Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
Gene Technology - 2020 106 - DNA Sequencing
Peptide sequencingEdman degradation: Edman, P. et al.; (1950). "Method for determination
of the amino acid sequence in peptides". Acta Chem. Scand. 4: 283–293.
sequential labeling and cleavage of N-terminal residue withoutdisrupting peptide bond between other a.a. residues
Gene Technology - 2020 06 - DNA Sequencing 2
procedure can then be repeated again to identify the next amino acidstep-by step yield 90-95 %problems with long streches ofidentical a.a.-smaximum length: 30-50 a.a.
This approach is not suitable forsequencing nucleic acids
https://doi.org/10.3891/acta.chem.scand.04-0283
Peptide sequencer
Gene Technology - 2020 06 - DNA Sequencing 3
First generation DNA sequencing
• 3’ or 5’ P32 labeled template, strand separation
• partial, specific modification of bases,
G dimethylsulfate (N7-methylation)
Pu formic acid
Py hydrazin
C hydrazin + NaCl
cleavage of phosphodiester bond at modified bases: hot piperidin
separation of fragments by PAGE
• SV40 (5243 bp)
4Gene Technology - 2020 06 - DNA Sequencing
Does not requries previous sequence information!!!
Maxam & Gilbert method
5Gene Technology - 2020 06 - DNA Sequencing
Maxam & Gilbert method
6Gene Technology - 2020 06 - DNA Sequencing
ENZYMATIC (dideoxy) METHODFrederick Sanger 13 August 1918 – 19 November 2013 1951-52 determination of amino acid sequence of insulin
Nobel Prize in chemistry 1958: for his work on the structure of proteins, especially that of insulin
1977 DNA sequencingNobel Prize in chemistry 1980: Walter Gilbert and Sanger shared
half of the chemistry prize "for their contributions concerning the determination of base sequences in nucleic acids"
7Gene Technology - 2020 06 - DNA Sequencing
ENZYMATIC (dideoxy) METHOD
template + primer + DNA polymerase + dNTP/ddNTP ( 1 %)template: single or double stranded DNA, PCR product labeling: primer (5’, [-32P]ATP)
during polymerization ([-35S]dATP)Enzyme: Sequenase (T 7 pol), Taq pol (processivity is important)polymerization: 4 parallel reactions (four ddNTPs)electrophoresis: denaturing PAGE (3 kV, 7M urea, 70 °C)
the product is double strandedoriginal template strand interferes separation
autoradiographymanual evaluation
8Gene Technology - 2020 06 - DNA Sequencing
ENZYMATIC (dideoxy) METHOD
„Manual” sequencing
Gene Technology - 2020 906 - DNA Sequencing
ENZYMATIC (dideoxy) METHOD
Gene Technology - 2020 1006 - DNA Sequencing
Automated fluorescent sequencing
based on enzymatic method
labeling: primer or dNTP
ddNTP 4 different colors: BigDye
polymerization: cyclic sequencing
(linear template amplification)
1 primer, AmpliTaq polymerase
electrophoresis: capillary electrophoresis
synthetic polymer gel (400-700 bases)
online detection (laser)
automatic digital read-out (free software: Chromas)
ABI Prism 310, 373, 377 (PE Biosystems)
integrated sequencing systems (10 kb-1 Mb/day)
11Gene Technology - 2020 06 - DNA Sequencing
Gene Technology - 2020 1206 - DNA Sequencing
Automated fluorescent sequencing
13Gene Technology - 2020 06 - DNA Sequencing
14CHROMASGene Technology - 2020 06 - DNA Sequencing
Whole genome sequencing
• Chromosome walking / primer walking
• Requires cloning long, contiguous DNA Gene Technology - 2020 1506 - DNA Sequencing
By Commins, J., Toft, C., Fares, M. A. - "Computational Biology Methods and Their Application to the Comparative Genomics of Endocellular Symbiotic Bacteria of Insects." Biol. Procedures Online (2009).
