Copyright � 2009 by the Genetics Society of AmericaDOI: 10.1534/genetics.109.105569

Gene Duplication and Hypermutation of the Pathogen Resistance GeneSNC1 in the Arabidopsis bal Variant

Hankuil Yi1 and Eric J. Richards2

Department of Biology, Washington University, St. Louis, Missouri 63130

Manuscript received May 28, 2009Accepted for publication August 29, 2009

ABSTRACT

The bal defect in the Arabidopsis thaliana Columbia strain was spontaneously generated in an inbred ddm1(decrease in DNA methylation 1) mutant background in which various genetic and epigenetic alterationsaccumulate. The bal variant displays short stature and curled leaves due to the constitutive activation ofdefense signaling. These bal phenotypes are metastable and phenotypic suppression is evident in more thanone-third of ethyl methanesulfonate (EMS)-treated bal M1 plants. The semidominant bal allele maps to theRPP5 (recognition of Peronospora parasitica 5) locus, which includes a cluster of disease Resistance (R) genes,many of which show an increase in steady-state expression levels in the bal variant. Here, we report thatactivation of RPP5 locus R genes and dwarfing in the bal variant are caused by a 55-kb duplication within theRPP5 locus. Although many RPP5 locus R genes are duplicated in the bal variant, the duplication of SNC1alone is necessary and sufficient for the phenotypic changes in the bal variant. Missense mutations in theSNC1 gene were identified in all three phenotypically suppressed EMS-treated bal lines investigated,indicating that the high-frequency phenotypic instability induced by EMS treatment is caused by a geneticmechanism. We propose that the high degree of variation in SNC1-related sequences among Arabidopsisnatural accessions follows the two-step mechanism observed in the bal variant: gene duplication followed byhypermutation.

GENE duplication plays an important role in ex-panding the repertoire of the genome. Immedi-

ately after duplication the two gene copies are expectedto be functionally equivalent, leading to reduced se-lection on one copy and an opportunity for subsequentspecialization (i.e., sub- or neo-functionalization). Thismodel is supportedbyLynch and Conery’s (2000) studyof genomic sequences from different eukaryotes dem-onstrating that most duplicated protein-coding genecopies experience an initial period of relaxed selectionduring which time mutations accumulate consistentwith the expectations of neutrality (Lynch and Conery

2000). However, some exceptions to this general trend inwhich nonsynonymous mutations within newly dupli-cated genes immediately predominate over silent mu-tations were observed. We describe here a molecularsnapshot of a coupled gene duplication-hypermutationevent involving plant disease Resistance or R genes thatcan generate such exceptional evolutionary geneticsignatures.

R genes encode proteins that recognize, either di-rectly or indirectly, plant pathogen components and

modulate defense-signaling pathways (Belkhadir et al.2004). Many Resistance proteins contain conserved do-mains, including Toll/Interleukin1 Receptor, nucleotide-binding site (NBS), and leucine-rich repeat (LRR) motifs,and paralogous genes encoding these proteins are oftenfound in clusters within the genome resulting from localtandem duplications (Martin et al. 2003). The Arabidop-sis RPP5 (for recognition of Peronospora parasitica 5) locus isan example of an R-gene cluster (Noel et al. 1999) thatcontains at least two functional genes (Parker et al. 1997;van der Biezen et al. 2002; Zhang et al. 2003) and severaladditional paralogs, many of which may also function inplant defense signaling (Meyers et al. 2003) (supportinginformation, Figure S1). RPP5 locus R genes can be co-ordinately regulated both positively and negatively. Posi-tive transcriptional activation is mediated through theupregulation of SNC1 (SUPPRESSOR OF NPR1-1, CONSTI-TUTIVE 1) (Li et al. 2007; Yi and Richards 2007), whilenegative regulation by RNA silencing with small interfer-ing RNA species targets multiple RPP5 locus R genes (Yi

and Richards 2007).Mutant screens in the Arabidopsis strain Columbia

have recovered three mutations—cpr1, bal, and snc1—thatmap to the RPP5 locus and display similar yet distinctdwarfism and curled-leaf phenotypes (Bowling et al.1994; Li et al. 2001; Stokes et al. 2002; Stokes andRichards 2002). These RPP5 locus mutants exhibitconstitutive expression of downstream pathogen defense

Supporting information is available online at http://www.genetics.org/cgi/content/full/genetics.109.105569/DC1.

1Present address: Donald Danforth Plant Science Center, St. Louis, MO63132.

2Corresponding author: Boyce Thompson Institute for Plant Research,Tower Rd., Ithaca, NY 14853. E-mail: ejr77@cornell.edu

Genetics 183: 1227–1234 (December 2009)

genes that lead to reduced fitness in both vegetativegrowth and reproduction (Bowling et al. 1994; Clarke

et al. 2001; Li et al. 2001; Stokes et al. 2002; Zhang et al.2003; Heidel et al. 2004). Several reports suggest thatupregulation of SNC1 and possibly other RPP5 locusR genes is responsible for the phenotypic and geneexpression changes in these mutants (Stokes et al. 2002;Yang and Hua 2004; Yi and Richards 2007, 2008).Unlike the snc1 mutation, a high incidence of pheno-typic instability is induced for the bal and cpr1 mutationsafter mutagen treatment or genetic interaction in bal 3

cpr1 or cpr1 3 snc1 F1 hybrids (Stokes et al. 2002; Stokes

and Richards 2002; Zhang and Li 2005; Yi andRichards 2008). A gain-of-function missense mutationresults in SNC1 activation in the snc1 mutant (Zhang

et al. 2003). However, the molecular changes corre-sponding to the bal or cpr1 mutations and the mecha-nisms responsible for the phenotypic instability of thesetwo alleles have not been elucidated.

Here, we report that a 55-kb region, including all theR genes in the RPP5 locus except RPP4, is tandemlyduplicated in the metastable bal variant. Our resultsdemonstrate that a duplication of SNC1 in the bal variantis responsible for the development of morphologicalphenotypes and leads to activation of multiple RPP5locus R genes. In addition, we show that the high levelof phenotypic instability in the bal variant is caused notby an epigenetic mechanism but by hypermutation ofSNC1, upregulation of which is necessary and sufficientfor the development of bal phenotypes. Our studyprovides an example of a two-step mechanism by whichpolymorphic R-gene clusters evolve: R-gene clusterexpansion via unequal crossing over, followed by hyper-mutation of duplicated R genes.

MATERIALS AND METHODS

Plants and growth conditions: The bal (Stokes et al. 2002),cpr1 (Bowling et al. 1994), snc1 (Li et al. 2001; Zhang et al.2003), and snc1-r1 (Zhang et al. 2003) mutants were previouslydescribed. Salk transfer DNA (T-DNA) insertional mutantswere obtained from the Arabidopsis Biological ResourceCenter at The Ohio State University, and homozygous mutantlines for individual RPP5 locus R genes were identified with thePCR-based method as previously suggested (Alonso et al.2003). All plants were grown in soil in a growth chamber underlong-day conditions (16 hr light and 8 hr dark) as describedpreviously (Stokes et al. 2002).

