprotein A-I-transgenic rabbits. Circulation 94: 713-717.

Eastman SJ, Baskin KM, Hodges BL, Chu Q, Gates A, Dreusicke R, Anderson S, and Scheule RK (2002) Development of catheter-based procedures for transducing the isolated rabbit liver with plasmid DNA. Hum.Gene Ther 13: 2065-2077.

Ehrhardt A, Xu H, Dillow AM, Bellinger DA, Nichols TC, and Kay MA (2003) A gene-deleted adenoviral vector results in phenotypic correction of canine hemophilia B without liver toxicity or thrombocytopenia. Blood 102: 2403-2411.

Eichner JE, Dunn ST, Perveen G, Thompson DM, Stewart KE, and Stroehla BC (2002) Apolipoprotein E polymorphism and cardiovascular disease: a HuGE review. Am.J.Epidemiol. 155: 487-495.

Emi N, Friedmann T, and Yee JK (1991) Pseudotype formation of murine leukemia virus with the G protein of vesicular stomatitis virus. J.Virol. 65: 1202-1207.

Eriksson M, Carlson LA, Miettinen TA, and Angelin B (1999) Stimulation of fecal steroid excretion after infusion of recombinant proapolipoprotein A-I. Potential reverse cholesterol transport in humans. Circulation 100: 594-598.

Eto M, Watanabe K, Chonan N, and Ishii K (1988) Familial hypercholesterolemia and apolipoprotein E4. Atherosclerosis 72: 123-128.

Eton D, Yu H, Wang Y, Raines J, Striker G, and Livingstone A (2004) Endograft technology: a delivery vehicle for intravascular gene therapy. J.Vasc.Surg. 39: 1066-1073.

Fan J, Ji ZS, Huang Y, de Silva H, Sanan D, Mahley RW, Innerarity TL, and Taylor JM (1998) Increased expression of apolipoprotein E in transgenic rabbits results in reduced levels of very low density lipoproteins and an accumulation of low density lipoproteins in plasma. J.Clin.Invest 101: 2151-2164.

Fazio S, Babaev VR, Burleigh ME, Major AS, Hasty AH, and Linton MF (2002) Physiological expression of macrophage apoE in the artery wall reduces atherosclerosis in severely hyperlipidemic mice. J.Lipid Res. 43: 1602-1609.

Fazio S, Babaev VR, Murray AB, Hasty AH, Carter KJ, Gleaves LA, Atkinson JB, and Linton MF (1997) Increased atherosclerosis in mice reconstituted with apolipoprotein E null macrophages. Proc.Natl.Acad.Sci.U.S.A 94: 4647-4652.

85

Feldman LJ, Pastore CJ, Aubailly N, Kearney M, Chen D, Perricaudet M, Steg PG, and Isner JM (1997) Improved efficiency of arterial gene transfer by use of poloxamer 407 as a vehicle for adenoviral vectors. Gene Ther. 4: 189-198.

Ferrieres J, Lambert J, Lussier-Cacan S, and Davignon J (1995) Coronary artery disease in heterozygous familial hypercholesterolemia patients with the same LDL receptor gene mutation. Circulation 92: 290-295.

Ferry N, Duplessis O, Houssin D, Danos O, and Heard JM (1991) Retroviral-mediated gene transfer into hepatocytes in vivo. Proc.Natl.Acad.Sci.U.S.A. 88: 8377-8381.

Fielding PE and Firlding CJ (2002) Dynamics of the Lipoprotein Transport in the Human Circulatory System. In: Biochemistry of Lipids, Lipoproteins and Membranes. Vance, D. E. and Vance, J. E. (eds.) Paris: Elsevier, Chapter 20. pp. 527-552.

Follenzi A, Ailles LE, Bakovic S, Geuna M, and Naldini L (2000) Gene transduction by lentiviral vectors is limited by nuclear translocation of the genome and is rescued by incorporation of cis-acting sequences for the HIV-1 pol gene. Nat Genet 25: 217-222.

Follenzi A, Battaglia M, Lombardo A, Annoni A, Roncarolo MG, and Naldini L (2004) Targeting lentiviral vector expression to hepatocytes limits transgene-specific immune response and establishes long-term expression of human antihemophilic factor IX in mice. Blood 103: 3700-3709.

Follenzi A, Sabatino G, Lombardo A, Boccaccio C, and Naldini L (2002) Efficient gene delivery and targeted expression to hepatocytes in vivo by improved lentiviral vectors. Hum.Gene Ther. 13: 243-260.

Franceschini G, Sirtori CR, Capurso A, Weisgraber KH, and Mahley RW (1980) A-IMilano apoprotein. Decreased high density lipoprotein cholesterol levels with significant lipoprotein modifications and without clinical atherosclerosis in an Italian family. J Clin.Invest 66: 892-900.

Francke U, Brown MS, and Goldstein JL (1984) Assignment of the human gene for the low density lipoprotein receptor to chromosome 19: synteny of a receptor, a ligand, and a genetic disease. Proc.Natl.Acad.Sci.U.S.A 81: 2826-2830.

Fraser R, Dobbs BR, and Rogers GW (1995) Lipoproteins and the liver sieve: the role of the fenestrated sinusoidal endothelium in lipoprotein metabolism, atherosclerosis, and cirrhosis. Hepatology 21: 863-874.

Freed EO and Martin MA (2001) HIVs and Their Replication. In: Fields Virology. Knipe, D. M. and Howley, P. M. (eds.) Philadelphia, PA, USA: Lippincott Williams & Wilkins, Chapter 59. pp. 1971-2041.

Freundlieb S, Schirra-Mueller C, and Bujard H (1999) A Tetracycline Controlled Activation/Repression System with Increased Potential for Gene Transfer into Mammalian Cells. J.Gene Med. 1: 4-12.

Fukuma T, Wu GY, and Wu CH (2000) Liver-selective nucleic acid targeting using the asialoglycoprotein receptor. Gene Therapy and Regulation 1: 79-93.

Gafvels ME, Caird M, Britt D, Jackson CL, Patterson D, and Strauss JF, III (1993) Cloning of a cDNA encoding a putative human very low density lipoprotein/apolipoprotein E receptor and assignment of the gene to chromosome 9pter-p23. Somat.Cell Mol.Genet. 19: 557-569.

Gallay P, Stitt V, Mundy C, Oettinger M, and Trono D (1996) Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import. J.Virol. 70: 1027-1032.

Gao GP, Alvira MR, Wang L, Calcedo R, Johnston J, and Wilson JM (2002) Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc.Natl.Acad.Sci.U.S.A 99: 11854-11859.

Geary RL, Clowes AW, Lau S, Vergel S, Dale DC, and Osborne WR (1994) Gene transfer in baboons using prosthetic vascular grafts seeded with retrovirally transduced smooth muscle cells: a model for local and systemic gene therapy. Hum.Gene Ther 5: 1211-1216.

Gehrke S, Jerome V, and Muller R (2003) Chimeric transcriptional control units for improved liver-specific transgene expression. Gene 322: 137-143.

Gerolami R, Uch R, Jordier F, Chapel S, Bagnis C, Brechot C, and Mannoni P (2000) Gene transfer to hepatocellular carcinoma: transduction efficacy and transgene expression kinetics by using retroviral and lentiviral vectors. Cancer Gene Ther. 7: 1286-1292.

Gerritsen G, Kypreos KE, van der ZA, Teusink B, Zannis VI, Havekes LM, and van Dijk KW (2003) Hyperlipidemia in APOE2 transgenic mice is ameliorated by a truncated apoE variant lacking the C-terminal domain. J.Lipid Res. 44: 408-414.

86

Ghosh S, Parvez MK, Banerjee K, Sarin SK, and Hasnain SE (2002) Baculovirus as mammalian cell expression vector for gene therapy: an emerging strategy. Mol.Ther 6: 5-11.

Ghosh SS, Takahashi M, Thummala NR, Parashar B, Chowdhury NR, and Chowdhury JR (2000) Liver-directed gene therapy: promises, problems and prospects at the turn of the century. J.Hepatol. 32: 238-252.

Giannini C, Morosan S, Tralhao JG, Guidotti JE, Battaglia S, Mollier K, Hannoun L, Kremsdorf D, Gilgenkrantz H, and Charneau P (2003) A highly efficient, stable, and rapid approach for ex vivo human liver gene therapy via a FLAP lentiviral vector. Hepatology 38: 114-122.

Girod A, Ried M, Wobus C, Lahm H, Leike K, Kleinschmidt J, Deléage G, and Hallek M (1999) Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2. Nat Med 5: 1052-1056.

Goff SP (2001) Retroviridae: The Retroviruses and Their Replication. In: Fields Virology. Knipe, D. M. and Howley, P. M. (eds.) Philadelphia, PA, USA: Lippincott Williams & Wilkins, Chapter 57. pp. 1871-1940.

Goins WF, Sternberg LR, Croen KD, Krause PR, Hendricks RL, Fink DJ, Straus SE, Levine M, and Glorioso JC (1994) A novel latency-active promoter is contained within the herpes simplex virus type 1 UL flanking repeats. J.Virol. 68: 2239-2252.

Goins WF, Wolfe D, Krisky DM, Bai Q, Burton EA, Fink DJ, and Glorioso JC (2004) Delivery using herpes simplex virus: an overview. Methods Mol.Biol. 246: 257-299.

Goldstein JL and Brown MS (1974) Binding and degradation of low density lipoproteins by cultured human fibroblasts. Comparison of cells from a normal subject and from a patient with homozygous familial hypercholesterolemia. J.Biol.Chem. 249: 5153-5162.

Goldstein JL, Hobbs HH, and Brown MS (2001) Familial Hypercholesterolemia. In: The Metabolic and Molecular Bases of Inherited Disease, 8th Edition Online. Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. (eds.) New York: McGraw Hill, Chapter 120.

Goldstein JL, Hobbs HH, and Brown MS (2002) Familial Hypercholesterolemia. In: The Metabolic and Molecular Bases of Inherited Disease, 8th Edition Online. Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. (eds.) New York: McGraw Hill, Chapter 120.

Goldstein JL, Kita T, and Brown MS (1983) Defective lipoprotein receptors and atherosclerosis. Lessons from an animal counterpart of familial hypercholesterolemia. N.Engl.J Med 309: 288-296.

Gomez L, Gazquez A, Roncero V, Sanchez C, and Duran ME (2002) Lymphoma in a rabbit: histopathological and immunohistochemical findings. J.Small Anim Pract. 43: 224-226.

Goncalves MA, van dV, I, Knaan-Shanzer S, Valerio D, and de Vries AA (2004) Stable transduction of large DNA by high-capacity adeno-associated virus/adenovirus hybrid vectors. Virology 321: 287-296.

Gossen M and Bujard H (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc.Natl.Acad.Sci.U.S.A 89: 5547-5551.

Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, and Bujard H (1995) Transcriptional activation by tetracyclines in mammalian cells. Science 268: 1766-1769.

Gough PJ and Raines EW (2003) Gene therapy of apolipoprotein E-deficient mice using a novel macrophage-specific retroviral vector. Blood 101: 485-491.

Greene HS (1959) Adenocarcinoma of the uterine fundus in the rabbit. Ann.N.Y.Acad.Sci. 75: 535-542. Greene WC and Peterlin BM (2002) Charting HIV's remarkable voyage through the cell: Basic science as a

passport to future therapy. Nat.Med 8: 673-680. Greeve J, Altkemper I, Dieterich JH, Greten H, and Windler E (1993) Apolipoprotein B mRNA editing in 12

different mammalian species: hepatic expression is reflected in low concentrations of apoB-containing plasma lipoproteins. J.Lipid Res. 34: 1367-1383.

Greeve J, Jona VK, Chowdhury NR, Horwitz MS, and Chowdhury JR (1996) Hepatic gene transfer of the catalytic subunit of the apolipoprotein B mRNA editing enzyme results in a reduction of plasma LDL levels in normal and Watanabe Heritable Hyperlipidemic rabbits. J Lipid Res 37: 2001-2017.

Gribaudo G, Ravaglia S, Caliendo A, Cavallo R, Gariglio M, Martinotti MG, and Landolfo S (1993) Interferons inhibit onset of murine cytomegalovirus immediate-early gene transcription. Virology 197: 303-311.

87

Grimm D and Kay MA (2003) From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy. Curr.Gene Ther 3: 281-304.

Grimm D, Zhou S, Nakai H, Thomas CE et al. (2003) Preclinical in vivo evaluation of pseudotyped adeno-associated virus vectors for liver gene therapy. Blood 102: 2412-2419.

Groen AK, Oude Elferink RP, Verkade HJ, and Kuipers F (2004) The ins and outs of reverse cholesterol transport. Ann.Med 36: 135-145.

Grossman M, Rader DJ, Muller DW, Kolansky DM, Kozarsky K, Clark BJI, Stein EA, Lupien PJ, Brewer HB, Jr., Raper SE, and Wilson JM (1995) A pilot study of ex vivo gene therapy for homozygous familial hypercholesterolaemia. Nat.Med. 1: 1148-1154.

Grossman M, Raper SE, Kozarsky K, Stein EA, Engelhardt JF, Muller D, Lupien PJ, and Wilson JM (1994) Successful ex vivo gene therapy directed to liver in a patient with familial hypercholesterolaemia. Nat.Genet. 6: 335-341.

Grossman M, Raper SE, and Wilson JM (1991) Towards liver-directed gene therapy: retrovirus-mediated gene transfer into human hepatocytes. Somat.Cell Mol.Genet. 17: 601-607.

Grossman M, Raper SE, and Wilson JM (1992) Transplantation of genetically modified autologous hepatocytes into nonhuman primates: feasibility and short-term toxicity. Hum.Gene Ther 3: 501-510.

Grossman M, Wilson JM, and Raper SE (1993) A novel approach for introducing hepatocytes into the portal circulation. J.Lab Clin.Med. 121: 472-478.

Gruchala M, Bhardwaj S, Pajusola K, Roy H et al. (2004a) Gene transfer into rabbit arteries with adeno-associated virus and adenovirus vectors. J.Gene Med 6: 545-554.