Whole genome shotgun sequencing
Gene Technology - 2020 1606 - DNA Sequencing
Assembly of the reads
Gene Technology - 2020 1706 - DNA Sequencing
By Commins, J., Toft, C., Fares, M. A. - "Computational Biology Methods and Their Application to the Comparative Genomics of Endocellular Symbiotic Bacteria of Insects." Biol. Procedures Online (2009).
Hierachical shotgun sequencing
Gene Technology - 2020 1806 - DNA Sequencing
By Becchamm - Own work, CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=17509620
Assemblig the tiling pathend-reads: short sequences at the 5’ and 3’ ends of a DNA fragment
which are unique enough that they (theoretically) exist together only once in a genome
contig: a continuous sequence of DNA assembled from overlappingframents
scaffold:
tiling path:
Gene Technology - 2020 1906 - DNA Sequencing
Gene Technology - 2020 2006 - DNA Sequencing
Next generation sequencing
Gene Technology - 2020 2106 - DNA Sequencing
22
Margulies2005-454 Supplement
Gene Technology - 2020 06 - DNA Sequencing
http://szilagyl.web.elte.hu/SH-2020/Classical%20papers/margulies2005-454.pdfhttp://szilagyl.web.elte.hu/SH-2020/Classical%20papers/Supplement%20for%20454.pdf
Steps of the sequencing process• Generation of DNA fragments (nebulizer)
fragment size range: 50-900 bp (mean: 325 bp) fragments blunt-ended and phosphorylated (polishing)T4 DNA polymerase, E. coli DNA polymerase (Klenow fragment),T4 polynucleotide kinase
• Ligation of adapters – binding to beads and sequencing oligogeneration single strands with different sequences at the endsone end allows annealing to complementary oligos immobilized on beadsother end binds sequencing oligo
• Emulsion PCR for amplification on the beads
• Sequencing by synthesis in picoliter volume well
• Lumimetric detection of pyrophosphate release
23Gene Technology - 2020 06 - DNA Sequencing
24
• DNA Capture Beads
• N-hydroxysuccinimide ester (NHS)-activated
Sepharose HP
• (5’-Amine-hexa-ethyleneglycol spacers
CCATCTGTTGCGTGCGTGTC-3’)
• hybridization at limiting dilution (A seq.)
only ONE copy of DNA/bead
• Amplification in emulsion (ePCR)
• 0.625 µM forward (complemenary to B)
(5’ - CGTTTCCCCTGTGTGCCTTG-3’)
• 0.039 µM reverse (complemenary to A)
(5’-CCATCTGTTGCGTGCGTGTC-3’)
• „asymmertic” PCR – reverse oligo bound to beads!
ONE MILLION copies/bead
Ligation of different adapters to the ends of fragment
A: CCATCTGTTGCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG
B: /5BioTEG/CCTTTCCCCTGTGTGCCTTGCCTATCCCCTGTTGCGTGTCTCAG
Gene Technology - 2020 06 - DNA Sequencing
Avidin / Streptavidin
Steps of the sequencing process• Generation of DNA fragments (nebulizer)
fragment size range: 50-900 bp (mean: 325 bp)
fragments blunt-ended and phosphorylated (polishing) T4 DNA polymerase, E. coli DNA polymerase (Klenow fragment) T4 polynucleotide kinase
• Ligation of adapters – binding to beads and sequencing oligogeneration single strands with different sequences at the endsone end allows annealing to complementary oligos immobilized on beads
other end binds sequencing oligo
• Emulsion PCR for amplification on the beads
• Sequencing by synthesis in picoliter volume well
• Lumimetric detection of pyrophosphate release
25Gene Technology - 2020 06 - DNA Sequencing
Emulsion PCR• Amplification mix contains
– dNTP, buffer, forward and reverse primer
– Hi-Fi Taq polymerase, thermostable pyrophosphatase
– 1.5 M DNA capture beads – containing single template chain
• Formation of water in oil emulsion
• PCR reaction: amplification 40 cycle
• Breakage of the emulsion
• Second-strand removal, enrichment of beads
Gene Technology - 2020 06 - DNA Sequencing 26
Preparation for sequencing
• 44 mm in diameter
• 55 mm in depth
• 75 pl
• 480 wells/mm2
• 1.6 million wells
27
DNA capture beads (25 mm) containingannealed sequencing primer + Bst DNA Polymerase Large Fragment + SSB protein
Dynal enzyme beadsUltraGlow Luciferase and Bst ATP sulfurylasewere prepared as biotin carboxyl carrier protein (BCCP) fusions
Gene Technology - 2020 06 - DNA Sequencing
PicoTiterPlate
Pyrosequencing• Bases (TACG) are flown sequentially and always in the same
order (100 times for a large FLX run) across the PicoTiterPlateduring a sequencing run
• An incorporated nucleotide complementary to the template strand generates pyrophosphate.