Nucleic acid isolation and analysis: Genomic DNA wasisolated by the urea lysis miniprep protocol (Cocciolone andCone 1993). Total RNA and low-molecular-weight-enrichedRNA were isolated from aerial parts of 2-week-old plants usingthe TRIzol reagent (Invitrogen) and mirVana miRNA isolationkit (Ambion), respectively. Protocols for DNA gel blot analysisand small RNA gel blot analysis were previously described( Jeddeloh et al. 1998; Yi and Richards 2007). Templates forprobes used in gel blot analyses were either PCR products oroligonucleotides. Copy numbers and steady-state expressionlevels of RPP5 locus R genes were compared using quantitativereal-time PCR, as described previously (Yi and Richards

2007). The Big Dye V1.1 Terminator Cycle Sequencingmethod (Applied Biosystems) was used to determine thenucleotide sequence of SNC1. Information on the oligonucle-otide primers and TaqMan probes (Applied Biosystems) usedin this study is included in Table S1.

RESULTS

Null alleles of SNC1 suppress the semidominantphenotypes of the bal allele: Previously, we showed thatSNC1 is upregulated in the bal variant and that trans-genic overexpression of SNC1 is sufficient for theinduction of bal-like phenotypes (dwarf stature andcurled leaf) (Stokes et al. 2002). However, our sub-sequent study found that other RPP5 locus R genes,including RPP4, are also upregulated in the bal variant(Yi and Richards 2007). This finding made it unclearwhether overexpression of SNC1, rather than anotherR gene or genes in the locus, is necessary for thedevelopment of phenotypes in the bal variant (van der

Biezen et al. 2002; Zhang et al. 2003). To determinewhich R gene is required for the bal phenotypes, we tookadvantage of the dosage-dependent phenotypes of thebal allele (Kakutani et al. 1996; Stokes et al. 2002).Morphological phenotypes and R-gene expression levelsare intermediate in heterozygous bal plants (BAL/bal) inthe Columbia background compared to wild-type (BAL/BAL) and homozygous bal plants (bal/bal) (Stokes et al.2002). However, Columbia/Landsberg interstrain F1

hybrids carrying one copy of the bal allele are pheno-typically normal in body size and leaf morphology(Kakutani et al. 1996). Considering that R genes inthe Landsberg RPP5 locus are quite diverged from thosein the Columbia RPP5 locus (Noel et al. 1999), wereasoned that the expression level of a specific R gene orgenes in the Columbia strain falls below a threshold levelin the interstrain F1 hybrids, and consequently theseplants show a wild-type morphology (Stokes et al. 2002).We predicted that a loss-of-function allele in the specificR gene required for the development of characteristicbal phenotypes would act as a dominant suppressor ofthe bal phenotypes, depending on the expression levelof this gene.

We tested whether a specific RPP5 locus R gene isrequired for the bal phenotypes by analyzing thephenotypes of F1 plants containing a bal allele anddifferent T-DNA insertional null alleles of individualRPP5 locus R genes in the Columbia background(Figure S1) (Alonso et al. 2003). We found that twoindependent T-DNA insertional null alleles of SNC1(Yang and Hua 2004) acted as dominant suppressors ofbal phenotypes in F1 plants (Figure 1). Suppression of balphenotypes in F1 hybrids by snc1 null alleles was furtherconfirmed by the use of a third SNC1 null allele, snc1-r1(Zhang et al. 2003), that has a small deletion in thecoding sequence of SNC1. In contrast, T-DNA lines withindividual disruptions in each of the other R genes in

1228 H. Yi and E. J. Richards

the locus produced F1 hybrids with an intermediatephenotype indistinguishable from heterozygous bal mu-tants (BAL/bal) (Figure 1). These results indicate thatSNC1 is necessary for the development of bal phenotypeswhile other R genes in the locus are dispensable. Takentogether with our previous results showing that trans-genic overexpression of SNC1 can induce bal-like phe-notypes, we conclude that SNC1 is the only R gene in theRPP5 locus whose overexpression is necessary andsufficient for the phenotypic development of the balvariant (Stokes et al. 2002; Yi and Richards 2007).

The copy number of SNC1 is increased in the balvariant: Although overexpression of SNC1 can explainthe development of bal phenotypes and locus-wideactivation of RPP5 locus R genes in the bal variant, nonucleotide sequence changes are present in the 7-kbregion covering the entire coding sequence and theputative promoter of SNC1 (Stokes et al. 2002; Yi andRichards 2007). On the basis of these results and theinstability of the bal allele, we previously proposed thatan epigenetic alteration at the RPP5 locus is responsiblefor the upregulation of SNC1 in the bal variant (Stokes

et al. 2002; Stokes and Richards 2002). We examinedthe SNC1 gene in the bal variant for hallmarks ofalternative epigenetic states, including differential cy-tosine methylation, small RNA accumulation, andhistone modifications. We found that the promoterregion of SNC1 is largely free from cytosine methylationin both wild-type and bal plants (data not shown),

consistent with results from genomewide cytosine meth-ylation profiling for wild-type Columbia strain plants(Zhang et al. 2006; Cokus et al. 2008). In addition, wedid not find any significant decrease in the accumula-tion of small RNA species that could negatively regulateRPP5 locus R genes in the bal variant (Figure S2).Chromatin immunoprecipitation (ChIP) experimentsdemonstrated that the SNC1 coding region was associ-ated with chromatin containing histone H3 lysine 4trimethylation in both wild-type plants and the balvariant (data not shown), consistent with a transcrip-tionally active state in both genotypes.

Our search for the molecular basis of the bal defectshifted back to genetic alterations on the basis of theresults from control samples in our ChIP analysis.Specifically, we noted a stronger amplification of theSNC1 coding sequence when the input DNA from the balvariant was compared to that from wild-type samplesafter normalization for amplification of sequences out-side of the RPP5 locus. This finding prompted us toconduct DNA gel blot hybridization experiments toinvestigate whether SNC1 is present at an elevated copynumber in the bal variant, leading to enhanced tran-scription of SNC1 mRNA. In the bal variant, moreintense hybridization signals were observed for restric-tion fragments that cover the entire coding sequence ofSNC1 (Figure S3). DNA gel blot results using SNC1 or anAt4g16950 probe, which cross-hybridizes to other RPP5locus R genes, suggested that many other R genes in theRPP5 locus are also duplicated along with SNC1 in the balvariant (Figure S3 and Figure S4). However, no signifi-cant change in copy number was observed for RPP4 orfor At4g16970, a non-R gene in the RPP5 locus. Using aquantitative real-time PCR method and genomic DNAtemplates, we measured how many extra copies of SNC1and At4g16950 are present in the bal variant. Bycomparing the copy number of SNC1 or At4g16950 tothat of RPP4 in wild-type and bal plants, we found thatone extra copy of SNC1 and At4g16950 is present in thebal haplotype (Figure 2).

Figure 1.—Null alleles of SNC1 can suppress the pheno-types of the bal allele in F1 hybrids. (A) Phenotypes of siblingplants with different numbers of bal alleles. BAL/BAL: wild-type plants with no bal allele. BAL/bal: heterozygous bal plantwith one bal allele. bal/bal: homozygous bal plant with two balalleles. (B) Phenotypes of F1 hybrid plants. Homozygous mu-tant alleles in female and male parents are indicated beforeand after the ‘‘X,’’ respectively. Null alleles of R genes inthe RPP5 locus obtained from the Salk T-DNA insertional linecollection are shown in Figure S1. rpp4: Salk_017569, snc1-11:Salk_047058, at4g16900: Salk_034491.