Gruchala M, Roy H, Bhardwaj S, and Ylä-Herttuala S (2004b) Gene therapy for cardiovascular diseases. Curr.Pharm.Des 10: 407-423.

Guo ZS, Wang LH, Eisensmith RC, and Woo SLC (1996) Evaluation of promoter strength for hepatic gene expression in vivo following adenovirus-mediated gene transfer. Gene Ther. 3: 802-810.

Hacein-Bey-Abina S, Le Deist F, Carlier F, Bouneaud C et al. (2002) Sustained correction of X-linked severe combined immunodeficiency by ex vivo gene therapy. N.Engl.J.Med. 346: 1185-1193.

Hacein-Bey-Abina S, von Kalle C, Schmidt M, Le Deist F, Wulffraat N, McIntyre E, Radford I, Villeval JL, Fraser CC, Cavazzana-Calvo M, and Fischer A (2003a) A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N.Engl.J.Med. 348: 255-256.

Hacein-Bey-Abina S, von Kalle C, Schmidt M, McCormack MP et al. (2003b) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302: 415-419.

Hafenrichter DG, Wu X, Rettinger SD, Kennedy SC, Flye MW, and Ponder KP (1994) Quantitative evaluation of liver-specific promoters from retroviral vectors after in vivo transduction of hepatocytes. Blood 84: 3394-3404.

Hansen AC and Pedersen FS (2002) Safety features of retroviral vectors. Curr.Opin.Mol.Ther 4: 324-333. Harding TC, Koprivnikar KE, Tu GH, Zayek N et al. (2004) Intravenous administration of an AAV-2 vector

for the expression of factor IX in mice and a dog model of hemophilia B. Gene Ther 11: 204-213. Harris JD, Graham IR, Schepelmann S, Stannard AK, Roberts ML, Hodges BL, Hill V, Amalfitano A, Hassall

DG, Owen JS, and Dickson G (2002a) Acute regression of advanced and retardation of early aortic atheroma in immunocompetent apolipoprotein-E (apoE) deficient mice by administration of a second generation [E1(-), E3(-), polymerase(-)] adenovirus vector expressing human apoE. Hum.Mol.Genet. 11: 43-58.

Harris JD, Schepelmann S, Athanasopoulos T, Graham IR, Stannard AK, Mohri Z, Hill V, Hassall DG, Owen JS, and Dickson G (2002b) Inhibition of atherosclerosis in apolipoprotein-E-deficient mice following muscle transduction with adeno-associated virus vectors encoding human apolipoprotein-E. Gene Ther 9: 21-29.

Harui A, Suzuki S, Kochanek S, and Mitani K (1999) Frequency and stability of chromosomal integration of adenovirus vectors. J.Virol. 73: 6141-6146.

Hasty AH, Linton MF, Brandt SJ, Babaev VR, Gleaves LA, and Fazio S (1999) Retroviral gene therapy in ApoE-deficient mice: ApoE expression in the artery wall reduces early foam cell lesion formation. Circulation 99: 2571-2576.

88

Havel RJ and Kane JP (2002) Introduction: Structure and Metabolism of Plasma Lipoproteins. In: The Metabolic and Molecular Bases of Inherited Disease, 8th Edition Online. Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. (eds.) New York: McGraw Hill, Chapter 114.

Haynes C, Erlwein O, and Schnierle BS (2003) Modified envelope glycoproteins to retarget retroviral vectors. Curr.Gene Ther 3: 405-410.

Heeren J, Steinwaerder DS, Schnieders F, Cichon G, Strauss M, and Beisiegel U (1999a) Nonphysiological overexpression of low-density lipoprotein receptors causes pathological intracellular lipid accumulation and the formation of cholesterol and cholesteryl ester crystals in vitro. J.Mol.Med 77: 735-743.

Heeren J, Weber W, and Beisiegel U (1999b) Intracellular processing of endocytosed triglyceride-rich lipoproteins comprises both recycling and degradation. J.Cell Sci. 112 ( Pt 3): 349-359.

Heister T, Heid I, Ackermann M, and Fraefel C (2002) Herpes simplex virus type 1/adeno-associated virus hybrid vectors mediate site-specific integration at the adeno-associated virus preintegration site, AAVS1, on human chromosome 19. J.Virol. 76: 7163-7173.

Hendrie PC, Hirata RK, and Russell DW (2003) Chromosomal integration and homologous gene targeting by replication-incompetent vectors based on the autonomous parvovirus minute virus of mice. J.Virol. 77: 13136-13145.

High KA (2001) AAV-mediated gene transfer for hemophilia. Ann.N.Y.Acad.Sci. 953: 64-74. Hill CL, Bieniasz PD, and McClure MO (1999) Properties of human foamy virus relevant to its development

as a vector for gene therapy. J.Gen.Virol. 80 ( Pt 8): 2003-2009. Hiltunen MO, Turunen MP, Turunen AM, Rissanen TT, Laitinen M, Kosma VM, and Yla-Herttuala S (2000)

Biodistribution of adenoviral vector to nontarget tissues after local in vivo gene transfer to arterial wall using intravascular and periadventitial gene delivery methods. FASEB J 14: 2230-2236.

Hobbs HH, Russell DW, Brown MS, and Goldstein JL (1990) The LDL receptor locus in familial hypercholesterolemia: mutational analysis of a membrane protein. Annu.Rev.Genet. 24: 133-170.

Hoffer MJ, van Eck MM, Petrij F, van der Zee A, de Wit E, Meijer D, Grosveld G, Havekes LM, Hofker MH, and Frants RR (1993) The mouse low density lipoprotein receptor gene: cDNA sequence and exon-intron structure. Biochem Biophys Res Commun 191: 880-886.

Hofmann C, Lehnert W, and Strauss M (1998) The baculovirus vector system for gene delivery into hepatocytes. Gene Ther.Mol.Biol. 1: 231-239.

Hofmann W, Schubert D, LaBonte J, Munson L, Gibson S, Scammell J, Ferrigno P, and Sodroski J (1999) Species-specific, postentry barriers to primate immunodeficiency virus infection. J.Virol. 73: 10020-10028.

Hopkins PN, Wu LL, Schumacher MC, Emi M, Hegele RM, Hunt SC, Lalouel JM, and Williams RR (1991) Type III dyslipoproteinemia in patients heterozygous for familial hypercholesterolemia and apolipoprotein E2. Evidence for a gene-gene interaction. Arterioscler.Thromb. 11: 1137-1146.

Hortelano G, Xu N, Vandenberg A, Solera J, Chang PL, and Ofosu FA (1999) Persistent delivery of factor IX in mice: gene therapy for hemophilia using implantable microcapsules. Hum.Gene Ther 10: 1281-1288.

Hortobagyi GN, Ueno NT, Xia W, Zhang S et al. (2001) Cationic liposome-mediated E1A gene transfer to human breast and ovarian cancer cells and its biologic effects: a phase I clinical trial. J.Clin.Oncol. 19: 3422-3433.

Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS, and Goldstein JL (2003) Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc.Natl.Acad.Sci.U.S.A 100: 12027-12032.

Horwitz MS (2001) Adenoviruses. In: Fields Virology. Knipe, D. M. and Howley, P. M. (eds.) Philadelphia, PA, USA: Lippincott Williams & Wilkins, Chapter 68. pp. 2301-2326.

http://www.ucl.ac.uk/fh/ (2004) Database of LDLR gene in FH; Heath, K., Whittall, R., Wilson, D., Day, I, O'Dell, S., and Haddad, L. UCL.

http://www.wiley.co.uk/genmed/clinical/ (2004) Gene Therapy Clinical Trials Worldwide; J.Gene Med. Huang Y, Ji ZS, Brecht WJ, Rall SC, Jr., Taylor JM, and Mahley RW (1999) Overexpression of apolipoprotein

E3 in transgenic rabbits causes combined hyperlipidemia by stimulating hepatic VLDL production and impairing VLDL lipolysis. Arterioscler.Thromb.Vasc.Biol. 19: 2952-2959.

89

Huang Y, Liu XQ, Rall SC, Jr., Taylor JM, von Eckardstein A, Assmann G, and Mahley RW (1998) Overexpression and accumulation of apolipoprotein E as a cause of hypertriglyceridemia. J.Biol.Chem. 273: 26388-26393.

Hummel S, Lynn EG, Osanger A, Hirayama S, Nimpf J, and Schneider WJ (2003) Molecular characterization of the first avian LDL receptor: role in sterol metabolism of ovarian follicular cells. J Lipid Res. 44: 1633-1642.

Huser A, Rudolph M, and Hofmann C (2001) Incorporation of decay-accelerating factor into the baculovirus envelope generates complement-resistant gene transfer vectors. Nat.Biotechnol. 19: 451-455.

Huser D, Weger S, and Heilbronn R (2002) Kinetics and frequency of adeno-associated virus site-specific integration into human chromosome 19 monitored by quantitative real-time PCR. J.Virol. 76: 7554-7559.

Huttner NA, Girod A, Schnittger S, Schoch C, Hallek M, and Buning H (2003) Analysis of site-specific transgene integration following cotransduction with recombinant adeno-associated virus and a rep encoding plasmid. J.Gene Med 5: 120-129.

Hyde SC, Southern KW, Gileadi U, Fitzjohn EM et al. (2000) Repeat administration of DNA/liposomes to the nasal epithelium of patients with cystic fibrosis. Gene Ther 7: 1156-1165.

Ill CR, Yang CQ, Bidlingmaier SM, Gonzales JN, Burns DS, Bartholomew RM, and Scuderi P (1997) Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia A. Blood Coagul.Fibrinolysis 8 Suppl 2: S23-S30.

Indolfi C, Avvedimento EV, Rapacciuolo A, Di Lorenzo E, Esposito G, Stabile E, Feliciello A, Mele E, Giuliano P, Condorelli G, and . (1995) Inhibition of cellular ras prevents smooth muscle cell proliferation after vascular injury in vivo. Nat.Med 1: 541-545.

Indraccolo S, Habeler W, Tisato V, Stievano L, Piovan E, Tosello V, Esposito G, Wagner R, Uberla K, Chieco-Bianchi L, and Amadori A (2002) Gene transfer in ovarian cancer cells: a comparison between retroviral and lentiviral vectors. Cancer Res. 62: 6099-6107.

Ingals TH, ADAMS WM, LURIE MB, and IPSEN J (1964) Natural history of adenocarcinoma of the uterus in the Phipps rabbit colony. J.Natl.Cancer Inst. 33: 799-806.

Innerarity TL, Friedlander EJ, Rall SC, Jr., Weisgraber KH, and Mahley RW (1983) The receptor-binding domain of human apolipoprotein E. Binding of apolipoprotein E fragments. J.Biol.Chem. 258: 12341-12347.

Inoue I, Ishibashi S, Harada K, Shimano H, Gotoda T, Shimada M, Takahashi K, Ishii J, Yazaki Y, and Yamada N (1991) Overexpression of low density lipoprotein receptor on Chinese hamster ovary cells generates foam cells. Arterioscler.Thromb. 11: 1310-1314.

Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, and Herz J (1993) Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J.Clin.Invest. 92: 883-893.

Ishibashi S, Goldstein JL, Brown MS, Herz J, and Burns DK (1994) Massive xanthomatosis and atherosclerosis in cholesterol-fed low density lipoprotein receptor-negative mice. J.Clin.Invest. 93: 1885-1893.

Ishigami M, Swertfeger DK, Hui MS, Granholm NA, and Hui DY (2000) Apolipoprotein E inhibition of vascular smooth muscle cell proliferation but not the inhibition of migration is mediated through activation of inducible nitric oxide synthase. Arterioscler.Thromb.Vasc.Biol. 20: 1020-1026.

Jansen AC, van Wissen S, Defesche JC, and Kastelein JJ (2002) Phenotypic variability in familial hypercholesterolaemia: an update. Curr.Opin.Lipidol. 13: 165-171.

Jeon H, Meng W, Takagi J, Eck MJ, Springer TA, and Blacklow SC (2001) Implications for familial hypercholesterolemia from the structure of the LDL receptor YWTD-EGF domain pair. Nat.Struct.Biol. 8: 499-504.

Johnston JC, Gasmi M, Lim LE, Elder JH, Yee JK, Jolly DJ, Campbell KP, Davidson BL, and Sauter SL (1999) Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors. J.Virol. 73: 4991-5000.

Johnston KM, Jacoby D, Pechan PA, Fraefel C, Borghesani P, Schuback D, Dunn RJ, Smith FI, and Breakefield XO (1997) HSV/AAV hybrid amplicon vectors extend transgene expression in human glioma cells. Hum Gene Ther 8: 359-370.

90

Jordan A, Defechereux P, and Verdin E (2001) The site of HIV-1 integration in the human genome determines basal transcriptional activity and response to Tat transactivation. EMBO J. 20: 1726-1738.

Kafri T (2001) Lentivirus vectors: difficulties and hopes before clinical trials. Curr.Opin.Mol.Ther 3: 316-326. Kafri T, Blömer U, Peterson DA, Gage FH, and Verma IM (1997) Sustained expression of genes delivered

directly into liver and muscle by lentiviral vectors. Nat.Genet. 17: 314-317. Kafri T, Morgan D, Krahl T, Sarvetnick N, Sherman L, and Verma I (1998) Cellular immune response to

adenoviral vector infected cells does not require de novo viral gene expression: Implications for gene therapy. Proc Natl Acad Sci USA 95: 11377-11382.

Kafri T, van Praag H, Ouyang L, Gage FH, and Verma IM (1999) A packaging cell line for lentivirus vectors. J Virol 73: 576-584.

Kahl CA, Marsh J, Fyffe J, Sanders DA, and Cornetta K (2004) Human immunodeficiency virus type 1-derived lentivirus vectors pseudotyped with envelope glycoproteins derived from Ross River virus and Semliki Forest virus. J.Virol. 78: 1421-1430.

Kalra M, Jost CJ, Severson SR, and Miller VM (2000) Adventitial versus intimal liposome-mediated ex vivo transfection of canine saphenous vein grafts with endothelial nitric oxide synthase gene. J.Vasc.Surg. 32: 1190-1200.

