Upload
trinhnhi
View
216
Download
3
Embed Size (px)
Citation preview
Fundamentals: Nucleic acids, DNA replication, transcription, translation and
application to molecular detection
Prokaryotic cell
Binary Fission
• Bacteria reproduce asexually via binary fission
• Each daughter cell is an identical copy (or clone) of its parent cell
Microbial evolution 101
Generation 1
Generation 2
Generation 3
Generation N
Ancestor Genotype
Clones
Clones
Clones and Divergent Genotypes
Microbial genetics 101
• What is DNA ?• What types of DNA molecules
are present in a bacterial cell?• What’s the size of the genetic
material for a typical bacterial pathogen ?
• How many genes does a bacterial pathogen have ?
• What’s the average size of a bacterial gene ?
What Is DNA?
Double Helix Structure and Anti-parallel Orientation
Nucleotide = 5 carbon sugar + nitrogenous base + phosphate group
DNA is a polynucleotide
Constituents of a Gene• Promoter• Ribosome binding site • Open reading frame• Start & Stop codons
ATG TAG
-10-35
Ribosome binding site
Promoter
Start codon
Stop codon
5’ 3’
The Central DogmaDNA
mRNA
Protein/Enzymes
Toxins & other metabolites
Molecularmethods
Classicalmethods
DNA replication
Translation
Transcription
Post-translation
DNA Replication• Topoisomerases remove superhelicity• New DNA is synthesized in the 5’ to 3’ direction • Replication begins at a the origin of replication (ori)• Two replication forks proceed around the chromosome (bi-directional) until they encounter termination (ter) sites• Replication is continuous on one strand and discontinuous on the other strand• Chromosomes partitioned into two daughter cells during cell division
DNA Replication
• Helicase; unwinds helix• Single-stranded binding protein; binds single-stranded DNA prevent
hybridization • Primase; lays down RNA primers needed for DNA polymerase activity• DNA polymerase I; remove RNA primers replace with DNA• DNA polymerase II; DNA repair• DNA polymerase III; major replication enzyme forms phosphodiester bonds • Ligase; seals nicks by linking free 3’ OH with 5’ adjacent phosphate group• Proofreading (DNA pol I & III) 3’ to 5’ exonuclease activity to remove incorrect
base• Incorrect base incorporated every 1x108 to 1x1011 bases
Leading strand; continuous replication
Lagging strand; discontinuous replication
DNA Polymerase and PCR
• DNA polymerase III• Polymerase with or without 3’ to 5’ exonuclease
proofreading activity– Taq (5’ - 3’ exonuclease activity); only degrades double
stranded DNA while extending– Vent (3’ to 5’ exonuclease activity; specialized Taq)– Implications
• Detection/subtyping methods• Cloning
DNA Replication and Application to Molecular Detection
• Polymerase chain reaction (PCR) or “DNA photocopying”– Simulate the natural DNA replication process to make
copies of DNA in vitro
– Make many copies of specific DNA fragment(s) in vitro• Template, deoxynucleotidetriphosphates, primers, DNA
polymerase, enzyme cofactors, and buffer
RNA v. DNA
RNA in the cell• Ribosomal RNA (rRNA) bulk of RNA in a cell
– 3 types (16s, 23s, and 5s)– 3,000 copies in a cell – Ribosomes; protein assembly during translation
• Messenger RNA (mRNA) 5-10% of RNA in a cell– Almost as many types as there are genes – Not stable in the cell; highly transcribed genes have a few hundred
copies; half-life a few minutes (1 to 7 min.)– Synthesized from DNA during transcription– Move information contained in DNA to translation machinery
• Transfer RNA (tRNA)– About 50 types– Pick up amino acid & transport to ribosome during translation
• Small RNA (sRNAs)– 50 - 200 nucleotides– Regulatory roles (e.g., affect mRNA stability and translation)
The Central DogmaDNA
mRNA
Protein/Enzymes
Toxins & other metabolites
Molecularmethods
Classicalmethods
DNA replication
Translation
Transcription
Post-translation
Transcription and translation are coupled in bacteria
Holoenzyme (RNA polymerase and sigma factor
Anticodon
Transcription
tRNA
Translated Protein
mRNA
RibosomesTranslationDirection
5’3’
3’5’
50S large subunit (23S and 5S RNA and proteins)