Figure 2.—Both SNC1 and At4g16950 are duplicated in thebal variant. Using quantitative real-time PCR, the copy num-bers of SNC1 (A) and At4g16950 (B) were compared to thatof RPP4, whose copy number is not altered in the bal variant.gSNC1/gRPP4 and gAt4g16950/gRPP4 are amplification ratiosof SNC1 and At4g16950, respectively, relative to RPP4 when ge-nomic DNA was used as template. BAL: wild-type plants. bal:bal/bal homozygotes.

R-Gene Duplication and Hypermutation 1229

A 55-kb region in the RPP5 locus, covering SNC1 andfive additional R genes, is tandemly duplicated in thebal variant: We next determined the genomic organiza-tion of the duplicated RPP5 locus R genes. On the basisof genomewide phylogenetic analyses of ArabidopsisR genes, it was proposed that many of NBS–LRR classR genes, including those in RPP5 locus R genes, weregenerated by tandem duplication (Baumgarten et al.2003; Meyers et al. 2003; Cannon et al. 2004). Becauseour genetic mapping results for the bal allele showedthat the duplicated copy of SNC1 is tightly linked to theRPP5 locus, we hypothesized that the duplicated seg-ment of the RPP5 locus is tandemly located within thenative RPP5 locus (Kakutani et al. 1996; Stokes et al.2002). First, we delimited the centromere-proximalboundary of the duplicated segment of the RPP5 locusbetween RPP4 (not duplicated in the bal variant) andAt4g16880 (duplicated in the bal variant) through theidentification of a restriction fragment length poly-morphism using DNA gel blot analysis (Figure 3A).Armed with information on the approximate location ofthe centromere-proximal duplication breakpoint, weused PCR to narrow down the position of the telomere-proximal breakpoint. We found that we could amplify aproduct from the bal variant, but not wild-type plants,using a primer (R) located in the promoter region ofRPP4 facing toward the centromere and a secondprimer (F) located in the coding region of At4g16950facing toward the telomere (Figure 3, B and C).Sequence analysis of the telomere-proximal duplica-tion boundary revealed that the entire first exon ofAt4g16960 is fused to the promoter sequence of RPP4, aresult of an apparent homologous recombination eventwithin an 186-bp region with 100% identity shared

between RPP4 and At4g16960 (position �14 to 1171relative to the translational start codon) (Figure S5). Weconfirmed the structure of the duplication border in thebal variant using DNA gel blot analysis with a hybridiza-tion probe that spans the putative breakpoint anddetected the predicted 2-kb BclI restriction fragmentspecifically in bal but not in wild-type plants (Figure 3D).We ruled out the possibility of large DNA rearrange-ments inside the duplicated region because the sizes ofthe PacI and SwaI restriction fragments detected in ourDNA gel blot analyses of the bal variant were consistentwith a simple tandem duplication. These data indicatethat a contiguous 55-kb segment extending from thepromoter region of RPP4 to the first exon of At4g16960is tandemly duplicated in the bal variant.

Expression levels of RPP5 locus R genes arepositively correlated with SNC1 copy number: Weinvestigated whether the steady-state expression levelsof RPP5 locus R genes in the bal variant are affected bySNC1 copy number, as is the case for the phenotypes inthe bal variant. To this end, we used quantitative real-time–PCR to compare the expression levels of SNC1,RPP4, and At4g16950 in wild-type plants (BAL/BAL),heterozygous bal plants (BAL/bal), and hemizygous F1

plants (bal/�) generated by crossing a snc1 null mutantand the bal variant. The copy numbers of SNC1, RPP4,and At4g16950 differ among these genotypes (Figure 4),allowing us to assess the contributions of varying SNC1copy numbers relative to that of other R genes in thelocus. We found that both SNC1 and RPP4 were lessstrongly expressed in the F1 hemizygous compared toheterozygous bal plants (Figure 4, B and C). In contrast,comparable levels of expression were observed in wild-type and F1 plants, both of which contain two copies of

Figure 3.—Many RPP5locus R genes, includingSNC1, are tandemly dupli-cated in the bal variant.(A) DNA gel blot analysisshowed that At4g16880 isduplicated in the bal vari-ant. The restriction frag-ment detected by theAt4g16880 probe in a wild-type plant is marked by anasterisk. An extra band de-tected with the At4g16880probe in the bal variant ismarked with a plus symbol(1). The positions of re-striction fragments in the

bal haplotype are indicated with bars marked with the asterisk and plus labels in panel C. BAL: wild-type plant. bal: bal variant.(B) PCR amplification demonstrated that the sequence in the promoter region of At4g16860 (RPP4) is located upstream of theAt4g16950 coding sequence in the bal variant. The positions of the primers used in the PCR reaction are shown with arrowheadsand labeled ‘‘F’’ and ‘‘R’’ in panel C. The arrowheads are pointing to the 39-ends of primers. (C) Organization of RPP5 locus Rgenes in wild-type plants and the bal variant. The regions duplicated in the bal variant are indicated by two thick bars above theRPP5 locus R genes in the bal variant. A bar labeled with double pluses (11) shows the position of the polymorphic band detectedin D. Note that only the BclI sites that generated the polymorphic restriction fragment in D are shown. (D) DNA gel blot result thatdetected the predicted 2-kb band marked with ‘‘11’’ in the bal variant.

1230 H. Yi and E. J. Richards

SNC1. The higher steady-state expression level of RPP4observed in the heterozygous bal plants, which containthree copies of SNC1, can be explained by transcrip-tional activation of RPP4 mediated through dosage-dependent SNC1 overexpression (Stokes et al. 2002; Yi

and Richards 2007).The expression level of another R gene in the locus,

At4g16950, was also dependent on SNC1 copy number.At4g16950 expression in the F1 hybrids was lower thanthat in heterozygous bal plants (Figure 4D). F1 hybridshave two copies of SNC1 and three copies of At4g16950while heterozygous bal plants have three copies of bothgenes, indicating that the expression level of At4g16950is influenced by the copy number of SNC1. The higherexpression level of At4g16950 in F1 hybrids comparedto wild-type plants revealed that the At4g16950 expres-sion level is also correlated with the copy number ofAt4g16950. On the basis of these findings, we concludethat both gene copy number and transcriptional activa-tion mediated via SNC1 are important factors influenc-ing the expression levels of various RPP5 locus R genes.