Kang Y, Stein CS, Heth JA, Sinn PL et al. (2002) In vivo gene transfer using a nonprimate lentiviral vector pseudotyped with Ross River Virus glycoproteins. J Virol. 76: 9378-9388.

Karolewski BA, Watson DJ, Parente MK, and Wolfe JH (2003) Comparison of transfection conditions for a lentivirus vector produced in large volumes. Hum.Gene Ther 14: 1287-1296.

Kashyap VS, Santamarina-Fojo S, Brown DR, Parrott CL, Applebaum-Bowden D, Meyn S, Talley G, Paigen B, Maeda N, and Brewer HBJ (1995) Apolipoprotein E deficiency in mice: gene replacement and prevention of atherosclerosis using adenovirus vectors. J.Clin.Invest. 96: 1612-1620.

Kaul S, Rukshin V, Santos R, Azarbal B, Bisgaier CL, Johansson J, Tsang VT, Chyu KY, Cercek B, Mirocha J, and Shah PK (2003) Intramural delivery of recombinant apolipoprotein A-IMilano/phospholipid complex (ETC-216) inhibits in-stent stenosis in porcine coronary arteries. Circulation 107: 2551-2554.

Kawashiri M, Zhang Y, Usher D, Reilly M, Pure E, and Rader DJ (2001) Effects of coexpression of the LDL receptor and apoE on cholesterol metabolism and atherosclerosis in LDL receptor-deficient mice. J.Lipid Res. 42: 943-950.

Kay MA, Baley P, Rothenberg S, Leland F, Fleming L, Ponder KP, Liu T, Finegold M, Darlington G, Pokorny W, and . (1992) Expression of human alpha 1-antitrypsin in dogs after autologous transplantation of retroviral transduced hepatocytes. Proc.Natl.Acad.Sci.U.S.A 89: 89-93.

Kim DH, Iijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H, Kondo H, Saeki S, and Yamamoto T (1996) Human apolipoprotein E receptor 2. A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J Biol Chem 271: 8373-8380.

Kim SS, Kothari N, You XJ, Robinson WE, Jr., Schnell T, Uberla K, and Fan H (2001) Generation of replication-defective helper-free vectors based on simian immunodeficiency virus. Virology 282: 154-167.

Kim VN, Mitrophanous K, Kingsman SM, and Kingsman AJ (1998) Minimal requirement for a lentivirus vector based on human immunodeficiency virus type 1. J Virol 72: 811-816.

Kingsley DM, Kozarsky KF, Segal M, and Krieger M (1986) Three types of low density lipoprotein receptor-deficient mutant have pleiotropic defects in the synthesis of N-linked, O-linked, and lipid-linked carbohydrate chains. J.Cell Biol. 102: 1576-1585.

Kitten O, Cosset FL, and Ferry N (1997) Highly efficient retrovirus-mediated gene transfer into rat hepatocytes in vivo. Hum Gene Ther 8: 1491-1494.

Klages N, Zufferey R, and Trono D (2000) A stable system for the high-titer production of multiply attenuated lentiviral vectors. Mol.Ther 2: 170-176.

Klein NC and Cunha BA (2001) New uses of older antibiotics. Med Clin.North Am. 85: 125-132. Klocker U, Oberwinkler H, Kurschner T, and Protzer U (2003) Presence of replicating virus in recombinant

hepadnavirus stocks results from recombination and can be eliminated by the use of a packaging cell line. J.Virol. 77: 2873-2881.

91

Kobayashi K, Oka K, Forte T, Ishida B, Teng B, Ishimura-Oka K, Nakamuta M, and Chan L (1996) Reversal of hypercholesterolemia in low density lipoprotein receptor knockout mice by adenovirus-mediated gene transfer of the very low density lipoprotein receptor. J Biol Chem 271: 6852-6860.

Kochanek S, Schiedner G, and Volpers C (2001) High-capacity 'gutless' adenoviral vectors. Curr.Opin.Mol.Ther 3: 454-463.

Koeberl DD, Alexander IE, Halbert CL, Russell DW, and Miller AD (1997) Persistent expression of human clotting factor IX from mouse liver after intravenous injection of adeno- associated virus vectors. Proc Natl Acad Sci USA 94: 1426-1431.

Koeberl DD, Bonham L, Halbert CL, Allen JM, Birkebak T, and Miller AD (1999) Persistent, therapeutically relevant levels of human granulocyte colony-stimulating factor in mice after systemic delivery of adeno-associated virus vectors. Hum.Gene Ther. 10: 2133-2140.

Koivisto PV, Koivisto UM, Kovanen PT, Gylling H, Miettinen TA, and Kontula K (1993) Deletion of exon 15 of the LDL receptor gene is associated with a mild form of familial hypercholesterolemia. FH-Espoo. Arterioscler.Thromb. 13: 1680-1688.

Koivisto UM, Gylling H, Miettinen TA, and Kontula K (1997) Familial moderate hypercholesterolemia caused by Asp235-->Glu mutation of the LDL receptor gene and co-occurrence of a de novo deletion of the LDL receptor gene in the same family. Arterioscler Thromb Vasc Biol 17: 1392-1399.

Koivisto UM, Hubbard AL, and Mellman I (2001) A novel cellular phenotype for familial hypercholesterolemia due to a defect in polarized targeting of LDL receptor. Cell 105: 575-585.

Koivisto UM, Turtola H, Aalto-Setälä K, Top B, Frants RR, Kovanen PT, Syvänen AC, and Kontula K (1992) The familial hypercholesterolemia (FH)-North Karelia mutation of the low density lipoprotein receptor gene deletes seven nucleotides of exon 6 and is a common cause of FH in Finland. J.Clin.Invest. 90: 219-228.

Koivisto UM, Viikari JS, and Kontula K (1995) Molecular characterization of minor gene rearrangements in Finnish patients with heterozygous familial hypercholesterolemia: identification of two common missense mutations (Gly823-->Asp and Leu380-->His) and eight rare mutations of the LDL receptor gene. Am.J.Hum.Genet. 57: 789-797.

Kontula K, Vuorio A, Turtola H, and Saikku P (1999) Association of seropositivity for Chlamydia pneumoniae and coronary artery disease in heterozygous familial hypercholesterolaemia. Lancet 354: 46-47.

Kontush A, Chantepie S, and Chapman MJ (2003) Small, dense HDL particles exert potent protection of atherogenic LDL against oxidative stress. Arterioscler.Thromb.Vasc.Biol. 23: 1881-1888.

Konvalinka J, Litterst MA, Welker R, Kottler H, Rippmann F, Heuser AM, and Krausslich HG (1995) An active-site mutation in the human immunodeficiency virus type 1 proteinase (PR) causes reduced PR activity and loss of PR-mediated cytotoxicity without apparent effect on virus maturation and infectivity. J.Virol. 69: 7180-7186.

Kootstra NA, Matsumura R, and Verma IM (2003) Efficient production of human FVIII in hemophilic mice using lentiviral vectors. Mol.Ther. 7: 623-631.

Korokhov N, Mikheeva G, Krendelshchikov A, Belousova N et al. (2003) Targeting of adenovirus via genetic modification of the viral capsid combined with a protein bridge. J.Virol. 77: 12931-12940.

Kowal RC, Herz J, Goldstein JL, Esser V, and Brown MS (1989) Low density lipoprotein receptor-related protein mediates uptake of cholesteryl esters derived from apoprotein E-enriched lipoproteins. Proc.Natl.Acad.Sci.U.S.A. 86: 5810-5814.

Kowolik CM and Yee JK (2002) Preferential transduction of human hepatocytes with lentiviral vectors pseudotyped by Sendai virus F protein. Mol.Ther. 5: 762-769.

Kozarsky KF, Bonen DK, Giannoni F, Funahashi T, Wilson JM, and Davidson NO (1996a) Hepatic expression of the catalytic subunit of the apolipoprotein B mRNA editing enzyme (apobec-1) ameliorates hypercholesterolemia in LDL receptor-deficient rabbits. Hum Gene Ther 7: 943-957.

Kozarsky KF, Jooss K, Donahee M, Strauss JF, and Wilson JM (1996b) Effective treatment of familial hypercholesterolaemia in the mouse model using adenovirus-mediated transfer of the VLDL receptor gene. Nat Genet 13: 54-62.

Kozarsky KF, McKinley DR, Austin LL, Raper SE, Stratford-Perricaudet LD, and Wilson JM (1994) In vivo correction of low density lipoprotein receptor deficiency in the Watanabe heritable hyperlipidemic rabbit with recombinant adenoviruses. J Biol Chem 269: 13695-13702.

92

Kramer MG, Barajas M, Razquin N, Berraondo P, Rodrigo M, Wu C, Qian C, Fortes P, and Prieto J (2003) In vitro and in vivo comparative study of chimeric liver-specific promoters. Mol.Ther. 7: 375-385.

Kuriyama S, Mitoro A, Tsujinoue H, Nakatani T, Yoshiji H, Tsujimoto T, Yamazaki M, and Fukui H (2000) Particle-mediated gene transfer into murine livers using a newly developed gene gun. Gene Ther. 7: 1132-1136.

Kypreos KE, Li X, van Dijk KW, Havekes LM, and Zannis VI (2003) Molecular mechanisms of type III hyperlipoproteinemia: The contribution of the carboxy-terminal domain of ApoE can account for the dyslipidemia that is associated with the E2/E2 phenotype. Biochemistry 42: 9841-9853.

Kypreos KE, Morani P, van Dijk KW, Havekes LM, and Zannis VI (2001a) The amino-terminal 1-185 domain of apoE promotes the clearance of lipoprotein remnants in vivo. The carboxy-terminal domain is required for induction of hyperlipidemia in normal and apoE-deficient mice. Biochemistry 40: 6027-6035.

Kypreos KE, van Dijk KW, van der ZA, Havekes LM, and Zannis VI (2001b) Domains of apolipoprotein E contributing to triglyceride and cholesterol homeostasis in vivo. Carboxyl-terminal region 203-299 promotes hepatic very low density lipoprotein-triglyceride secretion. J.Biol.Chem. 276: 19778-19786.

Laitinen M, Hartikainen J, Hiltunen MO, Eränen J et al. (2000) Catheter-mediated vascular endothelial growth factor gene transfer to human coronary arteries after angioplasty. Hum Gene Ther 11: 263-270.

Laitinen M, Pakkanen T, Donetti E, Baetta R et al. (1997) Gene transfer into the carotid artery using an adventitial collar: comparison of the effectiveness of the plasmid- liposome complexes, retroviruses, pseudotyped retroviruses, and adenoviruses. Hum Gene Ther 8: 1645-1650.

Laitinen M and Ylä-Herttuala S (1998) Adventitial gene transfer to arterial wall. Pharmacol Res 37: 251-254. Lam PY and Breakefield XO (2000) Hybrid vector designs to control the delivery, fate and expression of

transgenes. J.Gene Med 2: 395-408. Lamartina S, Roscilli G, Rinaudo CD, Sporeno E, Silvi L, Hillen W, Bujard H, Cortese R, Ciliberto G, and

Toniatti C (2002) Stringent control of gene expression in vivo by using novel doxycycline-dependent trans-activators. Hum.Gene Ther. 13: 199-210.

Lamartina S, Silvi L, Roscilli G, Casimiro D et al. (2003) Construction of an rtTA2(s)-m2/tts(kid)-based transcription regulatory switch that displays no basal activity, good inducibility, and high responsiveness to doxycycline in mice and non-human primates. Mol.Ther 7: 271-280.

Lander ES, Linton LM, Birren B, Nusbaum C et al. (2001) Initial sequencing and analysis of the human genome. Nature 409: 860-921.

Langer C, Huang Y, Cullen P, Wiesenhutter B, Mahley RW, Assmann G, and von Eckardstein A (2000) Endogenous apolipoprotein E modulates cholesterol efflux and cholesteryl ester hydrolysis mediated by high-density lipoprotein-3 and lipid-free apolipoproteins in mouse peritoneal macrophages. J.Mol.Med 78: 217-227.

Le M, Okuyama T, Cai SR, Kennedy SC, Bowling WM, Flye MW, and Ponder KP (1997) Therapeutic levels of functional human factor X in rats after retroviral-mediated hepatic gene therapy. Blood 89: 1254-1259.

Lebherz C, Gao G, Louboutin JP, Millar J, Rader D, and Wilson JM (2004) Gene therapy with novel adeno-associated virus vectors substantially diminishes atherosclerosis in a murine model of familial hypercholesterolemia. J.Gene Med 6: 663-672.

Lee LY, Mohler WA, Schafer BL, Freudenberger JS, Byrne-Connolly N, Eager KB, Mosley ST, Leighton JK, Thrift RN, Davis RA, and . (1989) Nucleotide sequence of the rat low density lipoprotein receptor cDNA. Nucleic Acids Res. 17: 1259-1260.

Lehrman S (1999) Virus treatment questioned after gene therapy death. Nature 401: 517-518. Lehtolainen P, Tyynelä K, Kannasto J, Airenne KJ, and Ylä-Herttuala S (2002) Baculoviruses exhibit restricted

cell type specificity in rat brain: a comparison of baculovirus- and adenovirus-mediated intracerebral gene transfer in vivo. Gene Ther. 9: 1693-1699.

Leurs C, Jansen M, Pollok KE, Heinkelein M, Schmidt M, Wissler M, Lindemann D, von Kalle C, Rethwilm A, Williams DA, and Hanenberg H (2003) Comparison of three retroviral vector systems for transduction of nonobese diabetic/severe combined immunodeficiency mice repopulating human CD34+ cord blood cells. Hum.Gene Ther 14: 509-519.

93

Lewis P, Hensel M, and Emerman M (1992) Human immunodeficiency virus infection of cells arrested in the cell cycle. EMBO J. 11: 3053-3058.

Li CJ, Friedman DJ, Wang C, Metelev V, and Pardee AB (1995a) Induction of apoptosis in uninfected lymphocytes by HIV-1 Tat protein. Science 268: 429-431.

Li J, Fang B, Eisensmith RC, Li XH et al. (1995b) In vivo gene therapy for hyperlipidemia: phenotypic correction in Watanabe rabbits by hepatic delivery of the rabbit LDL receptor gene. J.Clin.Invest. 95: 768-773.