• A coupled enzyme reaction transforms PPi to ATP
• Firefly luciferase is a light-emitting enzyme catalyses the oxidation of firefly luciferin, requiring oxygen and ATP.
• The light signal is recorded by the CCD camera
• The signal strength is proportional to the number of nucleotide incorporated
Gene Technology - 2020 06 - DNA Sequencing 28
Gene Technology - 2020 06 - DNA Sequencing 29
Principle of pyrosequencing
Gene Technology - 2020 06 - DNA Sequencing 30
Apyrase added after each cycle
dATP is also a substrate for luciferase
Adventages of Roche 454
• long read lengths (700 bp)
• fast operation
• high accuracy
Disadvantages of Roche 454
• error rate increases with theincrease of the length ofpolybase
• high cost
• low throughput
• low scalability
Gene Technology - 2020 06 - DNA Sequencing 31
production discontinued in October 2016
Life Technologies - Ion torrentsequencing
32
Ion torrent
Gene Technology - 2020 06 - DNA Sequencing
../Videos/Ion Torrent next-gen sequencing technology - YouTube.mp4
Life Technologies - Ion torrentsequencing
• Sample preparation similar to 454 – based on PCR amplification
• Sequencing by synthesis – sequential additon of dNTP-s
• detection of released H+ - CMOS transformed into miniaturepH meter
33
Ion torrent
Gene Technology - 2020 06 - DNA Sequencing
../Videos/Ion Torrent next-gen sequencing technology - YouTube.mp4
Sequencing by ligation – AppliedBiosystems
Gene Technology - 2020 06 - DNA Sequencing 34
Sequencing by ligation – Applied BiosystemsLigation of adapter sequences
Hybridization to beads
Emulsion PCR
Remove empty beads
Beads are attached to glass plate
Gene Technology - 2020 3506 - DNA Sequencing
Sequencing by ligationComponents of the sequencing reactions1. Template (PCR amplified on the beads)
2. Primers complementary to P1
3. 8 nt long probes with dye at 5’ end
4. Ligase
Structure of the probes (16 altogether)
Color coding of 16 probes
Gene Technology - 2020 3606 - DNA Sequencing
Sequencing by ligationComponents of the sequencing reactions1. Template (PCR amplified on the beads)
2. Primers complementary to P1
3. 8 nt long probes with dye at 5’ end
4. Ligase
Structure of the probes (16 altogether)
Color coding of 16 probes
Gene Technology - 2020 3706 - DNA Sequencing
Steps in sequencing by ligation
1. Primer binds to templatestrands
2. Probe hybridization and ligation
3. Fluorescence measurement
4. Dye end (3) nucleotidescleaved (phosphorothioate; silver or mercury salt)
5. Steps 1-4 repeated 6+ times
6. The synthesized strandswashed away
Process completed 5 times, each time newprimer - offset by -1 base
Gene Technology - 2020 3806 - DNA Sequencing
Sequencing by ligation
After 5 ligation cycle we have information on every 5th base!