High-frequency suppression of the bal allele isassociated with SNC1 hypermutation: Previously, wereported that high-frequency (.10%) phenotypic sup-pression is observed in bal M2 populations (i.e., progenyof M1 plants grown from mutagenized seed) and that thealterations responsible for the high-frequency pheno-typic suppression are tightly linked to the RPP5 locus,arguing against an extragenic suppressor mutationmechanism (Stokes et al. 2002). Our subsequent studyfound that heritable genetic or epigenetic changesinvolved in the high-frequency phenotypic suppressionoccur in more than one-third of EMS-treated bal M1

plants (Yi and Richards 2008). We investigated whethergenetic mutations, such as reversions or intragenicsuppressor mutations, or epigenetic alterations (e.g.,RNA silencing in the RPP5 locus) are responsible for thehigh-frequency phenotypic suppression of the bal vari-ant. We focused on possible epigenetic or geneticchanges affecting the SNC1 gene because overexpres-sion of this gene is necessary and sufficient for thedevelopment of bal phenotypes. For these studies, we

established three stable lines, which exhibited signifi-cantly milder phenotypes and did not segregate anyplants with bal morphology over several generationsfrom a new EMS M2 population (Figure 5A). We firstexamined the abundance of small RNA targeting SNC1but failed to find a significant change in our preliminarystudies. We next investigated a genetic mechanism:reversion by a reduction in SNC1 copy number. Theorganization of duplicated segments in the bal variant, aswell as the RPP5 locus R genes themselves, resembletandem repeats, and we reasoned that stress conditions,such as those induced by DNA damage, might increasethe frequency of homologous recombination, as wasnoted for a tandemly repeated reporter construct inArabidopsis (Lucht et al. 2002; Molinier et al. 2006).However, no significant SNC1 copy number variationwas detected in any of the three stable phenotypicallysuppressed lines that we examined (Figure S6). There-fore, we rejected the hypothesis that phenotypic sup-pression in EMS-treated bal plants is mediated by areversion mechanism.

Next, we determined whether nucleotide sequencechanges in SNC1 are responsible for the high-frequencyphenotypic suppression. To obtain unbiased nucleotidesequence reads from both copies of SNC1 in the genomeof phenotypically suppressed lines, we determined thesequence of uncloned PCR products amplified fromgenomic DNA. A 4950-bp region extending from thestart codon to the stop codon of SNC1 was examined inthree phenotypically suppressed lines, and a total offour double peaks of A and G sequence were detectedwhere single G peaks were expected (Figure S7). Threeof these nucleotide sequence changes cause amino acidsequence changes in the NBS or LRR regions of SNC1(Figure 5B). These missense mutations in SNC1 changeamino acid residues conserved among RPP4, SNC1, andRPP5 (Parker et al. 1997; van der Biezen et al. 2002;Zhang et al. 2003). One missense mutation changes aGly to Glu at the first position in the RNBS-B motif in theNBS domain. Extensive structure and function analysisrevealed that a Gly-to-Glu mutation at the same positionin RPM1, an R protein with NBS and LRR domains,

Figure 4.—Expression levels of RPP5 locus Rgenes are different in plants with a different copynumber of these R genes. (A) Copy numbers ofRPP5 locus R genes in wild-type plants (BAL/BAL), heterozygous bal plants (BAL/bal), andhemizygous F1 hybrids (bal/�). F1 hybrids weregenerated by crossing the bal variant and a snc1null plant, the Salk_047058 mutant. Transcriptlevels of SNC1 (B), RPP4 (C), and At4g16950(D) relative to ACT2 were determined by real-time RT–PCR. Total RNA was extracted from 2-week-old plants.

R-Gene Duplication and Hypermutation 1231

destroys protein function (Tornero et al. 2002). Theother missense mutation, which we recovered in twoindependent lines, is located in the fourth LRR do-main within the predicted solvent-exposed b-sheetthat is important for ligand recognition of R proteins(Mondragon-Palomino et al. 2002). The steady-stateexpression levels of SNC1 in the three suppressed linesexamined are significantly lower than those in the balvariant (data not shown), suggesting that the missensemutations cause defects in SNC1 protein function andthereby affect the positive feedback amplification ofSNC1 transcription (Yang and Hua 2004). Our discov-ery that all three stable phenotypically suppressed linescharacterized in this study carry missense mutations inthe SNC1 gene indicates that the unusual phenotypicinstability of bal plants is caused mainly by hypermuta-tion of the SNC1 gene.

DISCUSSION

Here, we define the molecular events responsible forthe unusual behavior of the bal allele, providing amolecular snapshot of a two-step mechanism that candrive disease Resistance gene evolution. The first stepinvolves an increase in gene copy number within paral-ogous gene clusters via homologous recombination. Thesecond and more remarkable step involves the rapidinactivation or divergence of paralogs that relieves thefitness penalty exacted by the dosage effects of R-geneduplication.

Copy number variation by homologous recombina-tion: The diverse phenotypes of the bal variant arecaused by the duplication of a 55-kb region that includessix RPP5 locus R genes: SNC1, At4g16900, At4g16920,At4g16940, At4g16950, and At4g16960 (Figure 3). Al-though several genes are duplicated, our dominantgenetic suppressor screen indicated that SNC1 is theonly R gene in the locus whose expression over a certainthreshold is sufficient and necessary for the develop-ment of bal phenotypes (Figure 1). Moreover, theincreased copy number of SNC1 is critical for the

upregulation of paralogous R genes in the locus (Figure4). These conclusions are supported by the report thatintroduction of extra genomic copies of the RPP5 lo-cus R genes other than SNC1 does not induce bal-likephenotypes, while the addition of one or two extracopies of SNC1 is enough to induce bal-like phenotypes(Li et al. 2007).

The bal allele arose by a homologous recombinationevent between two paralogous R genes in the RPP5locus that fused the At4g16960 coding sequence withthe RPP4 upstream region to create a novel gene(Figure S5). Sequence comparison of the variousRPP5 locus R genes previously suggested that similarsequence exchanges among neighboring paralogousgenes contributed to generation of the extant R genesin the locus (Noel et al. 1999). The recovery of achimeric R gene at the duplication breakpoint in thebal variant is a real-time example of a novel R-geneformation event, supporting inferences gainedfrom comparative genomic studies (Song et al. 1997;Ramakrishna et al. 2002; Kuang et al. 2004; Friedman

and Baker 2007).The bal variant was originally isolated in an inbred

ddm1 mutant background, and it is possible that a loss ofheterochromatic marks and transposon silencing in theRPP5 locus contributed to the formation of the balduplication. An alternative hypothesis is that loss ofDDM1 might have played a more direct role in stimulat-ing homologous recombination events. Support for thishypothesis comes from a recent report that deletion ofthe budding yeast ortholog of DDM1 (YFR038W, IRC5)increases the rate of recombination between homolo-gous chromosomes (Alvaro et al. 2007). A thirdpossibility is that the RPP5 locus is inherently dynamicand the isolation of the bal allele in a ddm1 mutantbackground was a coincidence. This view is reinforced byour observation that SNC1-related sequences show ahigh frequency of restriction fragment length polymor-phisms as well as copy number variation among differentwild-type A. thaliana accessions (Figure S8) (Noel et al.1999; Yang and Hua 2004).

Figure 5.—Phenotypic suppression of the balvariant by SNC1 mutation. (A) Phenotypes ofbal / BAL suppressed lines. BAL: wild-type plant.bal: bal variant. Lines f, s, and w are three sup-pressed lines. Bar, 1 cm. (B) The positions ofamino acid changes found in the three suppressedlines. The SNC1 protein with TIR (Toll/Interleu-kin-1 Receptor), NBS (nucleotide binding-site),and LRR (leucine-rich repeat) domains is de-picted as a rectangle. Long and short arrows indi-cate the position of Glu to Lys at position 639 andGly to Glu at position 313 in SNC1, respectively.The arrowhead in parentheses indicates a silentmutation detected in the coding sequence. Itwas not determined whether the two point muta-tions in line w are in the same copy or in differentcopies of SNC1.