Li T and Zhang J (2004) Stable expression of three genes from a tricistronic retroviral vector containing a picornavirus and 9-nt cellular internal ribosome entry site elements. J.Virol.Methods 115: 137-144.

Li Z, Dullmann J, Schiedlmeier B, Schmidt M et al. (2002) Murine leukemia induced by retroviral gene marking. Science 296: 497-

Lieber A, Vrancken Peeters MJ, Meuse L, Fausto N, Perkins J, and Kay MA (1995) Adenovirus-mediated urokinase gene transfer induces liver regeneration and allows for efficient retrovirus transduction of hepatocytes in vivo. Proc.Natl.Acad.Sci.U.S.A. 92: 6210-6214.

Lin CY, Duan H, and Mazzone T (1999) Apolipoprotein E-dependent cholesterol efflux from macrophages: kinetic study and divergent mechanisms for endogenous versus exogenous apolipoprotein E. J.Lipid Res. 40: 1618-1627.

Lindgren V, Luskey KL, Russell DW, and Francke U (1985) Human genes involved in cholesterol metabolism: chromosomal mapping of the loci for the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-coenzyme A reductase with cDNA probes. Proc.Natl.Acad.Sci.U.S.A 82: 8567-8571.

Linton MF, Atkinson JB, and Fazio S (1995) Prevention of atherosclerosis in apolipoprotein E-deficient mice by bone marrow transplantation. Science 267: 1034-1037.

Linton MF, Hasty AH, Babaev VR, and Fazio S (1998) Hepatic apo E expression is required for remnant lipoprotein clearance in the absence of the low density lipoprotein receptor. J Clin Invest 101: 1726-1736.

Lipshutz GS, Flebbe-Rehwaldt L, and Gaensler KM (1999) Adenovirus-mediated gene transfer to the peritoneum and hepatic parenchyma of fetal mice in utero. Surgery 126: 171-177.

Liscum L (2002) Cholesterol Biosynthesis. In: Biochemistry of Lipids, Lipoproteins and Membranes. Vance, D. E. and Vance, J. E. (eds.) Paris: Elsevier, Chapter 15. pp. 409-431.

Liu F, Lei J, Vollmer R, and Huang L (2004a) Mechanism of liver gene transfer by mechanical massage. Mol.Ther 9: 452-457.

Liu MA (2003) DNA vaccines: a review. J.Intern.Med 253: 402-410. Liu X, Yan Z, Luo M, Zak R, Li Z, Driskell RR, Huang Y, Tran N, and Engelhardt JF (2004b) Targeted

correction of single-base-pair mutations with adeno-associated virus vectors under nonselective conditions. J.Virol. 78: 4165-4175.

Loewen N, Bahler C, Teo WL, Whitwam T, Peretz M, Xu R, Fautsch MP, Johnson DH, and Poeschla EM (2002) Preservation of aqueous outflow facility after second-generation FIV vector-mediated expression of marker genes in anterior segments of human eyes. Invest Ophthalmol.Vis.Sci. 43: 3686-3690.

Loiler SA, Conlon TJ, Song S, Tang Q et al. (2003) Targeting recombinant adeno-associated virus vectors to enhance gene transfer to pancreatic islets and liver. Gene Ther 10: 1551-1558.

Lu IL, Lin CY, Lin SB, Chen ST, Yeh LY, Yang FY, and Au LC (2003) Correction/mutation of acid alpha-D-glucosidase gene by modified single-stranded oligonucleotides: in vitro and in vivo studies. Gene Ther 10: 1910-1916.

Lundstrom K (2003) Latest development in viral vectors for gene therapy. Trends Biotechnol. 21: 117-122. Lusis AJ (2000) Atherosclerosis. Nature 407: 233-241. Lutz H (1990) Feline retroviruses: a brief review. Vet.Microbiol. 23: 131-146. Lynch CM, Hara PS, Leonard JC, Williams JK, Dean RH, and Geary RL (1997) Adeno-associated virus

vectors for vascular gene delivery. Circ.Res. 80: 497-505. MacKenzie TC, Kobinger GP, Kootstra NA, Radu A, Sena-Esteves M, Bouchard S, Wilson JM, Verma IM,

and Flake AW (2002) Efficient transduction of liver and muscle after in utero injection of lentiviral vectors with different pseudotypes. Mol.Ther. 6: 349-358.

94

Mahley RW (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 240: 622-630.

Mahley RW and Huang Y (1999) Apolipoprotein E: from atherosclerosis to Alzheimer's disease and beyond. Curr.Opin.Lipidol. 10: 207-217.

Mahley RW, Huang Y, and Rall SC, Jr. (1999) Pathogenesis of type III hyperlipoproteinemia (dysbetalipoproteinemia). Questions, quandaries, and paradoxes. J.Lipid Res. 40: 1933-1949.

Mahley RW and Rall SC, Jr. (2002) Type III Hyperlipoproteinemia (Dysbetalipoproteinemia): The Role of Apolipoprotein E in Normal and Abnormal Lipoprotein Metabolism. In: The Metabolic and Molecular Bases of Inherited Disease, 8th Edition Online. Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. (eds.) New York: McGraw Hill, Chapter 119.

Mahley RW, Weisgraber KH, Hussain MM, Greenman B, Fisher M, Vogel T, and Gorecki M (1989) Intravenous infusion of apolipoprotein E accelerates clearance of plasma lipoproteins in rabbits. J Clin Invest 83: 2125-2130.

Malloy SI, Altenburg MK, Knouff C, Lanningham-Foster L, Parks JS, and Maeda N (2004) Harmful effects of increased LDLR expression in mice with human APOE*4 but not APOE*3. Arterioscler.Thromb.Vasc.Biol. 24: 91-97.

Mann R, Mulligan RC, and Baltimore D (1983) Construction of a retrovirus packaging mutant and its use to produce helper-free defective retrovirus. Cell 33: 153-159.

Manome Y, Kunieda T, Wen PY, Koga T, Kufe DW, and Ohno T (1998) Transgene expression in malignant glioma using a replication-defective adenoviral vector containing the Egr-1 promoter: activation by ionizing radiation or uptake of radioactive iododeoxyuridine. Hum.Gene Ther 9: 1409-1417.

Marks D, Thorogood M, Neil HA, and Humphries SE (2003) A review on the diagnosis, natural history, and treatment of familial hypercholesterolaemia. Atherosclerosis 168: 1-14.

Marshall E (1999) Gene therapy death prompts review of adenovirus vector. Science 286: 2244-2245. Martins IJ, Hone E, Chi C, Seydel U, Martins RN, and Redgrave TG (2000) Relative roles of LDLr and LRP in

the metabolism of chylomicron remnants in genetically manipulated mice. J.Lipid Res. 41: 205-213. Matukonis M, Li M, Molina RP, Paszkiet B, Kaleko M, and Luo T (2002) Development of second- and third-

generation bovine immunodeficiency virus-based gene transfer systems. Hum.Gene Ther 13: 1293-1303.

Maugeais C, Tietge UJ, Tsukamoto K, Glick JM, and Rader DJ (2000) Hepatic apolipoprotein E expression promotes very low density lipoprotein-apolipoprotein B production in vivo in mice. J.Lipid Res. 41: 1673-1679.

Mbewu AD, Bhatnagar D, Durrington PN, Hunt L, Ishola M, Arrol S, Mackness M, Lockley P, and Miller JP (1991) Serum lipoprotein(a) in patients heterozygous for familial hypercholesterolemia, their relatives, and unrelated control populations. Arterioscler.Thromb. 11: 940-946.

McLaughlin SK, Collis P, Hermonat PL, and Muzyczka N (1988) Adeno-associated virus general transduction vectors: analysis of proviral structures. J Virol 62: 1963-1973.

Mehta KD, Chen WJ, Goldstein JL, and Brown MS (1991) The low density lipoprotein receptor in Xenopus laevis. I. Five domains that resemble the human receptor. J Biol Chem 266: 10406-10414.

Mergia A and Heinkelein M (2003) Foamy virus vectors. Curr.Top.Microbiol.Immunol. 277: 131-159. Merten OW (2004) State-of-the-art of the production of retroviral vectors. J.Gene Med 6 Suppl 1: S105-

S124. Miao CH, Ohashi K, Patijn GA, Meuse L, Ye X, Thompson AR, and Kay MA (2000) Inclusion of the hepatic

locus control region, an intron, and untranslated region increases and stabilizes hepatic factor IX gene expression in vivo but not in vitro. Mol.Ther 1: 522-532.

Miao CH, Thompson AR, Loeb K, and Ye X (2001) Long-term and therapeutic-level hepatic gene expression of human factor IX after naked plasmid transfer in vivo. Mol.Ther 3: 947-957.

Miao CH, Ye X, and Thompson AR (2003) High-level factor VIII gene expression in vivo achieved by nonviral liver-specific gene therapy vectors. Hum.Gene Ther 14: 1297-1305.

Mikkelsen JG, Yant SR, Meuse L, Huang Z, Xu H, and Kay MA (2003) Helper-Independent Sleeping Beauty transposon-transposase vectors for efficient nonviral gene delivery and persistent gene expression in vivo. Mol.Ther 8: 654-665.

95

Miller AD (1997) In: Retroviruses. Coffin, J. M, Hughes, S. H, and Varmus, H. E. (eds.) Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, pp. 437-473.

Miller AD and Buttimore C (1986) Redesign of retrovirus packaging cell lines to avoid recombination leading to helper virus production. Mol.Cell Biol. 6: 2895-2902.

Mingozzi F, Schuttrumpf J, Arruda VR, Liu Y, Liu YL, High KA, Xiao W, and Herzog RW (2002) Improved hepatic gene transfer by using an adeno-associated virus serotype 5 vector. J.Virol. 76: 10497-10502.

Mitani K and Kubo S (2002) Adenovirus as an integrating vector. Curr.Gene Ther 2: 135-144. Miyata M and Smith JD (1996) Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity

by oxidative insults and beta-amyloid peptides. Nat.Genet. 14: 55-61. Miyazaki Y, Takamatsu T, Nosaka T, Fujita S, Martin TE, and Hatanaka M (1995) The cytotoxicity of human

immunodeficiency virus type 1 Rev: implications for its interaction with the nucleolar protein B23. Exp.Cell Res. 219: 93-101.

Miyoshi H, Blömer U, Takahashi M, Gage FH, and Verma IM (1998) Development of a self-inactivating lentivirus vector. J Virol 72: 8150-8157.

Mizuguchi H and Hayakawa T (2001) Characteristics of adenovirus-mediated tetracycline-controllable expression system. Biochim.Biophys.Acta 1568: 21-29.

Mizuguchi H, Xu ZL, Sakurai F, Mayumi T, and Hayakawa T (2003) Tight positive regulation of transgene expression by a single adenovirus vector containing the rtTA and tTS expression cassettes in separate genome regions. Hum.Gene Ther 14: 1265-1277.

Mochizuki S, Mizukami H, Ogura T, Kure S et al. (2004) Long-term correction of hyperphenylalaninemia by AAV-mediated gene transfer leads to behavioral recovery in phenylketonuria mice. Gene Ther Advance online publication, 1 April 2004; doi 10.1038/sj.gt.3302262.

Moffatt S, Hays J, HogenEsch H, and Mittal SK (2000) Circumvention of vector-specific neutralizing antibody response by alternating use of human and non-human adenoviruses: implications in gene therapy. Virology 272: 159-167.

Morral N, O'Neal W, Rice K, Leland M et al. (1999) Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons. Proc.Natl.Acad.Sci.U.S.A. 96: 12816-12821.

Mount JD, Herzog RW, Tillson DM, Goodman SA, Robinson N, McCleland ML, Bellinger D, Nichols TC, Arruda VR, Lothrop CD, Jr., and High KA (2002) Sustained phenotypic correction of hemophilia B dogs with a factor IX null mutation by liver-directed gene therapy. Blood 99: 2670-2676.

Mozas P, Castillo S, Reyes G, Tejedor D, Civeira F, Garcia-Alvarez I, Puzo J, Cenarro A, Alonso R, Mata P, and Pocovi M (2003) Apolipoprotein E genotype is not associated with cardiovascular disease in heterozygous subjects with familial hypercholesterolemia. Am.Heart J. 145: 999-1005.

Muller K, Heller H, and Doerfler W (2001) Foreign DNA integration. Genome-wide perturbations of methylation and transcription in the recipient genomes. J.Biol.Chem. 276: 14271-14278.

Muul LM, Tuschong LM, Soenen SL, Jagadeesh GJ et al. (2003) Persistence and expression of the adenosine deaminase gene for 12 years and immune reaction to gene transfer components: long-term results of the first clinical gene therapy trial. Blood 101: 2563-2569.

Mäkinen K, Manninen H, Hedman M, Matsi P, Mussalo H, Alhava E, and Ylä-Herttuala S (2002) Increased vascularity detected by digital subtraction angiography after VEGF gene transfer to human lower limb artery: a randomized, placebo-controlled, double-blinded phase II study. Mol.Ther 6: 127-133.

Nabel EG, Plautz G, and Nabel GJ (1990) Site-specific gene expression in vivo by direct gene transfer into the arterial wall. Science 249: 1285-1288.

Nakai H, Herzog RW, Hagstrom JN, Walter J et al. (1998) Adeno-associated viral vector-mediated gene transfer of human blood coagulation factor IX into mouse liver. Blood 91: 4600-4607.

Nakai H, Iwaki Y, Kay MA, and Couto LB (1999) Isolation of recombinant adeno-associated virus vector-cellular DNA junctions from mouse liver. J Virol 73: 5438-5447.

Nakai H, Storm TA, and Kay MA (2000) Increasing the size of rAAV-mediated expression cassettes in vivo by intermolecular joining of two complementary vectors. Nat.Biotechnol. 18: 527-532.

Nakashima Y, Plump AS, Raines EW, Breslow JL, and Ross R (1994) ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler.Thromb. 14: 133-140.

96

Nanjee MN, Doran JE, Lerch PG, and Miller NE (1999) Acute effects of intravenous infusion of ApoA1/phosphatidylcholine discs on plasma lipoproteins in humans. Arterioscler.Thromb.Vasc.Biol. 19: 979-989.