Repeat the process 4 times, with primers offset by 1 base:
Gene Technology - 2020 3906 - DNA Sequencing
Data analysis
We know that the last base of P1 adapter is TThe first base of probe ligated in the 2nd roud (n-1) must be complementary to T = A
The first read of probe n-1 is orange
If first base A and color is orange: second base of the probe is G
The first base of the template is C
A base and a color define the next base in the sequence!SoLiD
Gene Technology - 2020 4006 - DNA Sequencing
../Videos/SOLiD DNA Sequencing.mp4
Pacific Biosciences - SMRT
Gene Technology - 2020 06 - DNA Sequencing 41
Pacific Biosciences - SMRT
• Single molecule real time sequencing
• Phospholinked fluorescent nucleotides – polymerase cleavesoff label
• Zero Mode Waveguide – nanophotonic visualization chamber– illuminated volume 20 zeptoliter (10-21)
• single polymerase molecule bound to the bottom ofthechamber - real time sequence reading
• Possibility to detect methylated bases
42
SMRT
Gene Technology - 2020 06 - DNA Sequencing
../Videos/Single Molecule Real Time Sequencing - Pacific Biosciences - YouTube.mp4
Pacific Biosciences - SMRT
43Gene Technology - 2020 06 - DNA Sequencing
Epigenetic analysis by SMRT
Gene Technology - 2020 4406 - DNA Sequencing
Helicos - tSMS
45Gene Technology - 2020 06 - DNA Sequencing
Helicos - tSMS• True single molecule sequencing – no PCR amplification
• Immobilized oligoT on chip
• polyA tailing of fragmented (~100 -200 base) DNA – last A fluorescent
• Polymerization using virtual terminator nucleotides
• Paralell reading billions ofsequences
• One day – 1000 $ genome
• Bankruptcy in 2012
46Gene Technology - 2020 06 - DNA Sequencing
• Q1 pyrophosphatase???
• A1
• Q2 how to get rid of empty beads?
• A2
• DROPLET DIGITAL PCR VIRTUAL SYMPOSIUM, 5 NOVEMBER 2020
• Live from 11:00-17:00 CETBio-Rad’s Droplet Digital PCR System provides ultrasensitive and absolutenucleic acid quantification. This breakthrough technology is particularlyuseful for low-abundance targets, targets in complex backgrounds, allelicvariants (SNPs), and for monitoring subtle changes in target levels thatcannot be detected with real-time PCR.
• https://bio-rad.vfairs.com/en/#droplet-digital
Gene Technology - 2020 06 - DNA Sequencing 47
https://bio-rad.vfairs.com/en/
Illumina sequencing
Illumina
Gene Technology - 2020 4806 - DNA Sequencing
../Videos/Illumina Sequencing by Synthesis (Now in 3D).mp4
Illumina sequencing
Ligation of different adaptors to endsof DNA fragments (150-200 bp)
Attachment to flowcell
Bridge amplification
Cluster formation
Sequencing with virtualterminator nucleotides
In one cycle 4 bases are addedtogether
After each cycle detection at4 channels
Illumina
Gene Technology - 2020 4906 - DNA Sequencing
../Videos/Illumina Sequencing by Synthesis (Now in 3D).mp4
Base reading in Illumina sequencer
Gene Technology - 2020 5006 - DNA Sequencing
4-channel base detection
Simplified base detection
• Rather than a separate dye for each base, 2-channel SBS uses a mix of dyes. Images are taken of each DNA cluster using red and green wavelength filter bands
• Clusters seen in red or green images are interpreted as C and T bases, respectively. Clusters observed in both red and green images are flagged as A bases (appearing as yellow clusters), while unlabeled clusters are identified as G bases.
Gene Technology - 2020 06 - DNA Sequencing 51
Illumina
Gene Technology - 2020 5206 - DNA Sequencing
Gene Technology - 2020 06 - DNA Sequencing 53
Oxford Nanopore Technologies
Nanopore Sequencing
Gene Technology - 2020 5406 - DNA Sequencing
Introduction to nanopore sensing
A nanopore: a nano-scale hole.
• Biological: a pore-forming protein (e.g. α-Hemolysin) in a membrane (e.g. lipid bilayer)
• Solid-state: in synthetic materials ( e.g. silicon nitride or graphene)
• Hybrid: formed by a pore-forming protein set in synthetic material
Gene Technology - 2020 5506 - DNA Sequencing
Nanopore sensing
•Disruption in current detected when analyte passes through the pore or near its aperture.