1232 H. Yi and E. J. Richards

Rapid divergence of duplicated paralogs: Our resultsdemonstrate an unexpected mechanism by which suchR-gene diversity might be facilitated: hypermutation ofduplicated paralogs. Although phenotypes conditionedby the bal allele are stable in unmutagenized popula-tions, we recovered phenotypically suppressed individ-uals in mutagenized M1 and M2 populations at anextremely high frequency (Stokes et al. 2002; Yi andRichards 2008). For example, more than one-thirdof EMS-treated bal M1 plants are phenotypically sup-pressed or contain sectors with milder phenotypes (Yi

and Richards 2008). Moreover, nearly all M1 plantsexamined gave rise to phenotypically suppressed M2

progeny. The frequencies with which phenotypicallysuppressed M1 and M2 plants are recovered are orders ofmagnitude higher than expected by traditional muta-genesis, a finding that implicates an epigenetic mecha-nism. We show here, however, that the principal cause ofthis unusual phenotypic instability is mutation in one ofthe duplicated copies of SNC1. We characterized threeindependent, stable, phenotypically suppressed linesderived from an EMS-treated M2 population and foundthat each line carries a different missense mutation inthe coding region of SNC1 (Figure 5B). Although fourbp substitutions were identified within the 4950-bpSNC1 coding region among the three phenotypicallysuppressed lines, no nucleotide sequence changes weredetected in these lines in another genic region onchromosome 4 that was sequenced as a control [i.e., an�3260-bp region encoding part of the FWA (FloweringWageningen) gene; data not shown]. In addition, prog-eny of EMS-treated bal plants only rarely exhibitedaberrant gross morphological phenotypes such as albi-nism, floral defects, or sterility. These findings suggestthat the high frequency of mutation observed at SNC1did not occur broadly across the genome.

The unusually high incidence of phenotypic suppres-sion in EMS-treated bal plants might be explained by atleast two different mechanisms, which are not mutuallyexclusive. One possibility is that the high-frequencyphenotypic suppression in EMS-treated bal plants resultsfrom the selection within the meristematic tissues thatfavors cells carrying a mutation in SNC1 (Comai andCartwright 2005; Henikoff 2005). Constitutive acti-vation of RPP5 locus R genes exacts a significant fitnesscost during vegetative growth (Heidel et al. 2004). Cellsin which the expression levels of RPP5 locus R genes arereduced by mutations in the SNC1 gene might have aselective advantage in the stem cell niche within themeristem. Consequently, cells containing SNC1 muta-tions in the context of the bal duplication would beexpected to out-compete cells without suppressor muta-tions as development progresses. Consistent with themeristem selection hypothesis, all of the recoveredmutations are G/C-to-A/T transitions, matching themutagenic specificity of EMS (Greene et al. 2003).Additional support for this hypothesis comes from the

prevalence of EMS-treated M1 bal plants that showphenotypically suppressed sectors. An alternative hy-pothesis for the apparent hypermutation of SNC1 inphenotypically suppressed plants is stress-induced mu-tagenesis (Galhardo et al. 2007)—the stress in this casebeing initiated by DNA damage. The recovery of twoSNC1 mutations in one of the phenotypically suppressedlines is consistent with stress-induced mutagenesis me-diated by error-prone DNA polymerases. This scenario,however, necessitates an additional postulate that themutation rate of the SNC1 gene in the bal variant iselevated preferentially. The constitutively active state ofSNC1 in the bal variant might play a role, as transcription-coupled mutagenesis has been documented in bothyeast and bacteria (Datta and Jinks-Robertson 1995;Wright et al. 1999). It is also possible that the largeduplication in the bal variant of the already repetitiousRPP5 locus provides a platform for increased homolo-gous recombination, which has been linked to stress-induced mutagenesis (Galhardo et al. 2007). We notethat high-frequency phenotypic instability is induced byEMS treatment of the cpr1 mutant, which carries anunknown defect in the RPP5 locus (Bowling et al. 1994;Yi and Richards 2008). An increased mutation fre-quency has been observed under special circumstancesin diverse organisms, for example, repeat-induced pointmutation in fungi during the sexual phase of their lifecycle (Galagan and Selker 2004), and somatic hyper-mutation of vertebrate immunoglobulin during B-cellproliferation (Teng and Papavasiliou 2007). Therecovery of SNC1 mutations in the bal variant providesa unique system for studying the mechanistic basis ofhigh-frequency mutation in plants.

We thank Hye Ryun Woo and Travis Dittmer for helpful commentson the manuscript, Sanjida Rangwala for bisulfite sequencing results,and Michael Dyer and the Washington University Biology Departmentgreenhouse staff for plant care. The work was supported by grantsfrom the National Science Foundation to E.J.R. (MCB-0321990 andMCB-0548597). Additional support was provided by the DanforthFoundation.

LITERATURE CITED

Alonso, J. M., A. N. Stepanova, T. J. Leisse, C. J. Kim, H. Chen et al.,2003 Genome-wide insertional mutagenesis of Arabidopsisthaliana. Science 301: 653–657.

Alvaro, D., M. Lisby and R. Rothstein, 2007 Genome-wide anal-ysis of Rad52 foci reveals diverse mechanisms impacting recom-bination. PLoS Genet. 3: e228.

Baumgarten, A., S. Cannon, R. Spangler and G. May, 2003 Genome-level evolution of resistance genes in Arabidopsis thaliana. Genetics165: 309–319.

Belkhadir, Y., R. Subramaniam and J. L. Dangl, 2004 Plant diseaseresistance protein signaling: NBS-LRR proteins and their part-ners. Curr. Opin. Plant Biol. 7: 391–399.

Bowling, S. A., A. Guo, H. Cao, A. S. Gordon, D. F. Klessig et al.,1994 A mutation in Arabidopsis that leads to constitutive ex-pression of systemic acquired resistance. Plant Cell 6: 1845–1857.

Cannon, S. B., A. Mitra, A. Baumgarten, N. D. Young and G. May,2004 The roles of segmental and tandem gene duplication inthe evolution of large gene families in Arabidopsis thaliana.BMC Plant Biol. 4: 10.

R-Gene Duplication and Hypermutation 1233

Clarke, J. D., N. Aarts, B. J. Feys, X. Dong and J. E. Parker,2001 Constitutive disease resistance requires EDS1 in the Ara-bidopsis mutants cpr1 and cpr6 and is partially EDS1-dependentin cpr5. Plant J. 26: 409–420.

Cocciolone, S. M., and K. C. Cone, 1993 Pl-Bh, an anthocyanin reg-ulatory gene of maize that leads to variegated pigmentation. Ge-netics 135: 575–588.

Cokus, S. J., S. Feng, X. Zhang, Z. Chen, B. Merriman, C. D.Haudenschild et al., 2008 Shotgun bisulphite sequencing ofthe Arabidopsis genome reveals DNA methylation patterning.Nature 452: 215–219.

Comai, L., and R. A. Cartwright, 2005 A toxic mutator and selec-tion alternative to the non-Mendelian RNA cache hypothesis forhothead reversion. Plant Cell 17: 2856–2858.