Naoumova RP, Thompson GR, and Soutar AK (2004) Current management of severe homozygous hypercholesterolaemias. Curr.Opin.Lipidol. 15: 413-422.

Nett PC, Sollinger HW, and Alam T (2003) Hepatic insulin gene therapy in insulin-dependent diabetes mellitus. Am.J.Transplant. 3: 1197-1203.

Nguyen TH, Loux N, Dagher I, Vons C, Carey K, Briand P, Hadchouel M, Franco D, Jouanneau J, Schwall R, and Weber A (2003) Improved gene transfer selectivity to hepatocarcinoma cells by retrovirus vector displaying single-chain variable fragment antibody against c-Met. Cancer Gene Ther 10: 840-849.

Nguyen TH, Oberholzer J, Birraux J, Majno P, Morel P, and Trono D (2002) Highly efficient lentiviral vector-mediated transduction of nondividing, fully reimplantable primary hepatocytes. Mol.Ther. 6: 199-209.

Niidome T and Huang L (2002) Gene therapy progress and prospects: nonviral vectors. Gene Ther 9: 1647-1652.

Nissen SE, Tsunoda T, Tuzcu EM, Schoenhagen P et al. (2003) Effect of recombinant ApoA-I Milano on coronary atherosclerosis in patients with acute coronary syndromes: a randomized controlled trial. JAMA 290: 2292-2300.

Novelli G, Borgiani P, Giardina E, Mango R, Contino G, Romeo F, and Mehta JL (2003) Role of genetics in prevention of coronary atherosclerosis. Curr.Opin.Cardiol. 18: 368-371.

Nowotny N, Uthman A, Haas OA, Borkhardt A, Lechner K, Egberink HF, Mostl K, and Horzinek MC (1995) Is it possible to catch leukemia from a cat? Lancet 346: 252-253.

O'Rourke JP, Newbound GC, Kohn DB, Olsen JC, and Bunnell BA (2002) Comparison of gene transfer efficiencies and gene expression levels achieved with equine infectious anemia virus- and human immunodeficiency virus type 1-derived lentivirus vectors. J.Virol. 76: 1510-1515.

Oertel M, Rosencrantz R, Chen YQ, Thota PN, Sandhu JS, Dabeva MD, Pacchia AL, Adelson ME, Dougherty JP, and Shafritz DA (2003) Repopulation of rat liver by fetal hepatoblasts and adult hepatocytes transduced ex vivo with lentiviral vectors. Hepatology 37: 994-1005.

Ohashi K, Park F, and Kay MA (2002) Role of hepatocyte direct hyperplasia in lentivirus-mediated liver transduction in vivo. Hum.Gene Ther. 13: 653-663.

Oka K and Chan L (2002) Recent advances in liver-directed gene therapy for dyslipidemia. Curr.Atheroscler.Rep. 4: 199-207.

Oka K, Pastore L, Kim IH, Merched A et al. (2001) Long-term stable correction of low-density lipoprotein receptor-deficient mice with a helper-dependent adenoviral vector expressing the very low-density lipoprotein receptor. Circulation 103: 1274-1281.

Olaisen B, Teisberg P, and Gedde-Dahl T, Jr. (1982) The locus for apolipoprotein E (apoE) is linked to the complement component C3 (C3) locus on chromosome 19 in man. Hum.Genet. 62: 233-236.

Olmsted RA, Hirsch VM, Purcell RH, and Johnson PR (1989) Nucleotide sequence analysis of feline immunodeficiency virus: genome organization and relationship to other lentiviruses. Proc Natl Acad Sci U S A 86: 8088-8092.

Olmsted RA, Langley R, Roelke ME, Goeken RM, Adger-Johnson D, Goff JP, Albert JP, Packer C, Laurenson MK, and Caro TM (1992) Worldwide prevalence of lentivirus infection in wild feline species: epidemiologic and phylogenetic aspects. J Virol 66: 6008-6018.

Onodera M, Ariga T, Kawamura N, Kobayashi I et al. (1998) Successful peripheral T-lymphocyte-directed gene transfer for a patient with severe combined immune deficiency caused by adenosine deaminase deficiency. Blood 91: 30-36.

Orth P, Schnappinger D, Hillen W, Saenger W, and Hinrichs W (2000) Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system. Nat.Struct.Biol 7: 215-219.

Ory DS (2004) Nuclear receptor signaling in the control of cholesterol homeostasis: have the orphans found a home? Circ.Res. 95: 660-670.

Ory DS, Neugeboren BA, and Mulligan RC (1996) A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus g pseudotypes. Proc Natl Acad Sci USA 93: 11400-11406.

97

Osborne WR, Ramesh N, Lau S, Clowes MM, Dale DC, and Clowes AW (1995) Gene therapy for long-term expression of erythropoietin in rats. Proc.Natl.Acad.Sci.U.S.A. 92: 8055-8058.

Osuga J, Yonemoto M, Yamada N, Shimano H, Yagyu H, Ohashi K, Harada K, Kamei T, Yazaki Y, and Ishibashi S (1998) Cholesterol lowering in low density lipoprotein receptor knockout mice overexpressing apolipoprotein E. J.Clin.Invest 102: 386-394.

Pacchia AL, Adelson ME, Kaul M, Ron Y, and Dougherty JP (2001) An inducible packaging cell system for safe, efficient lentiviral vector production in the absence of HIV-1 accessory proteins. Virology 282: 77-86.

Pages JC and Bru T (2004) Toolbox for retrovectorologists. J.Gene Med 6 Suppl 1: S67-S82. Pakkanen TM, Laitinen M, Hippeläinen M, Hiltunen MO, Alhava E, and Ylä-Herttuala S (2000)

Periadventitial lacZ gene transfer to pig carotid arteries using a biodegradable collagen collar or a wrap of collagen sheet with adenoviruses and plasmid-liposome complexes. J.Gene Med. 2: 52-60.

Pakkanen TM, Laitinen M, Hippeläinen M, Hiltunen MO, Lehtolainen P, Leppänen P, Luoma JS, Alhava E, and Ylä-Herttuala S (1999a) Improved gene transfer efficiency in liver with vesicular stomatitis virus G-protein pseudotyped retrovirus after partial liver resection and thymidine kinase-ganciclovir pre-treatment. Pharmacol Res 40: 451-457.

Pakkanen TM, Laitinen M, Hippeläinen M, Kallionpää H, Lehtolainen P, Leppänen P, Luoma JS, Tarvainen R, Alhava E, and Ylä-Herttuala S (1999b) Enhanced plasma cholesterol lowering effect of retrovirus- mediated LDL receptor gene transfer to WHHL rabbit liver after improved surgical technique and stimulation of hepatocyte proliferation by combined partial liver resection and thymidine kinase ganciclovir treatment. Gene Ther. 6: 34-41.

Palombo F, Monciotti A, Recchia A, Cortese R, Ciliberto G, and La Monica N (1998) Site-specific integration in mammalian cells mediated by a new hybrid baculovirus-adeno-associated virus vector. J.Virol. 72: 5025-5034.

Pannell D and Ellis J (2001) Silencing of gene expression: implications for design of retrovirus vectors. Rev.Med.Virol. 11: 205-217.

Papadakis ED, Nicklin SA, Baker AH, and White SJ (2004) Promoters and control elements: designing expression cassettes for gene therapy. Curr.Gene Ther 4: 89-113.

Parikh SA and Edelman ER (2000) Endothelial cell delivery for cardiovascular therapy. Adv.Drug Deliv.Rev. 42: 139-161.

Parise F, Simone L, Croce MA, Ghisellini M, Battini R, Borghi S, Tiozzo R, Ferrari S, and Calandra S (1999) Construction and in vitro functional evaluation of a low-density lipoprotein receptor/transferrin fusion protein as a therapeutic tool for familial hypercholesterolemia. Hum Gene Ther 10: 1219-1228.

Park CW, Park YM, Lee GT, Lee Y, Woo S, Cha JY, Ahn CW, Cha BS, Kim KS, Ahn YH, and Lee HC (2004) Targeting of therapeutic gene expression to the liver by using liver-type pyruvate kinase proximal promoter and the SV40 viral enhancer active in multiple cell types. Biochem.Biophys.Res.Commun. 314: 131-137.

Park F and Kay MA (2001) Modified HIV-1 based lentiviral vectors have an effect on viral transduction efficiency and gene expression in vitro and in vivo. Mol.Ther 4: 164-173.

Park F, Ohashi K, Chiu W, Naldini L, and Kay MA (2000a) Efficient lentiviral transduction of liver requires cell cycling in vivo. Nat.Genet.2000.Jan.;24.(1.):49.-52. 24: 49-52.

Park F, Ohashi K, and Kay MA (2000b) Therapeutic levels of human factor VIII and IX using HIV-1-based lentiviral vectors in mouse liver. Blood 96: 1173-1176.

Park F, Ohashi K, and Kay MA (2003) The effect of age on hepatic gene transfer with self-inactivating lentiviral vectors in vivo. Mol.Ther. 8: 314-323.

Parks R, Evelegh C, and Graham F (1999) Use of helper-dependent adenoviral vectors of alternative serotypes permits repeat vector administration. Gene Ther 6: 1565-1573.

Parks RJ, Chen L, Anton M, Sankar U, Rudnicki MA, and Graham FL (1996) A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc.Natl.Acad.Sci.U.S.A. 93: 13565-13570.

Pastore L, Belalcazar LM, Oka K, Cela R, Lee B, Chan L, and Beaudet AL (2004) Helper-dependent adenoviral vector-mediated long-term expression of human apolipoprotein A-I reduces atherosclerosis in apo E-deficient mice. Gene 327: 153-160.

98

Pastore L, Morral N, Zhou H, Garcia R, Parks RJ, Kochanek S, Graham FL, Lee B, and Beaudet AL (1999) Use of a liver-specific promoter reduces immune response to the transgene in adenoviral vectors. Hum Gene Ther 10: 1773-1781.

Paszty C, Maeda N, Verstuyft J, and Rubin EM (1994) Apolipoprotein AI transgene corrects apolipoprotein E deficiency-induced atherosclerosis in mice. J.Clin.Invest 94: 899-903.

Patijn GA, Lieber A, Schowalter DB, Schwall R, and Kay MA (1998) Hepatocyte growth factor induces hepatocyte proliferation in vivo and allows for efficient retroviral-mediated gene transfer in mice. Hepatology 28: 707-716.

Pedersen NC (1993) The Feline Immunodeficiency Virus. In: The Retroviridae. Levy, J. A. (eds.) New York: Plenum Press, Chapter 3. pp. 181-228.

Peltonen L, Jalanko A, and Varilo T (1999) Molecular genetics of the Finnish disease heritage. Hum.Mol.Genet. 8: 1913-1923.

Peranteau WH, Hayashi S, Kim HB, Shaaban AF, and Flake AW (2004) In utero hematopoietic cell transplantation: what are the important questions? Fetal Diagn.Ther 19: 9-12.

Pfeifer A, Kessler T, Yang M, Baranov E, Kootstra N, Cheresh DA, Hoffman RM, and Verma IM (2001) Transduction of liver cells by lentiviral vectors: analysis in living animals by fluorescence imaging. Mol.Ther. 3: 319-322.

Pfeifer A and Verma IM (2001) Virus Vectors and Their Applications. In: Fields Virology. Knipe, D. M. and Howley, P. M. (eds.) Philadelphia, PA, USA: Lippincott Williams & Wilkins, Chapter 17. pp. 469-491.

Pimstone SN, Defesche JC, Clee SM, Bakker HD, Hayden MR, and Kastelein JJ (1997) Differences in the phenotype between children with familial defective apolipoprotein B-100 and familial hypercholesterolemia. Arterioscler.Thromb.Vasc.Biol. 17: 826-833.

Pimstone SN, Sun XM, du SC, Frohlich JJ, Hayden MR, and Soutar AK (1998) Phenotypic variation in heterozygous familial hypercholesterolemia: a comparison of Chinese patients with the same or similar mutations in the LDL receptor gene in China or Canada. Arterioscler.Thromb.Vasc.Biol. 18: 309-315.

Pittman RC, Carew TE, Attie AD, Witztum JL, Watanabe Y, and Steinberg D (1982) Receptor-dependent and receptor-independent degradation of low density lipoprotein in normal rabbits and in receptor-deficient mutant rabbits. J.Biol.Chem. 257: 7994-8000.

Plautz G, Nabel EG, and Nabel GJ (1991) Introduction of vascular smooth muscle cells expressing recombinant genes in vivo. Circulation 83: 578-583.

Plump AS, Smith JD, Hayek T, Aalto-Setälä K, Walsh A, Verstuyft JG, Rubin EM, and Breslow JL (1992) Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell 71: 343-353.

Podevin G, Podevin J, Ongoiba N, Sandoval C, Bralet MP, Ferry N, and Levard G (2000) In vivo retrovirus-mediated gene transfer into lamb liver. Eur.J.Pediatr.Surg. 10: 167-171.

Poeschla EM, Wong-Staal F, and Looney DJ (1998) Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors. Nat Med 4: 354-357.

Polvino WJ, Dichek DA, Mason J, and Anderson WF (1992) Molecular cloning and nucleotide sequence of cDNA encoding a functional murine low-density-lipoprotein receptor. Somat Cell Mol Genet 18: 443-450.

Ponnazhagan S, Erikson D, Kearns WG, Zhou SZ, Nahreini P, Wang XS, and Srivastava A (1997) Lack of site-specific integration of the recombinant adeno-associated virus 2 genomes in human cells. Hum.Gene Ther 8: 275-284.

Powell-Braxton L, Veniant M, Latvala RD, Hirano KI, Won WB, Ross J, Dybdal N, Zlot CH, Young SG, and Davidson NO (1998) A mouse model of human familial hypercholesterolemia: markedly elevated low density lipoprotein cholesterol levels and severe atherosclerosis on a low-fat chow diet. Nat.Med. 4: 934-938.

