Upload
zola
View
55
Download
0
Tags:
Embed Size (px)
DESCRIPTION
Gene knockout. Lecturer : Du Shengyang January 24 2013. Minimum genome Based on a kind of ideal hypothesis It a ssume that cells contain a minimal gene set Under the condition of the gene set to maintain normal life functions reduced genome - PowerPoint PPT Presentation
Citation preview
Gene knockout
Lecturer: Du ShengyangJanuary 24 2013
Minimum genomeBased on a kind of ideal hypothesisIt assume that cells contain a minimal gene setUnder the condition of the gene set to maintain normal life functions
reduced genomeGradually eliminate nonessential gene sequence
The significance of gene knockout
Gene knockout can reduce the redundancy of biological system
Identify specific essential genes
Improve metabolic efficiency
Controllability and predictability higher
nonessential genes and sequences recombinogenic or mobile DNA and cryptic virulence genes gene cluster related to different secondary metabolites synthesis IS sequence Redundancy sequence
The common method
1、 homologous recombination
2、 Insertion mutation
3、 RNAi
Red recombination 1.red and Sce I cutting 2.Two step to Red recombination
Cre-LoxP System LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT ATAACTTCGTATA TATTGAAGCATAT
Cre
Target geneLoxP
a novel Bacillus subtilis strain,MBG874,depleted of 874 kb (20%) of the genomic sequence
productivity of extracellular cellulase and protease from transformed plasmids harboring the corresponding genes is remarkably en-hanced
a new genetic strategy based on the Cre-loxP recombination system to generate large chromosomal rearrangements in Lac-tococcus lactis.
The Cre-loxP recombination system described can potentially be used for other gram-positive bacteria without further modi-fication.
Chromosomal inversions in Lactocoaal
All inversions have an effect on the cell fitness compared to thatassociated with the corresponding isogenic parental structure,with a decrease in growth rate ranging from 8 to 18% dependingon the extent of the chromosome disorganization it can potentially be used for generating rearrangements in any region of the bacterial chromosome.
It will be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies.
MG1655 red(KmR) rpsL hsdR::ApR
These criteria are described in PEC database nonessential genes is 29.7% (1.38 Mb).
The construction of deletion units by theCRS cassette method Using P1 phage integrates "deletion unit" in the MG1655 rpsL
MG1655 Deleting the largest K-islands of E.coli an 0.38Mb(8.1%) reduced genome size
comparing the genomes of MG1655and EDL933plasmid pSG76-CS.by PCR carrying a selectable marker [CmR] two I-SceI siteshelper plasmid pBADαβγ integrated the linear fragment into their chromosomeplasmid pSTKST delete insert segments
MG1655 IS sequence, transposase, defect
phage and integration enzyme all movable component size 0.71
Mb (15.27%)
Compare genome information of MG1655 with other five e. coli strains and knock out the gene fragments only exist in the MG1655 、 use red reorganization system of the phage λ to knock out the target segment
W3110ΔrecBCD::Plac-bet
exo kan
Confirm nonessential area and translocation genes, IS sequence by comparative genome
comparing the genomes of W3110and Buchnera sp.compare PEC and ERGO database determine the knock out areause red reorganization system of
the phage λ
B.subtilis GB469
Gain 11 nonessential gene cluster by prediction and experimental verification
Using the upp-cassette and 5-FU screening method,it choose the area that a single gene knockout does not affect cell growthgene knock out gradually
Our subject
Confirm the target that can be deleted
In other hand, we can not affect the bacteria growth and nisin synthetic
Using some Gene knockout techniques deletes IS sequence and gene cluster related to secondary metabolites synthesis.(upp or Cre-loxP )
Experimental verification and analysis