Datta, A., and S. Jinks-Robertson, 1995 Association of increasedspontaneous mutation rates with high levels of transcription inyeast. Science 268: 1616–1619.

Friedman, A. R., and B. J. Baker, 2007 The evolution of resistancegenes in multi-protein plant resistance systems. Curr. Opin.Genet. Dev. 17: 493–499.

Galagan, J. E., and E. U. Selker, 2004 RIP: the evolutionary cost ofgenome defense. Trends Genet. 20: 417–423.

Galhardo, R. S., P. J. Hastings and S. M. Rosenberg,2007 Mutation as a stress response and the regulation of evolv-ability. Crit. Rev. Biochem. Mol. Biol. 42: 399–435.

Greene, E. A., C. A. Codomo, N. E. Taylor, J. G. Henikoff et al.,2003 Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 164: 731–740.

Heidel, A. J., J. D. Clarke, J. Antonovics and X. Dong, 2004 Fit-ness costs of mutations affecting the systemic acquired resistancepathway in Arabidopsis thaliana. Genetics 168: 2197–2206.

Henikoff, S., 2005 Rapid changes in plant genomes. Plant Cell 17:2852–2855.

Jeddeloh, J. A., J. Bender and E. J. Richards, 1998 The DNA meth-ylation locus DDM1 is required for maintenance of gene silenc-ing in Arabidopsis. Genes Dev. 12: 1714–1725.

Kakutani, T., J. A. Jeddeloh, S. K. Flowers, K. Munakata and E. J.Richards, 1996 Developmental abnormalities and epimuta-tions associated with DNA hypomethylation mutations. Proc.Natl. Acad. Sci. USA 93: 12406–12411.

Kuang, H., S. S. Woo, B. C. Meyers, E. Nevo and R. W. Michelmore,2004 Multiple genetic processes result in heterogeneous ratesof evolution within the major cluster disease resistance genesin lettuce. Plant Cell 16: 2870–2894.

Li, X., J. D. Clarke, Y. Zhang and X. Dong, 2001 Activation of anEDS1-mediated R-gene pathway in the snc1 mutant leads to con-stitutive, NPR1-independent pathogen resistance. Mol. Plant Mi-crobe Interact. 14: 1131–1139.

Li, Y., S. Yang, H. Yang and J. Hua, 2007 The TIR-NB-LRR geneSNC1 is regulated at the transcript level by multiple factors.Mol. Plant Microbe Interact. 20: 1449–1456.

Lucht, J. M., B. Mauch-Mani, H. Y. Steiner, J. P. Metraux, J. Ryals

et al., 2002 Pathogen stress increases somatic recombinationfrequency in Arabidopsis. Nat. Genet. 30: 311–314.

Lynch, M., and J. S. Conery, 2000 The evolutionary fate and con-sequences of duplicate genes. Science 290: 1151–1155.

Martin, G. B., A. J. Bogdanove and G. Sessa, 2003 Understandingthe functions of plant disease resistance proteins. Annu. Rev.Plant Biol. 54: 23–61.

Meyers, B. C., A. Kozik, A. Griego, H. Kuang and R. W. Michelmore,2003 Genome-wide analysis of NBS-LRR-encoding genes in Ara-bidopsis. Plant Cell 15: 809–834.

Molinier, J., G. Ries, C. Zipfel and B. Hohn, 2006 Transgenerationmemory of stress in plants. Nature 442: 1046–1049.

Mondragon-Palomino, M., B. C. Meyers, R. W. Michelmore andB. S. Gaut, 2002 Patterns of positive selection in the completeNBS-LRR gene family of Arabidopsis thaliana. Genome Res. 12:1305–1315.

Noel, L., T. L. Moores, E. A. van der Biezen, M. Parniske, M. J.Daniels et al., 1999 Pronounced intraspecific haplotype diver-gence at the RPP5 complex disease resistance locus of Arabidop-sis. Plant Cell 11: 2099–2112.

Parker, J. E., M. J. Coleman, V. Szabo, L. N. Frost, R. Schmidt et al.,1997 The Arabidopsis downy mildew resistance gene RPP5shares similarity to the toll and interleukin-1 receptors with Nand L6. Plant Cell 9: 879–894.

Ramakrishna, W., J. Emberton, M. Ogden, P. SanMiguel and J. L.Bennetzen, 2002 Structural analysis of the maize rp1 complexreveals numerous sites and unexpected mechanisms of local re-arrangement. Plant Cell 14: 3213–3223.

Song, W. Y., L. Y. Pi, G. L. Wang, J. Gardner, T. Holsten et al.,1997 Evolution of the rice Xa21 disease resistance gene family.Plant Cell 9: 1279–1287.

Stokes, T. L., and E. J. Richards, 2002 Induced instability of twoArabidopsis constitutive pathogen-response alleles. Proc. Natl.Acad. Sci. USA 99: 7792–7796.

Stokes, T. L., B. N. Kunkel and E. J. Richards, 2002 Epigeneticvariation in Arabidopsis disease resistance. Genes Dev. 16: 171–182.

Teng, G., and F. N. Papavasiliou, 2007 Immunoglobulin somatichypermutation. Annu. Rev. Genet. 41: 107–120.

Tornero, P., R. A. Chao, W. N. Luthin, S. A. Goff and J. L. Dangl,2002 Large-scale structure-function analysis of the ArabidopsisRPM1 disease resistance protein. Plant Cell 14: 435–450.

van der Biezen, E. A., C. T. Freddie, K. Kahn, J. E. Parker and J. D.Jones, 2002 Arabidopsis RPP4 is a member of the RPP5 multi-gene family of TIR-NB-LRR genes and confers downy mildew re-sistance through multiple signalling components. Plant J. 29:439–451.

Wright, B. E., A. Longacre and J. M. Reimers, 1999 Hypermutationin derepressed operons of Escherichia coli K12. Proc. Natl. Acad.Sci. USA 96: 5089–5094.

Yang, S., and J. Hua, 2004 A haplotype-specific Resistance gene reg-ulated by BONZAI1 mediates temperature-dependent growthcontrol in Arabidopsis. Plant Cell 16: 1060–1071.

Yi, H., and E. J. Richards, 2007 A cluster of disease resistance genesin Arabidopsis is coordinately regulated by transcriptional activa-tion and RNA silencing. Plant Cell 19: 2929–2939.

Yi, H., and E. J. Richards, 2008 Phenotypic instability of Arabidop-sis alleles affecting a disease resistance gene cluster. BMC PlantBiol. 8: 36.

Zhang, X., J. Yazaki, A. Sundaresan, S. Cokus, S. W. Chan et al.,2006 Genome-wide high-resolution mapping and functionalanalysis of DNA methylation in Arabidopsis. Cell 126: 1189–1201.

Zhang, Y., and X. Li, 2005 A putative nucleoporin 96 is required forboth basal defense and constitutive resistance responses medi-ated by suppressor of npr1–1,constitutive 1. Plant Cell 17:1306–1316.

Zhang, Y., S. Goritschnig, X. Dong and X. Li, 2003 A gain-of-function mutation in a plant disease resistance gene leads toconstitutive activation of downstream signal transduction path-ways in suppressor of npr1–1, constitutive 1. Plant Cell 15:2636–2646.