Prasad Alur RK, Foley B, Parente MK, Tobin DK, Heuer GG, Avadhani AN, Pongubala J, and Wolfe JH (2002) Modification of multiple transcriptional regulatory elements in a Moloney murine leukemia virus gene transfer vector circumvents silencing in fibroblast grafts and increases levels of expression of the transferred enzyme. Gene Ther. 9: 1146-1154.

Prevost M and Raussens V (2004) Apolipoprotein E-low density lipoprotein receptor binding: study of protein-protein interaction in rationally selected docked complexes. Proteins 55: 874-884.

99

Price MA, Case SS, Carbonaro DA, Yu XJ et al. (2002) Expression from second-generation feline immunodeficiency virus vectors is impaired in human hematopoietic cells. Mol.Ther. 6: 645-652.

Pullinger CR, Kane JP, and Malloy MJ (2003) Primary hypercholesterolemia: genetic causes and treatment of five monogenic disorders. Expert.Rev.Cardiovasc.Ther 1: 107-119.

Qian X, Balestra ME, Yamanaka S, Boren J, Lee I, and Innerarity TL (1998) Low expression of the apolipoprotein B mRNA-editing transgene in mice reduces LDL levels but does not cause liver dysplasia or tumors. Arterioscler Thromb Vasc Biol 18: 1013-1020.

Rader DJ and FitzGerald GA (1998) State of the art: atherosclerosis in a limited edition. Nat.Med. 4: 899-900.

Radhakrishnan A, Sun LP, Kwon HJ, Brown MS, and Goldstein JL (2004) Direct binding of cholesterol to the purified membrane region of SCAP: mechanism for a sterol-sensing domain. Mol.Cell 15: 259-268.

Raffai RL, Hasty AH, Wang Y, Mettler SE, Sanan DA, Linton MF, Fazio S, and Weisgraber KH (2003) Hepatocyte-derived ApoE is more effective than non-hepatocyte-derived ApoE in remnant lipoprotein clearance. J.Biol.Chem. 278: 11670-11675.

Ramani K, Hassan Q, Venkaiah B, Hasnain SE, and Sarkar DP (1998) Site-specific gene delivery in vivo through engineered Sendai viral envelopes. Proc Natl Acad Sci U S A 95: 11886-11890.

Raper SE, Chirmule N, Lee FS, Wivel NA, Bagg A, Gao GP, Wilson JM, and Batshaw ML (2003) Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol.Genet.Metab 80: 148-158.

Raper SE, Grossman M, Rader DJ, Thoene JG, Clark BJ, Kolansky DM, Muller DWM, and Wilson JM (1996) Safety and feasibility of liver-directed ex vivo gene therapy for homozygous familial hypercholesterolemia. Ann Surg 223: 116-126.

Raper SE, Wilson JM, and Grossman M (1992) Retroviral-mediated gene transfer in human hepatocytes. Surgery 112: 333-339.

Raper SE, Yudkoff M, Chirmule N, Gao GP et al. (2002) A pilot study of in vivo liver-directed gene transfer with an adenoviral vector in partial ornithine transcarbamylase deficiency. Hum.Gene Ther. 13: 163-175.

Raussens V, Slupsky CM, Sykes BD, and Ryan RO (2003) Lipid-bound structure of an apolipoprotein E-derived peptide. J.Biol.Chem. 278: 25998-26006.

Razzini G, Parise F, Calebiro D, Battini R, Bagni B, Corazzari T, Tarugi P, Angelelli C, Molinari S, Falqui L, and Ferrari S (2004) Low-density lipoprotein (LDL) receptor/transferrin fusion protein: in vivo production and functional evaluation as a potential therapeutic tool for lowering plasma LDL cholesterol. Hum.Gene Ther 15: 533-541.

Recchia A, Parks RJ, Lamartina S, Toniatti C, Pieroni L, Palombo F, Ciliberto G, Graham FL, Cortese R, La Monica N, and Colloca S (1999) Site-specific integration mediated by a hybrid adenovirus/adeno-associated virus vector. Proc Natl Acad Sci U S A 96: 2615-2620.

Reddick RL, Zhang SH, and Maeda N (1994) Atherosclerosis in mice lacking apo E. Evaluation of lesional development and progression [published erratum appears in Arterioscler Thromb 1994 May;14(5):839]. Arterioscler.Thromb. 14: 141-147.

Rendahl KG, Quiroz D, Ladner M, Coyne M, Seltzer J, Manning WC, and Escobedo JA (2002) Tightly regulated long-term erythropoietin expression in vivo using tet-inducible recombinant adeno-associated viral vectors. Hum.Gene Ther 13: 335-342.

Rhainds D and Brissette L (1999) Low density lipoprotein uptake: holoparticle and cholesteryl ester selective uptake. Int.J.Biochem.Cell Biol. 31: 915-931.

Rhainds D and Brissette L (2004) The role of scavenger receptor class B type I (SR-BI) in lipid trafficking. defining the rules for lipid traders. Int.J.Biochem.Cell Biol. 36: 39-77.

Ribourtout E, Desfaits AC, Salazkin I, and Raymond J (2003) Ex vivo gene therapy with adenovirus-mediated transforming growth factor beta1 expression for endovascular treatment of aneurysm: results in a canine bilateral aneurysm model. J.Vasc.Surg. 38: 576-583.

Richardson P, Thoma C, Kren BT, and Steer CJ (2002) Strategies for hepatic gene correction. J.Drug Target 10: 133-141.

Riddell DR, Graham A, and Owen JS (1997) Apolipoprotein E inhibits platelet aggregation through the L-arginine:nitric oxide pathway. Implications for vascular disease. J.Biol.Chem. 272: 89-95.

100

Riddell DR, Vinogradov DV, Stannard AK, Chadwick N, and Owen JS (1999) Identification and characterization of LRP8 (apoER2) in human blood platelets. J.Lipid Res. 40: 1925-1930.

Riddell SR, Elliott M, Lewinsohn DA, Gilbert MJ, Wilson L, Manley SA, Lupton SD, Overell RW, Reynolds TC, Corey L, and Greenberg PD (1996) T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat.Med. 2: 216-223.

Rinaldi M, Catapano AL, Parrella P, Ciafre SA, Signori E, Seripa D, Uboldi P, Antonini R, Ricci G, Farace MG, and Fazio VM (2000) Treatment of severe hypercholesterolemia in apolipoprotein E-deficient mice by intramuscular injection of plasmid DNA. Gene Ther 7: 1795-1801.

Rios CD, Ooboshi H, Piegors D, Davidson BL, and Heistad DD (1995) Adenovirus-mediated gene transfer to normal and atherosclerotic arteries. A novel approach. Arterioscler.Thromb.Vasc.Biol. 15: 2241-2245.

Rodenburg J, Vissers MN, Wiegman A, Trip MD, Bakker HD, and Kastelein JJ (2004) Familial hypercholesterolemia in children. Curr.Opin.Lipidol. 15: 405-411.

Ross R (1999) Mechanisms of disease - Atherosclerosis - An inflammatory disease. N Engl J Med 340: 115-126.

Rudenko G and Deisenhofer J (2003) The low-density lipoprotein receptor: ligands, debates and lore. Curr.Opin.Struct.Biol. 13: 683-689.

Rudenko G, Henry L, Henderson K, Ichtchenko K, Brown MS, Goldstein JL, and Deisenhofer J (2002) Structure of the LDL receptor extracellular domain at endosomal pH. Science 298: 2353-2358.

Russell DW and Miller AD (1996) Foamy virus vectors. J.Virol. 70: 217-222. Russell DW, Yamamoto T, Schneider WJ, Slaughter CJ, Brown MS, and Goldstein JL (1983) cDNA cloning

of the bovine low density lipoprotein receptor: feedback regulation of a receptor mRNA. Proc Natl Acad Sci U S A 80: 7501-7505.

Rutledge EA and Russell DW (1997) Adeno-associated virus vector integration junctions. J Virol 71: 8429-8436.

Räty JK, Airenne KJ, Marttila AT, Marjomaki V, Hytönen VP, Lehtolainen P, Laitinen OH, Mähönen AJ, Kulomaa MS, and Ylä-Herttuala S (2004) Enhanced gene delivery by avidin-displaying baculovirus. Mol.Ther 9: 282-291.

Saenz DT and Poeschla EM (2004) FIV: from lentivirus to lentivector. J.Gene Med 6 Suppl 1: S95-104. Salucci V, Scarito A, Aurisicchio L, Lamartina S et al. (2002) Tight control of gene expression by a helper-

dependent adenovirus vector carrying the rtTA2(s)-M2 tetracycline transactivator and repressor system. Gene Ther 9: 1415-1421.

Samulski RJ, Chang LS, and Shenk T (1989) Helper-free stocks of recombinant adeno-associated viruses: normal integration does not require viral gene expression. J Virol 63: 3822-3828.

Sandig V, Hofmann C, Steinert S, Jennings G, Schlag P, and Strauss M (1996a) Gene transfer into hepatocytes and human liver tissue by baculovirus vectors. Hum.Gene Ther. 7: 1937-1945.

Sandig V, Loser P, Lieber A, Kay MA, and Strauss M (1996b) HBV-derived promoters direct liver-specific expression of an adenovirally transduced LDL receptor gene. Gene Ther 3: 1002-1009.

Sandmair AM, Loimas S, Puranen P, Immonen A et al. (2000) Thymidine kinase gene therapy for human malignant glioma, using replication-deficient retroviruses or adenoviruses. Hum Gene Ther 11: 2197-2205.

Sarkar R, Tetreault R, Gao G, Wang L, Bell P, Chandler R, Wilson JM, and Kazazian HH, Jr. (2004) Total correction of hemophilia A mice with canine FVIII using an AAV 8 serotype. Blood 103: 1253-1260.

Satoh W, Hirai Y, Tamayose K, and Shimada T (2000) Site-specific integration of an adeno-associated virus vector plasmid mediated by regulated expression of rep based on Cre-loxP recombination. J.Virol. 74: 10631-10638.

Sauter BV, Parashar B, Chowdhury NR, Kadakol A, Ilan Y, Singh H, Milano J, Strayer DS, and Chowdhury JR (2000) A replication-deficient rSV40 mediates liver-directed gene transfer and a long-term amelioration of jaundice in gunn rats. Gastroenterology 119: 1348-1357.

Sauter SL and Gasmi M (2001) FIV vector systems. Somat.Cell Mol.Genet. 26: 99-129. Sauter SL, Gasmi M, and Dubensky TW, Jr. (2003) A highly efficient gene delivery system derived from feline

immunodeficiency virus (FIV). Methods Mol.Med. 76: 405-432.

101

Schagen FH, Ossevoort M, Toes RE, and Hoeben RC (2004) Immune responses against adenoviral vectors and their transgene products: a review of strategies for evasion. Crit Rev.Oncol.Hematol. 50: 51-70.

Schmidt-Wolf GD and Schmidt-Wolf IG (2003) Non-viral and hybrid vectors in human gene therapy: an update. Trends Mol.Med 9: 67-72.

Schneider DB, Sassani AB, Vassalli G, Driscoll RM, and Dichek DA (1999) Adventitial delivery minimizes the proinflammatory effects of adenoviral vectors. J Vasc Surg 29: 543-550.

Schneider WJ, Brown MS, and Goldstein JL (1983) Kinetic defects in the processing of the low density lipoprotein receptor in fibroblasts from WHHL rabbits and a family with familial hypercholesterolemia. Mol.Biol.Med 1: 353-367.

Schneider WJ and Nimpf J (2003) LDL receptor relatives at the crossroad of endocytosis and signaling. Cell Mol.Life Sci. 60: 892-903.

Schröder AR, Shinn P, Chen H, Berry C, Ecker JR, and Bushman F (2002) HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110: 521-529.

Seed M, Hoppichler F, Reaveley D, McCarthy S, Thompson GR, Boerwinkle E, and Utermann G (1990) Relation of serum lipoprotein(a) concentration and apolipoprotein(a) phenotype to coronary heart disease in patients with familial hypercholesterolemia. N.Engl.J.Med 322: 1494-1499.

Seidah NG, Benjannet S, Wickham L, Marcinkiewicz J, Jasmin SB, Stifani S, Basak A, Prat A, and Chretien M (2003) The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc.Natl.Acad.Sci.U.S.A 100: 928-933.

Sever N, Song BL, Yabe D, Goldstein JL, Brown MS, and Debose-Boyd RA (2003) Insig-dependent ubiquitination and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and geranylgeraniol. J Biol.Chem. 278: 52479-52490.

Shah PK, Yano J, Reyes O, Chyu KY, Kaul S, Bisgaier CL, Drake S, and Cercek B (2001) High-dose recombinant apolipoprotein A-I(milano) mobilizes tissue cholesterol and rapidly reduces plaque lipid and macrophage content in apolipoprotein e-deficient mice. Potential implications for acute plaque stabilization. Circulation 103: 3047-3050.

Shi W, Wang X, Wong J, Hedrick CC, Wong H, Castellani LW, and Lusis AJ (2004) Effect of macrophage-derived apolipoprotein E on hyperlipidemia and atherosclerosis of LDLR-deficient mice. Biochem.Biophys.Res.Commun. 317: 223-229.

Shi Y, Evans JE, and Rock KL (2003) Molecular identification of a danger signal that alerts the immune system to dying cells. Nature 425: 516-521.

Shibuya K, Tajima M, Kanai K, Ihara M, and Nunoya T (1999) Spontaneous lymphoma in a Japanese White rabbit. J.Vet.Med Sci. 61: 1327-1329.

Shichiri M, Tanaka A, and Hirata Y (2003) Intravenous gene therapy for familial hypercholesterolemia using ligand-facilitated transfer of a liposome:LDL receptor gene complex. Gene Ther 10: 827-831.

Shimano H, Ohsuga J, Shimada M, Namba Y, Gotoda T, Harada K, Katsuki M, Yazaki Y, and Yamada N (1995) Inhibition of diet-induced atheroma formation in transgenic mice expressing apolipoprotein E in the arterial wall. J.Clin.Invest 95: 469-476.

Shiraishi M, Tomori H, Nagahama M, Taira K, Nozato E, Sugawa H, Ishida A, and Muto Y (1999) Stable gene expression with VSV-G pseudotyped-retrovirus vector in the rat liver. J.Surg.Res. 84: 168-173.