•Characteristic disruption indentifies the molecule in question.
Ionic current passed through membrane by setting a voltage across the membrane.
Gene Technology - 2020 5606 - DNA Sequencing
Nanopore DNA sequencing
• Strand sequencing:
– Sequencing in real-time as the intact DNA polymer passes through the nanopore.
• Exonuclease sequencing:
– Individual nucleotides pass through the nanoporeby the aid of processive exonuclease.
Oxford
Gene Technology - 2020 5706 - DNA Sequencing
../Videos/Movies - News - Oxford Nanopore Technologies.mp4
Oxford Nanopore
Gene Technology - 2020 06 - DNA Sequencing 58
Strand Sequencing
Snapshot from movie at http://www.nanoporetech.comGene Technology - 2020 5906 - DNA Sequencing
Electron-based read out
Four different magnitudes of disruption which can be classified as C, G, A or T
Modified base, e.g. methylatedcytosine, can be directly distinguished from the four standard bases
Gene Technology - 2020 6006 - DNA Sequencing
Strand Sequencing
Snapshot from movie at http://www.nanoporetech.com
▪ Hairpin structure:
▪Sense and anti-sense sequencing
▪Advantages in Data Analysis
Gene Technology - 2020 6106 - DNA Sequencing
Exonuclease Sequencing
Snapshot from movie at http://www.nanoporetech.comGene Technology - 2020 6206 - DNA Sequencing
Exonuclease Sequencing
Snapshot from movie at http://www.nanoporetech.com
▪ Adapter molecule (cyclodextrin):
• Accuracy averaging 99.8%
• Identification of meC
Gene Technology - 2020 6306 - DNA Sequencing
Peptide sequencingEdman degradation: Edman, P. et al.; (1950). "Method for determination
of the amino acid sequence in peptides". Acta Chem. Scand. 4: 283–293.
sequential labeling and cleavage of N-terminal residue withoutdisrupting peptide bond between other a.a. residues
Gene Technology - 2020 06 - DNA Sequencing 64
procedure can then be repeated again to identify the next amino acidstep-by step yield 90-95 %problems with long streches ofidentical a.a.-smaximum length: 30-50 a.a.
This approach is not suitable forsequencing nucleic acids
https://doi.org/10.3891/acta.chem.scand.04-0283
Working strategy
• GridION system
– Uses single-use, self-contained cartridge.
– Can be used as a single instrument: Node
– Can be used in a cluster, connected through network.
– Low power and space required.
Gene Technology - 2020 6506 - DNA Sequencing
Working strategy
• MinION: a miniaturised sensing instrument
– Portable.
– Field-deployable.
– Requires minimal sample prep.
– Compatible with blood serum, plasma and whole blood.
MinION
Gene Technology - 2020 6606 - DNA Sequencing
../Videos/MinION_ A Portable, Real-Time DNA_RNA Sequencing Device.mp4
Workflow versatility
• No fixed run time
– Can be run one or more nodes for minutes or days.
– Data analysis takes place in real time.
– Longer run enables collecting more data points.
• Run until... sufficient data
– The GridION system enables users to run an experiment until sufficient data has been collected to reach a predetermined experimental endpoint.
Gene Technology - 2020 6706 - DNA Sequencing
Advantages over present sequencing technologies
• No need for expensive and time-consuming mate pair library construction.
• Real-time sequencing strategy.
• No strand amplification needed.
• No bias due to sequencing amplification.
• Low cost: trying to fulfil the target of $1000 per human genome.
• Lager read size: read size is limited only by preparation.
• No requirement for large amounts of high-performance disk storage.
• Large-scale structural variation can be detected at lower depth of coverage.
• Enable long-range haplotyping.
Gene Technology - 2020 6806 - DNA Sequencing
Gene Technology - 2020 6906 - DNA Sequencing
Single cell sequencing
Gene Technology - 2020 06 - DNA Sequencing 70