Communicating editor: J. A. Birchler

1234 H. Yi and E. J. Richards

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.105569/DC1

Gene Duplication and Hypermutation of the Pathogen Resistance Gene SNC1 in the Arabidopsis bal Variant

Hankuil Yi and Eric J. Richards

Copyright © 2009 by the Genetics Society of America

DOI: 10.1534/genetics.109.105569

H. Yi and E. J. Richards 2 SI

FIGURE S1.—Organization of the RPP5 locus in the Columbia strain and the positions of T-DNA insertions from the SALK collection that were used in this study. The R genes and three related sequences (At4g16880, At4g16930, At4g16990) are indicated by open arrows while non-R genes are indicated by filled arrows. The start and end points of the arrows show the start and stop codons, respectively. Transposon-related sequences are not indicated. More information on Salk T-DNA insertional null alleles can be found at http://signal.salk.edu/cgi-bin/tdnaexpress. Cen: centromere

At4g16860

(RPP4)

At4g16890

(SNC1) At4g16900

At4g16880

At4g16850

At4g16920

At4g16930

At4g16940

At4g16950

At4g16960

At4g16970

At4g16980

At4g16990

At4g17000

Cen

Salk_047058

Salk_123471

Salk_017569

Salk_052814

Salk_034491

Salk_007524

Salk_005979

Salk_032697

Salk_028077

Salk_021144

5 kb

H. Yi and E. J. Richards 3 SI

FIGURE S2.—No significant differences in small RNA accumulation were observed between wild-type and bal plants. Small RNA gel blot analysis was used to detect the RNA species indicated on the left. BAL: wild-type plant. bal: bal variant. Tissue for RNA isolation was collected from 2 week-old plants. Results shown here were obtained from a single membrane. In two independent biological replicates, similar results were found.

Sense transcript of R genes

BAL bal

21 nt

Antisense transcript of R genes

21 nt

21 nt

Probe detecting

miR159

U6 snRNA

H. Yi and E. J. Richards 4 SI

FIGURE S3.—SNC1 and other RPP5 locus R genes are amplified in the bal variant. (A) Gene structure and DraI restriction map of SNC1. Exon and introns are illustrated by rectangles and connecting lines, respectively. The positions of probes used in the DNA gel blot analyses for Figure 3B, 3C, and 3D are indicated by thick bars labeled with 1, 2, and 3, in the order. (B), (C), and (D) Results of DNA gel blot analysis. Results were obtained from a single membrane after confirming that no hybridization signal was left from the previous experiment. The identities of the hybridization bands were inferred from the sizes of the DraI-restriction fragments of RPP5 locus R genes. BAL: wild-type plants. bal: bal variant. Actin 2 (ACT2) was used as a normalization control.

At4g16940, A4g16950

A

D

ATG TGA

DraI DraI DraI DraI

1 2 3 1 kb

B

SNC1

C

SNC1

At4g16920, A4g16950

RPP4, A4g16940, A4g16960

RPP4, A4g16900

SNC1, A4g16960

At4g16940, A4g16950

BAL bal

DraI

BAL bal

DraI

BAL bal

DraI

H. Yi and E. J. Richards 5 SI

FIGURE S4.—Copy number variation of SNC1 and At4g16950 in the bal variant. (A) and (B). Results of DNA gel blot analyses. Hybridization probes corresponding to exon1 sequences of SNC1 and At4g16950 were used in (A) and (B), respectively. The sizes of the strongest bands match those expected from the restriction fragments of SNC1 and At4g16950. BAL: wild-type plant. bal: bal variant

SNC1, At4g16900,

At4g16950, At4g16960

At4g16970

BAL bal

XbaI

A

At4g16930, At4g16940,

At4g16920

RPP4

BAL bal

RsaI

SNC1, At4g16960

RPP4

At4g16920, At4g16930,

At4g16940

At4g16950

B

At4g16900

At4g16900

H. Yi and E. J. Richards 6 SI

FIGURE S5.— DNA sequence alignment of RPP4, At4g16960, and the chimeric gene located at the duplication boundary in the bal variant. Nucleotide sequence of RPP4, At4g16960, and the chimeric gene (Chimeric) were aligned using CLUSTALW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html). For each gene, a 300 bp sequence covering -60 to +240 relative to the translational start codon was used. Polymorphic nucleotide sequences between RPP4 and those in At4g16960 are indicated in color: red for RPP4 and blue for At4g16960. Start codons, confirmed for RPP4, but putative for Chimeric and At4g16960, are indicated by brown boxes. The breakpoint in the bal variant that created the chimeric gene is delimited to the underlined 186 bp region of identity between RPP4 and At4g16960.

TGCTGATTTACTTCTCTTAAAAATCTTCGTCTCTTCTCTGAGTTCCCTCTATCGTCTCCC

TGCTGATTTACTTCTCTTAAAAATCTTCGTCTCTTCTCTGAGTTCCCTCTATCGTCTCCC

TGCTAATTTACTTCTCTTACGAATCTTCGTCTCTTCTCTGAGTTCTCTCTATCGTCTCCC

ATGGCTTCTTCTTCTTCTTCTCCTAGTAGCCGGAGATACGACGTTTTCCCAAGCTTCAGT

ATGGCTTCTTCTTCTTCTTCTCCTAGTAGCCGGAGATACGACGTTTTCCCAAGCTTCAGT

ATGGCTTCTTCTTCTTCTTCTCCTAGTAGCCGGAGATACGACGTTTTCCCAAGCTTCAGT

GGGGTAGATGTTCGCAAAACGTTCCTCAGCCATCTAATCGAGGCGCTCGACCGCAGATCA

GGGGTAGATGTTCGCAAAACGTTCCTCAGCCATCTAATCGAGGCGCTCGACCGCAGATCA

GGGGTAGATGTTCGCAAAACGTTCCTCAGCCATCTAATCGAGGCGCTCGACCGCAGATCA

ATCAATACATTCATGGATCACGGCATCGTGAGAAGCTGCATAATCGCCGATGCGCTTATA

ATCAATACATTCATGGATCACGGCATCGTGAGAAGCTGCATAATCGCCGATGAGCTTATA

ATCAATACATTCATGGATCACGGCATCGTGAGAAGCTGCATAATCGCCGATGAGCTTATA

ACGGCCATTAGAGAAGCGAGGATCTCAATAGTCATCTTCTCTGAGAACTATGCTTCTTCA

ACGGCCATTAGAGAAGCGAGGATCTCAATAGTTATCTTCTCTGAGAACTATGCTTCTTCC

ACGGCCATTAGAGAAGCGAGGATCTCAATAGTTATCTTCTCTGAGAACTATGCTTCTTCC

RPP4

Chimeric

At4g16960

RPP4

Chimeric

At4g16960

RPP4

Chimeric

At4g16960

RPP4

Chimeric

At4g16960

RPP4

Chimeric

At4g16960

H. Yi and E. J. Richards 7 SI

FIGURE S6.—No decrease in SNC1 copy number was detected in three lines of stable bal BAL suppressed lines. gSNC1/gRPP4: the relative ratio of genomic copy number of SNC1 and RPP4 determined by quantitative real-time PCR. BAL: wild type plant. bal: bal variant. Line f, Line s, and Line w: three suppressed lines.