Short MK, Clouthier DE, Schaefer IM, Hammer RE, Magnuson MA, and Beale EG (1992) Tissue-specific, developmental, hormonal, and dietary regulation of rat phosphoenolpyruvate carboxykinase-human growth hormone fusion genes in transgenic mice. Mol.Cell Biol. 12: 1007-1020.

Simons K and Ikonen E (2000) How cells handle cholesterol. Science 290: 1721-1726. Simons M, Edelman ER, DeKeyser JL, Langer R, and Rosenberg RD (1992) Antisense c-myb oligonucleotides

inhibit intimal arterial smooth muscle cell accumulation in vivo. Nature 359: 67-70. Siow RC, Mallawaarachchi CM, and Weissberg PL (2003) Migration of adventitial myofibroblasts following

vascular balloon injury: insights from in vivo gene transfer to rat carotid arteries. Cardiovasc.Res. 59: 212-221.

Sirtori CR, Calabresi L, Franceschini G, Baldassarre D, Amato M, Johansson J, Salvetti M, Monteduro C, Zulli R, Muiesan ML, and Agabiti-Rosei E (2001) Cardiovascular status of carriers of the apolipoprotein A-I(Milano) mutant: the Limone sul Garda study. Circulation 103: 1949-1954.

102

Snyder RO, Miao C, Meuse L, Tubb J et al. (1999) Correction of hemophilia B in canine and murine models using recombinant adeno-associated viral vectors. Nature Med 5: 64-70.

Snyder RO, Miao CH, Patijn GA, Spratt SK et al. (1997) Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat Genet. 16: 270-276.

Song JJ, Lee B, Chang JW, Kim JH, Kwon YK, and Lee H (2003) Optimization of vesicular stomatitis virus-G pseudotyped feline immunodeficiency virus vector for minimized cytotoxicity with efficient gene transfer. Virus Res. 93: 25-30.

Spady DK, Huettinger M, Bilheimer DW, and Dietschy JM (1987) Role of receptor-independent low density lipoprotein transport in the maintenance of tissue cholesterol balance in the normal and WHHL rabbit. J.Lipid Res. 28: 32-41.

Spiegel M, Bitzer M, Schenk A, Rossmann H, Neubert WJ, Seidler U, Gregor M, and Lauer U (1998) Pseudotype formation of Moloney murine leukemia virus with Sendai virus glycoprotein F. J.Virol. 72: 5296-5302.

Stannard AK, Riddell DR, Sacre SM, Tagalakis AD, Langer C, von Eckardstein A, Cullen P, Athanasopoulos T, Dickson G, and Owen JS (2001) Cell-derived apolipoprotein E (ApoE) particles inhibit vascular cell adhesion molecule-1 (VCAM-1) expression in human endothelial cells. J.Biol.Chem. 276: 46011-46016.

Stary HC (2000) Lipid and macrophage accumulations in arteries of children and the development of atherosclerosis. Am.J.Clin.Nutr. 72: 1297S-1306S.

Stefansson S, Chappell DA, Argraves KM, Strickland DK, and Argraves WS (1995) Glycoprotein 330/low density lipoprotein receptor-related protein-2 mediates endocytosis of low density lipoproteins via interaction with apolipoprotein B100. J.Biol.Chem. 270: 19417-19421.

Stein CS, Martins I, and Davidson BL (2000) Long-term reversal of hypercholesterolemia in low density lipoprotein receptor (LDLR)-deficient mice by adenovirus-mediated LDLR gene transfer combined with CD154 blockade. J.Gene Med 2: 41-51.

Steinberg D (2002) Atherogenesis in perspective: hypercholesterolemia and inflammation as partners in crime. Nat.Med 8: 1211-1217.

Stopeck AT, Jones A, Hersh EM, Thompson JA, Finucane DM, Gutheil JC, and Gonzalez R (2001) Phase II study of direct intralesional gene transfer of allovectin-7, an HLA-B7/beta2-microglobulin DNA-liposome complex, in patients with metastatic melanoma. Clin.Cancer Res. 7: 2285-2291.

Strayer D, Branco F, Zern MA, Yam P et al. (2002) Durability of transgene expression and vector integration: recombinant SV40-derived gene therapy vectors. Mol.Ther 6: 227-237.

Südhof TC, Goldstein JL, Brown MS, and Russell DW (1985) The LDL receptor gene: a mosaic of exons shared with different proteins. Science 228: 815-822.

Summerford C, Bartlett JS, and Samulski RJ (1999) alpha V beta 5 integrin: a co-receptor for adeno- associated virus type 2 infection. Nature Med 5: 78-82.

Sun AM, Cai Z, Shi Z, Ma F, O'Shea GM, and Gharapetian H (1986) Microencapsulated hepatocytes as a bioartificial liver. ASAIO Trans. 32: 39-41.

Sun L, Li J, and Xiao X (2000) Overcoming adeno-associated virus vector size limitation through viral DNA heterodimerization. Nat.Med 6: 599-602.

Sung VM and Lai MM (2002) Murine retroviral pseudotype virus containing hepatitis B virus large and small surface antigens confers specific tropism for primary human hepatocytes: a potential liver-specific targeting system. J.Virol. 76: 912-917.

Svoboda J, Hejnar J, Geryk J, Elleder D, and Vernerova Z (2000) Retroviruses in foreign species and the problem of provirus silencing. Gene 261: 181-188.

Swift LL, Farkas MH, Major AS, Valyi-Nagy K, Linton MF, and Fazio S (2001) A recycling pathway for resecretion of internalized apolipoprotein E in liver cells. J.Biol.Chem. 276: 22965-22970.

Tabas I (2002) Cholesterol in health and disease. J Clin.Invest 110: 583-590. Tai ES, Adiconis X, Ordovas JM, Carmena-Ramon R, Real J, Corella D, Ascaso J, and Carmena R (2003)

Polymorphisms at the SRBI locus are associated with lipoprotein levels in subjects with heterozygous familial hypercholesterolemia. Clin.Genet. 63: 53-58.

103

Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, and Yamamoto T (1992) Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity. Proc.Natl.Acad.Sci.U.S.A. 89: 9252-9256.

Takahashi S, Ohsugi K, Yamamoto T, Shiomi M, and Sakuragawa N (2001) A novel approach to ex vivo gene therapy for familial hypercholesterolemia using human amniotic epithelial cells as a transgene carrier. Tohoku J.Exp.Med. 193: 279-292.

Takeuchi Y, Cosset FL, Lachmann PJ, Okada H, Weiss RA, and Collins MK (1994) Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell. J.Virol. 68: 8001-8007.

Talbott RL, Sparger EE, Lovelace KM, Fitch WM, Pedersen NC, Luciw PA, and Elder JH (1989) Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proc Natl Acad Sci U S A 86: 5743-5747.

Tangirala RK, Pratico D, FitzGerald GA, Chun S, Tsukamoto K, Maugeais C, Usher DC, Pure E, and Rader DJ (2001) Reduction of isoprostanes and regression of advanced atherosclerosis by apolipoprotein E. J.Biol.Chem. 276: 261-266.

Tangirala RK, Rubin EM, and Palinski W (1995) Quantitation of atherosclerosis in murine models: correlation between lesions in the aortic origin and in the entire aorta, and differences in the extent of lesions between sexes in LDL receptor-deficient and apolipoprotein E-deficient mice. J Lipid Res 36: 2320-2328.

Tenenbaum L, Lehtonen E, and Monahan PE (2003) Evaluation of risks related to the use of adeno-associated virus-based vectors. Curr.Gene Ther 3: 545-565.

Thomas CE, Ehrhardt A, and Kay MA (2003) Progress and problems with the use of viral vectors for gene therapy. Nat.Rev.Genet. 4: 346-358.

Thompson GR (2003) LDL apheresis. Atherosclerosis 167: 1-13. Thorngate FE, Rudel LL, Walzem RL, and Williams DL (2000) Low levels of extrahepatic nonmacrophage

ApoE inhibit atherosclerosis without correcting hypercholesterolemia in ApoE-deficient mice. Arterioscler.Thromb.Vasc.Biol. 20: 1939-1945.

Tietge UJ, Cichon G, Buttner C, Genschel J et al. (2004) A sensitive noninvasive method for monitoring successful liver-directed gene transfer of the low-density lipoprotein receptor in Watanabe hyperlipidemic rabbits in vivo. Gene Ther 11: 574-580.

Toniatti C, Bujard H, Cortese R, and Ciliberto G (2004) Gene therapy progress and prospects: transcription regulatory systems. Gene Ther 11: 649-657.

Tranchant I, Thompson B, Nicolazzi C, Mignet N, and Scherman D (2004) Physicochemical optimisation of plasmid delivery by cationic lipids. J.Gene Med 6 Suppl 1: S24-S35.

Tripathy SK, Black HB, Goldwasser E, and Leiden JM (1996) Immune responses to transgene-encoded proteins limit the stability of gene expression after injection of replication-defective adenovirus vectors. Nat.Med. 2: 545-550.

Trono D (2000) Lentiviral vectors: turning a deadly foe into a therapeutic agent. Gene Ther.2000.Jan.;7.(1.):20.-23. 7: 20-23.

Tsui LV, Kelly M, Zayek N, Rojas V et al. (2002) Production of human clotting Factor IX without toxicity in mice after vascular delivery of a lentiviral vector. Nat.Biotechnol. 20: 53-57.

Tsukamoto K, Maugeais C, Glick JM, and Rader DJ (2000a) Markedly increased secretion of VLDL triglycerides induced by gene transfer of apolipoprotein E isoforms in apoE-deficient mice. J.Lipid Res. 41: 253-259.

Tsukamoto K, Smith P, Glick JM, and Rader DJ (1997) Liver-directed gene transfer and prolonged expression of three major human ApoE isoforms in ApoE-deficient mice. J Clin Invest 100: 107-114.

Tsukamoto K, Tangirala R, Chun SH, Pure E, and Rader DJ (1999) Rapid regression of atherosclerosis induced by liver-directed gene transfer of ApoE in ApoE-deficient mice. Arterioscler.Thromb.Vasc.Biol. 19: 2162-2170.

Tsukamoto K, Tangirala RK, Chun S, Usher D, Pure E, and Rader DJ (2000b) Hepatic expression of apolipoprotein E inhibits progression of atherosclerosis without reducing cholesterol levels in LDL receptor-deficient mice. Mol.Ther. 1: 189-194.

104

Turley SD (2004) Cholesterol metabolism and therapeutic targets: rationale for targeting multiple metabolic pathways. Clin.Cardiol. 27: III16-III21.

Turunen MP, Hiltunen MO, Ruponen M, Virkamäki L, Szoka FCJ, Urtti A, and Ylä-Herttuala S (1999) Efficient adventitial gene delivery to rabbit carotid artery with cationic polymer-plasmid complexes. Gene Ther 6: 6-11.

Untergasser A and Protzer U (2004) Hepatitis B virus-based vectors allow the elimination of viral gene expression and the insertion of foreign promoters. Hum.Gene Ther 15: 203-210.

Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, and Hillen W (2000) Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc.Natl.Acad.Sci.U.S.A. 97: 7963-7968.

Van Berkel TJ, Van Eck M, Herijgers N, Fluiter K, and Nion S (2000) Scavenger receptor classes A and B. Their roles in atherogenesis and the metabolism of modified LDL and HDL. Ann.N.Y.Acad.Sci. 902: 113-126.

Van Craenenbroeck K, Vanhoenacker P, and Haegeman G (2000) Episomal vectors for gene expression in mammalian cells. Eur.J.Biochem. 267: 5665-5678.

Van den Driessche T, Collen D, and Chuah MK (2003) Gene therapy for the hemophilias. J.Thromb.Haemost. 1: 1550-1558.

Van den Driessche T, Thorrez L, Naldini L, Follenzi A, Moons L, Berneman Z, Collen D, and Chuah MK (2002) Lentiviral vectors containing the human immunodeficiency virus type-1 central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo. Blood 100: 813-822.

Van Dijk KW, van Vlijmen BJ, van't Hof HB, van der ZA, Santamarina-Fojo S, Van Berkel TJ, Havekes LM, and Hofker MH (1999) In LDL receptor-deficient mice, catabolism of remnant lipoproteins requires a high level of apoE but is inhibited by excess apoE. J.Lipid Res. 40: 336-344.

Van Eck M, van Dijk KW, Herijgers N, Hofker MH, Groot PH, and van Berkel TJ (2001) Essential role for the (hepatic) LDL receptor in macrophage apolipoprotein E-induced reduction in serum cholesterol levels and atherosclerosis. Atherosclerosis 154: 103-112.

Van Linthout S, Collen D, and De Geest B (2002) Effect of promoters and enhancers on expression, transgene DNA persistence, and hepatotoxicity after adenoviral gene transfer of human apolipoprotein A-I. Hum.Gene Ther 13: 829-840.

Vassilopoulos G, Trobridge G, Josephson NC, and Russell DW (2001) Gene transfer into murine hematopoietic stem cells with helper-free foamy virus vectors. Blood 98: 604-609.

Venter JC, Adams MD, Myers EW, Li PW et al. (2001) The sequence of the human genome. Science 291: 1304-1351.

Verhoeyen E and Cosset FL (2004) Surface-engineering of lentiviral vectors. J.Gene Med 6 Suppl 1: S83-S94.

Vogel R, Amar L, Thi AD, Saillour P, and Mallet J (2004) A single lentivirus vector mediates doxycycline-regulated expression of transgenes in the brain. Hum.Gene Ther 15: 157-165.

Volpers C and Kochanek S (2004) Adenoviral vectors for gene transfer and therapy. J.Gene Med 6 Suppl 1: S164-S171.

Vuorio AF, Aalto-Setälä K, Koivisto UM, Turtola H, Nissen H, Kovanen PT, Miettinen TA, Gylling H, Oksanen H, and Kontula K (2001) Familial hypercholesterolaemia in Finland: common, rare and mild mutations of the LDL receptor and their clinical consequences. Finnish FH-group. Ann.Med 33: 410-421.