30S small subunit (16S RNA and proteins)
A closer look at transcription
• DNA used as template to synthesize complementary mRNA molecules• RNA polymerase (pol) binds to promoter region in double-stranded DNA• Sigma factors help RNA pol bind promoter & target genes to be transcribed
• -10 and -35 region 5’ of transcription start site
• Local unwinding of double-stranded DNA• RNA pol recognizes transcription start site • RNA pol adds nucleotides 5’ to 3’• RNA pol termination RNA pol and RNA molecule released
•Rho-dependent•Rho-independent (hairpin loop; termination sequence)
The Central DogmaDNA
mRNA
Protein/Enzymes
Toxins & other metabolites
Molecularmethods
Classicalmethods
DNA replication
Translation
Transcription
Post-translation
A closer look at translation
• Three ribosome sites:• A site; entry of aminoacyl tRNA (except 1st aminoacyl tRNA or start codon, which enters at P site)• P site; peptidyl tRNA is formed • E site; exit for uncharged tRNA
• Shine-Dalgarno sequence or ribosome binding site recognized (5-10 bases upstream of start codon)• Assembly of small and large ribosome subunits• Amino acids added to carboxyl end of growing chain• Protein exits ribosome through tunnel in large subunit• Termination occurs when one of three termination codons moves into A site
Genetic code
Application to molecular detection in food microbiology
• Molecular detection methods include assays that target nucleic acids (i.e., DNA and RNA)
• DNA detection methods– Detect presence or absence of gene(s) or gene fragment(s)
specific to the target organism– Detection of universal gene or gene fragment (e.g., 16s rRNA)
followed by DNA sequencing – Detection of DNA does not differentiate between viable and non-
viable organism• mRNA detection methods
– mRNA is rapidly degraded and detection indicates presence of viable organism
PCR Applications
• PCR detection particularly useful when– Classical detection too time-consuming– Differentiation from closely related non-pathogenic
organisms is difficult• Listeria monocytogenes
– Only species in Listeria genera that is pathogenic to humans
– PCR assay targeted to detect hemolysin (hlyA) gene can detect presence and differentiate L. monocytogenesfrom other Listeria spp.
PCR Reaction Components
• 1 - Small quantity of DNA added to tube• 2 - DNA polymerase• 3 - Oligonucleotides (primers)• 4 - Deoxynucleotidetriphosphate bases• 5 - MgCl2• 6 - Buffer• 7 - Sterile ultrapure water
Polymerase Chain Reaction (PCR) FundamentalsDNA Extraction
Introduction to PCR • DNA Genetic information for every animal, plant and
microorganism
• Unique variations in DNA allow us to track it back to the organism it originated from with precision
• Comparative genomics, forensics, fingerprinting often require significant amounts of DNA
• PCR can synthesize, characterize and analyze any specific piece of DNA
What is PCR ?
Polymerase Chain Reaction:– in vitro (DNA synthesis in a tube)– Yields million of copies of target DNA sequence– Repeated cycling action– Involving DNA polymerase enzyme
PCR Principles
• Conceptualized by Kary Mullis in 1983• DNA amplification in vitro using the following
components:– Two synthetic oligonucleotides (primers)
complementary to each end of targeted DNA sequence– Single nucleotide bases as substrate– DNA polymerase; a naturally occurring enzyme
responsible for in vivo DNA replication and repair
PCR Applications
• Food Science:– Detection or molecular confirmation of specific
microorganisms present in foods– Molecular subtyping of isolates
• Molecular Biology:– Mutagenesis, cloning or sequencing
• Evolutionary Biology:– Re-create the evolutionary history of a group of taxa
PCR Applications
• PCR detection particularly useful when– Classical detection too time-consuming– Differentiation from closely related non-pathogenic
organisms is difficult• Listeria monocytogenes
– Only species in Listeria genera that is pathogenic to humans
– PCR assay targeted to detect hemolysin (hlyA) gene can detect presence and differentiate L. monocytogenesfrom other Listeria spp.