BAL bal Line f

gS

NC

1/g

RP

P4

4

0

0.5

1

1.5

2

2.5

3

3.5

4

gS

NC

1/g

RP

P4

BAL bal Line s Line w

3.5

2.5

1.5

0.5

1

2

3

0

H. Yi and E. J. Richards 8 SI

FIGURE S7.—DNA sequencing electropherogram traces around the regions where nucleotide sequence changes were detected in the SNC1 coding sequence from the three bal BAL suppressed lines. Positions of nucleotide sequence changes that cause amino acid changes at positions 313 (Gly Glu) and 639 (Glu Lys) in SNC1 are indicated by the short and long arrow, respectively. A silent mutation detected in the coding sequence is indicated by arrowhead in parenthesis.

Line f

Line w

Line s

C C T G/A A G G

C G T G/A A A G

C C T G/A A G G

A A G G/A A G T ( )

H. Yi and E. J. Richards 9 SI

FIGURE S8.—Copy number variation and restriction fragment length polymorphism was observed for SNC1-related sequences in 22 natural strains of Arabidopsis. (A) and (B). Results of DNA blot analysis. Radiolabeled probes corresponding to either the first exon probe of SNC1 (A) or the Actin 2 coding sequence (B) were sequentially hybridized to the immobilized BamHI-digested genomic DNA. a, Columbia; b, Bayreuth-0; c, Borky-4; d, Eifel-2; e, Estland-1; f, Gabelstein-0; g, Kindaville-0; h, Kazakhstan-9; i, Landsberg erecta-1; j, Markt-0; k, Noordzwizk-3; l, Renkum-1; m, Renkum-11; n, Sorbo; o, Sq-1; p, Sq-8; q, Tammisari-2; r, Tosa Del Mar-5; s, Warsaw-1; t, Wassilewskija-2; u, Zdarec-1; v, Zdarec-6.

A

B

a b c d e f g h i k l m n o p q r s t u vj a

a b c d e f g h i k l m n o p q r s t u vj a

H. Yi and E. J. Richards 10 SI

TABLE S1

Information on oligonucleotides used in this study

Oligonucleotide Name Sequences (5’ 3’) Use

snc1F GTGGAGTTCCCATCTGAACATC Amplification of DNA fragment with or without snc1 point mutation that disrupts XbaI site

snc1R CCCATTTTGATTGCTGGAAAG Amplification of DNA fragment with or without snc1 point mutation that disrupts XbaI site

At4g16890endo CGCGAGCTTCAGTGGAGAAAAT Amplification of Southern probe in 5’ region of SNC1

Salk_047058U TCATGGCTGCTTCACTAGGC Amplification of Southern probe in 5’ region of SNC1

SNC1middleF GACTTTCCGGAAGGGAGAAATGAG Amplification of Southern probe in mid part of SNC1

SNC1middleR GACATAACCGTGGTAAGACATAACC Amplification of Southern probe in mid part of SNC1

890GATE0 CACCTGACAAAAGGCTGGAGGTTCTCCGAT Amplification of Southern probe in 3’ region of SNC1

890GATE3 AGAGCTCTGAGGTACAATGACAG Amplification of Southern probe in 3’ region of SNC1

Salk_028077D TGCAAGTCTTGGAGGGAAGGA Amplification of Southern probe in 5’ region of At4g16950

Salk_028077U2New CTCTAATCGCCGATATAAGCTCAGG Amplification of Southern probe in 5’ region of At4g16950

860RealTime 6FAM-CTTGCCACGTAAACT Determination of genomic copy number and expression level of RPP4 in real-time PCR

860RealTimeF GAAGGCACTCAAGGCCTCATT Determination of genomic copy number and expression level of RPP4 in real-time PCR

860RealTimeR GACAATAATCCCACCATAGCCTTT Determination of genomic copy number and expression level of RPP4 in real-time PCR

IntactSNC1 6FAM-CAGAGGATGAGAAACAA Determination of genomic copy number of SCN1 in real-time PCR

H. Yi and E. J. Richards 11 SI

IntactSNC1F TTTGAAGAGACATGCAAGGCTAAA Determination of genomic copy number of SCN1 in real-time PCR

IntactSNC1R GCTGCTAGAGCTTGCTTCCAA Determination of genomic copy number of SCN1 in real-time PCR

950 Taqman probe 6FAM-TAGCAAATATAGCCGGAGAGG

Determination of genomic copy number and expression level of At4g16950 in real-time PCR

950RealtimeF TGGGTGCAAGCTCTCACAGA

Determination of genomic copy number and expression level of At4g16950 in real-time PCR

950RealtimeR TCATTAGGCCCGTTCAGAAGA Determination of expression level of At4g16950 in real-time PCR

950GenomicRealtimeR GGAATCATAACAACGTACCCGTTCA Determination of genomic copy number of At4g16950 in real-time PCR

New890RealTime 6FAM-TGGCCTAGTGAAGCAG Determination of expression level of SNC1 in real-time PCR

At4g16890realtimeF GCCGGATATGATCTTCGGAA Determination of expression level of SNC1 in real-time PCR

At4g16890realtimeR CGGCAAGCTCTTCAATCATG Determination of expression level of SNC1 in real-time PCR

act2Realtime NED-AGCACATTCCAGCAGATGTGGATCTCCAA Determination of expression levels of R genes in real-time PCR

act2F Taqman TCGGTGGTTCCATTCTTGCT Determination of expression levels of R genes in real-time PCR

act2R Taqman GCTTTTTAAGCCTTTGATCTTGAGAG Determination of expression levels of R genes in real-time PCR

Salk_112108U TTTGAGATGTTCTGGGCGAAA Primer for 880 Southern probe in Figure

Salk_112108D TGCCTATGGTGGCGTTATTGT Primer for 880 Southern probe in Figure

F CTCTAATCGCCGATATAAGCTCAGG Amplification of product specific for the bal allele

R TGCCTATGGTGGCGTTATTGT Amplification of product specific for the bal allele

H. Yi and E. J. Richards 12 SI

Salk_017569U AAAGGTCGTCAGTTGATTTTGAA Amplification of Southern probe detecting a novel BclI-digested fragment in the bal variant

RPP4Promoter_tel TCTTTGCTACAATTCCGCATATTCTTTCATTAT Amplification of Southern probe detecting a novel BclI-digested fragment in the bal variant

anitLRRsmRNA5' ACTTCTTCAATGGCGGTGTT Amplification of PCR product used for a probe detecting RPP5 locus R gene antisense transcripts

anitLRRsmRNA3' GAGACAGGTTCCAGATCTTTCGAAGGCCA Amplification of PCR product used for a probe detecting RPP5 locus R gene antisense transcripts

860GATE CACCTGATTCCAGATCTTTCGAAGGCCA Amplification of PCR product used for a probe detecting RPP5 locus R gene sense transcripts

860smENA GAGACAGGACTTCTTCAATGGCGGTGTT Amplification of PCR product used for a probe detecting RPP5 locus R gene sense transcripts

U6 snRNA CACGCATAAATCGAGAAATGGTCCTGTCTC Construction of U6 probe

miR159 TTTGGATTGAAGGGAGCTCTACCTGTCTC Construction of mir159 probe