Vuorio AF, Turtola H, and Kontula K (1997a) A novel point mutation (Pro84-->Ser) of the low density lipoprotein receptor gene in a family with moderate hypercholesterolemia. Clin.Genet. 51: 191-195.

Vuorio AF, Turtola H, and Kontula K (1997b) Neonatal diagnosis of familial hypercholesterolemia in newborns born to a parent with a molecularly defined heterozygous familial hypercholesterolemia. Arterioscler.Thromb.Vasc.Biol. 17: 3332-3337.

Vuorio AF, Turtola H, Piilahti KM, Repo P, Kanninen T, and Kontula K (1997c) Familial hypercholesterolemia in the Finnish north Karelia. A molecular, clinical, and genealogical study. Arterioscler.Thromb.Vasc.Biol. 17: 3127-3138.

105

Wade-Martins R, Saeki Y, and Chiocca EA (2003) Infectious delivery of a 135-kb LDLR genomic locus leads to regulated complementation of low-density lipoprotein receptor deficiency in human cells. Mol.Ther 7: 604-612.

Walther W and Stein U (1996) Cell type specific and inducible promoters for vectors in gene therapy as an approach for cell targeting. J Molecular Med-Jmm 74: 379-392.

Wang L, Hernandez-Alcoceba R, Shankar V, Zabala M, Kochanek S, Sangro B, Kramer MG, Prieto J, and Qian C (2004) Prolonged and inducible transgene expression in the liver using gutless adenovirus: a potential therapy for liver cancer. Gastroenterology 126: 278-289.

Wang L, Takabe K, Bidlingmaier SM, Ill CR, and Verma IM (1999) Sustained correction of bleeding disorder in hemophilia B mice by gene therapy. Proc Natl Acad Sci U S A 96: 3906-3910.

Watanabe Y (1980) Serial inbreeding of rabbits with hereditary hyperlipidemia (WHHL-rabbit). Atherosclerosis 36: 261-268.

Weisbroth SH (1994) Neoplastic Diseases. In: The Biology of the Laboratory Rabbit. Manning, P. J., Ringler, D. H., and Newcomer, C. E. (eds.) Chapter 12. pp. 259.

Weisgraber KH (1994) Apolipoprotein E: structure-function relationships. Adv.Protein Chem. 45: 249-302. Weisgraber KH, Bersot TP, Mahley RW, Franceschini G, and Sirtori CR (1980) A-Imilano apoprotein.

Isolation and characterization of a cysteine-containing variant of the A-I apoprotein from human high density lipoproteins. J Clin.Invest 66: 901-907.

Weisgraber KH and Mahley RW (1996) Human apolipoprotein E: the Alzheimer's disease connection. FASEB J. 10: 1485-1494.

Westgren M, Ringden O, Bartmann P, Bui TH, Lindton B, Mattsson J, Uzunel M, Zetterquist H, and Hansmann M (2002) Prenatal T-cell reconstitution after in utero transplantation with fetal liver cells in a patient with X-linked severe combined immunodeficiency. Am.J.Obstet.Gynecol. 187: 475-482.

White SJ, Nicklin SA, Buning H, Brosnan MJ, Leike K, Papadakis ED, Hallek M, and Baker AH (2004) Targeted gene delivery to vascular tissue in vivo by tropism-modified adeno-associated virus vectors. Circulation 109: 513-519.

Whitfield AJ, Barrett PH, Van Bockxmeer FM, and Burnett JR (2004) Lipid Disorders and Mutations in the APOB Gene. Clin.Chem.

Wiegman A, Rodenburg J, de Jongh S, Defesche JC, Bakker HD, Kastelein JJ, and Sijbrands EJ (2003a) Family history and cardiovascular risk in familial hypercholesterolemia: data in more than 1000 children. Circulation 107: 1473-1478.

Wiegman A, Sijbrands EJ, Rodenburg J, Defesche JC, de Jongh S, Bakker HD, and Kastelein JJ (2003b) The apolipoprotein epsilon4 allele confers additional risk in children with familial hypercholesterolemia. Pediatr.Res. 53: 1008-1012.

Wiklund O, Angelin B, Olofsson SO, Eriksson M, Fager G, Berglund L, and Bondjers G (1990) Apolipoprotein(a) and ischaemic heart disease in familial hypercholesterolaemia. Lancet 335: 1360-1363.

Willnow TE, Goldstein JL, Orth K, Brown MS, and Herz J (1992) Low density lipoprotein receptor-related protein and gp330 bind similar ligands, including plasminogen activator-inhibitor complexes and lactoferrin, an inhibitor of chylomicron remnant clearance. J.Biol.Chem. 267: 26172-26180.

Wilson JM, Chowdhury NR, Grossman M, Wajsman R, Epstein A, Mulligan RC, and Chowdhury JR (1990) Temporary amelioration of hyperlipidemia in low density lipoprotein receptor-deficient rabbits transplanted with genetically modified hepatocytes. Proc Natl Acad Sci U S A 87: 8437-8441.

Wilson JM, Grossman M, Wu CH, Chowdhury NR, Wu GY, and Chowdhury JR (1992) Hepatocyte-directed gene transfer in vivo leads to transient improvement of hypercholesterolemia in low density lipoprotein receptor-deficient rabbits. J.Biol.Chem. 267: 963-967.

Wilund KR, Yi M, Campagna F, Arca M, Zuliani G, Fellin R, Ho YK, Garcia JV, Hobbs HH, and Cohen JC (2002) Molecular mechanisms of autosomal recessive hypercholesterolemia. Hum.Mol.Genet. 11: 3019-3030.

Wolff JA and Lederberg J (1994) An early history of gene transfer and therapy. Hum.Gene Ther 5: 469-480. Wolff JA, Yee JK, Skelly HF, Moores JC, Respess JG, Friedmann T, and Leffert H (1987) Expression of

retrovirally transduced genes in primary cultures of adult rat hepatocytes. Proc.Natl.Acad.Sci.U.S.A 84: 3344-3348.

106

Wu J, Nantz MH, and Zern MA (2002) Targeting hepatocytes for drug and gene delivery: emerging novel approaches and applications. Front Biosci. 7: d717-d725.

Wu X, Li Y, Crise B, and Burgess SM (2003) Transcription start regions in the human genome are favored targets for MLV integration. Science 300: 1749-1751.

Wu X, Wakefield JK, Liu H, Xiao H, Kralovics R, Prchal JT, and Kappes JC (2000) Development of a novel trans-lentiviral vector that affords predictable safety. Mol.Ther 2: 47-55.

Xiao W, Berta SC, Lu MM, Moscioni AD, Tazelaar J, and Wilson JM (1998) Adeno-associated virus as a vector for liver-directed gene therapy. J Virol 72: 10222-10226.

Xu K, Ma H, McCown TJ, Verma IM, and Kafri T (2001) Generation of a stable cell line producing high-titer self-inactivating lentiviral vectors. Mol.Ther 3: 97-104.

Xu L, Gao C, Sands MS, Cai SR, Nichols TC, Bellinger DA, Raymer RA, McCorquodale S, and Ponder KP (2003) Neonatal or hepatocyte growth factor-potentiated adult gene therapy with a retroviral vector results in therapeutic levels of canine factor IX for hemophilia B. Blood 101: 3924-3932.

Yabe D, Brown MS, and Goldstein JL (2002) Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc.Natl.Acad.Sci.U.S.A 99: 12753-12758.

Yamada N, Inoue I, Kawamura M, Harada K, Watanabe Y, Shimano H, Gotoda T, Shimada M, Kohzaki K, and Tsukada T (1992) Apolipoprotein E prevents the progression of atherosclerosis in Watanabe heritable hyperlipidemic rabbits. J Clin Invest 89: 706-711.

Yamada N, Shimano H, Mokuno H, Ishibashi S, Gotohda T, Kawakami M, Watanabe Y, Akanuma Y, Murase T, and Takaku F (1989) Increased clearance of plasma cholesterol after injection of apolipoprotein E into Watanabe heritable hyperlipidemic rabbits. Proc.Natl.Acad.Sci.U.S.A 86: 665-669.

Yamada T, Iwasaki Y, Tada H, Iwabuki H et al. (2003) Nanoparticles for the delivery of genes and drugs to human hepatocytes. Nat.Biotechnol. 21: 885-890.

Yamamoto T, Bishop RW, Brown MS, Goldstein JL, and Russell DW (1986) Deletion in cysteine-rich region of LDL receptor impedes transport to cell surface in WHHL rabbit. Science 232: 1230-1237.

Yamamoto T, Davis CG, Brown MS, Schneider WJ, Casey ML, Goldstein JL, and Russell DW (1984) The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell 39: 27-38.

Yamanaka R (2004) Alphavirus vectors for cancer gene therapy (review). Int.J.Oncol. 24: 919-923. Yamanaka S, Balestra ME, Ferrell LD, Fan J, Arnold KS, Taylor S, Taylor JM, and Innerarity TL (1995)

Apolipoprotein B mRNA-editing protein induces hepatocellular carcinoma and dysplasia in transgenic animals. Proc.Natl.Acad.Sci.U.S.A 92: 8483-8487.

Yanay O, Barry SC, Flint LY, Brzezinski M, Barton RW, and Osborne WR (2003) Long-term erythropoietin gene expression from transduced cells in bioisolator devices. Hum.Gene Ther 14: 1587-1593.

Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R, Goldstein JL, and Brown MS (2002a) Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 110: 489-500.

Yang Y, Ballatori N, and Smith HC (2002b) Apolipoprotein B mRNA editing and the reduction in synthesis and secretion of the atherogenic risk factor, apolipoprotein B100 can be effectively targeted through TAT-mediated protein transduction. Mol.Pharmacol. 61: 269-276.

Yang Y, Ertl HC, and Wilson JM (1994a) MHC class I-restricted cytotoxic T lymphocytes to viral antigens destroy hepatocytes in mice infected with E1-deleted recombinant adenoviruses. Immunity. 1: 433-442.

Yang Y, Nunes FA, Berencsi K, Furth EE, Gonczol E, and Wilson JM (1994b) Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy. Proc Natl Acad Sci U.S.A. 91: 4407-4411.

Yant SR, Meuse L, Chiu W, Ivics Z, Izsvak Z, and Kay MA (2000) Somatic integration and long-term transgene expression in normal and haemophilic mice using a DNA transposon system. Nat.Genet. 25: 35-41.

Yarranton GT (1992) Inducible vectors for expression in mammalian cells. Curr.Opin.Biotechnol. 3: 506-511.

Ylä-Herttuala S (1997) Vascular gene transfer. Curr Opin Lipidol 8: 72-76. Ylä-Herttuala S and Martin JF (2000) Cardiovascular gene therapy. Lancet 355: 213-222.

107

Ylä-Herttuala S, Nikkari T, Hirvonen J, Laaksonen H, Möttönen M, Pesonen E, Raekallio J, and Åkerblom HK (1986) Biochemical composition of coronary arteries in Finnish children. Arteriosclerosis 6: 230-236.

Yoshida H, Hasty AH, Major AS, Ishiguro H, Su YR, Gleaves LA, Babaev VR, Linton MF, and Fazio S (2001) Isoform-specific effects of apolipoprotein E on atherogenesis: gene transduction studies in mice. Circulation 104: 2820-2825.

Young CE, Karas RH, and Kuvin JT (2004) High-density lipoprotein cholesterol and coronary heart disease. Cardiol.Rev. 12: 107-119.

Yu H, Rabson AB, Kaul M, Ron Y, and Dougherty JP (1996) Inducible human immunodeficiency virus type 1 packaging cell lines. J Virol 70: 4530-4537.

Yu KC, Jiang Y, Chen W, and Cooper AD (2000) Rapid initial removal of chylomicron remnants by the mouse liver does not require hepatically localized apolipoprotein E. J.Lipid Res. 41: 1715-1727.

Yu S, Yarnell JW, Sweetnam P, and Bolton CH (2003a) High density lipoprotein subfractions and the risk of coronary heart disease: 9-years follow-up in the Caerphilly Study. Atherosclerosis 166: 331-338.

Yu SF, von Rüden T, Kantoff PW, Garber C, Seiberg M, Rüther U, Anderson WF, Wagner EF, and Gilboa E (1986) Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells. Proc Natl Acad Sci U S A 83: 3194-3198.

Yu SS, Han E, Hong Y, Lee JT, Kim S, and Kim S (2003b) Construction of a retroviral vector production system with the minimum possibility of a homologous recombination. Gene Ther 10: 706-711.

Zabala M, Wang L, Hernandez-Alcoceba R, Hillen W, Qian C, Prieto J, and Kramer MG (2004) Optimization of the Tet-on system to regulate interleukin 12 expression in the liver for the treatment of hepatic tumors. Cancer Res. 64: 2799-2804.

Zannis VI and Breslow JL (1981) Human very low density lipoprotein apolipoprotein E isoprotein polymorphism is explained by genetic variation and posttranslational modification. Biochemistry 20: 1033-1041.

Zeh HJ and Bartlett DL (2002) Development of a replication-selective, oncolytic poxvirus for the treatment of human cancers. Cancer Gene Ther 9: 1001-1012.

Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, and Charneau P (2000) HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101: 173-185.

Zhang G, Song YK, and Liu D (2000) Long-term expression of human alpha1-antitrypsin gene in mouse liver achieved by intravenous administration of plasmid DNA using a hydrodynamics-based procedure. Gene Ther 7: 1344-1349.

Zhang SH, Reddick RL, Piedrahita JA, and Maeda N (1992) Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258: 468-471.

Zhang X, Collins L, Sawyer GJ, Dong X, Qiu Y, and Fabre JW (2001) In vivo gene delivery via portal vein and bile duct to individual lobes of the rat liver using a polylysine-based nonviral DNA vector in combination with chloroquine. Hum.Gene Ther 12: 2179-2190.

Zhao Y, Zhu L, Lee S, Li L, Chang E, Soong NW, Douer D, and Anderson WF (1999) Identification of the block in targeted retroviral-mediated gene transfer. Proc.Natl.Acad.Sci.U.S.A 96: 4005-4010.

Zufferey R, Donello JE, Trono D, and Hope TJ (1999) Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol 73: 2886-2892.

Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, and Trono D (1998) Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72: 9873-9880.