PCR Reaction• High temperature “melts” double strand DNA
helix into single strand DNA
• Two synthetic sequences of single stranded DNA (18-24 bases) known as primers target a region of genome
• Forward primer and Reverse primer flank the region of interest (usually <1000 base pair)
PCR Reaction Components
1 – DNA template2 – DNA polymerase3 – Primers (oligonucleotides)4 – Deoxynucleotidetriphosphate bases (dNTPs)5 – MgCl26 – Buffer7 – Sterile ultrapure water
PCR Reaction Set-up1 - DNA Template
– Theoretically, PCR can detect as little as one DNA molecule
– Template DNA should be present in small amounts (< 106 target molecules; 1 ng of E. coli DNA = 3x105)
– Bacterial cells need to be lysed to make their DNA accessible for PCR
PCR Reaction Set-up2 – Primers
– Should be in great excess to template DNA to ensure that most strands anneal to a primer and not each other
– Generally between 0.1 and 0.5 µM optimal concentration
– Higher primer concentrations may cause non-specific products
PCR Reaction Set-up3 - Deoxynucleotide Triphosphates (dNTPs)
– Building blocks of DNA A’s, T’s, G’s, & C’s
– Essential to have enough dNTPs to make desired number of target sequence copies
– Final concentration of EACH dATP, dTTP, dCTP and dGTP should be 0.1 mM
PCR Reaction Set-up4 - DNA Polymerase Enzyme:
– Original PCR performed with E. coli DNA polymerase, but high temperature (94-95oC) needed to denature double stranded DNA also denatured this polymerase
– Problem solved using thermostable Taq DNA polymerase
– Concentration should be around 0.5 to 5 units/100µl reaction volume
PCR Reaction Set-up5 - MgCl2
– Essential for optimum Taq activity and for proper primer annealing
– Excessive concentrations cause non-specific products
– Standard PCR reaction contains between 1.5 and 5.0 mM MgCl2
PCR Reaction Set-up6 - PCR buffer
– Buffer keeps the PCR reaction at the proper pH (6.8-7.8) for enzyme activity
– Contains 10-50mM Tris-HCl and KCl or NaCl (50 mM)
– Salt also helps to stabilize hybridization of primer to target DNA
PCR Reaction Set-up7 – High quality water
– Dilutes template, buffers etc.
PCR Demo Cycling Action
• http://www.dnalc.org/files/swfs/animationlib/pcr.exe
Standard Thermal Cycling Conditions
• Newly synthesized extension product of one primer serves as template for annealing of the second primer in subsequent cycles
• Each reaction cycle doubles the number of DNA copies or PCR products
94-96°C
50-55°C
72°C 72°C
4°C
1-2 min
1-2 min
1-2 min 5-7 min
∞
94-96°C2-10 min
25-40 cycles
*Denaturation
*Annealing
*Extension
*Initialdenaturation *Final
extension
Amplification Cycles
• Initial denaturation at 94-96oC for 2 min• Standard PCR protocol has 20-45 cycles of the following
time/temperature combinations• 1-2 min @ 94-96oC
– Denature DNA• 1-2 min @ 50-55oC
– Primers hybridize by forming hydrogen bonds to complementary sequence
• 1-2 min @ 72oC– DNA polymerase binds and extends a complementary strand from
each hybridized primer• One final hold at 72oC for 5-7 min optional for higher
product yield
Exponential Amplification
• Newly synthesized extension product of one primer serves as template for annealing of the second primer in subsequent cycles
• Each reaction cycle doubles the number of DNA copies or PCR products
Important PCR Innovations
• Acquisition of heat stable DNA polymerase (Taq) from Thermus acquaticus which inhabits hot springs– Remains active during repeated denaturation
cycles• Thermal cycler or thermocycler
– Computer controlled heating block for repetitive temperature change cycles required for PCR reaction
Basics of DNA Extraction
Goal Gain access to DNA
1) Classic DNA Extractions methods2) Silica membrane (commercial kit)3) Microwave (yep, just nuke the sample)
Classic DNA Prep1. Disrupt the cell wall
– Mechanically Beadbeating, sonication, French press
– Enzymatically Lysozyme
2. Remove membrane lipid– Triton-X, Sodium dodecyl sulfate (SDS)Detergents
3. Degrade proteins– Proteinase K
4. Extract residual proteins phenol:chloroformextraction
5. Ethanol precipitation
Commercial Silica Column DNA Purification
1.Enzymatic lysis & protein degradation
2.Apply supernatant to silica membrane in a column
3.DNA is negatively charged; silica membrane is negatively chargedNa+
Commercial Silica Column DNA Purification , cont.
4.High salt and Ethanol washes rinse degraded protein through the column
5. ElutionWater with low salt concentrations disrupt the DNA-Na-Silica interaction releasing the DNA from the column
Microwave
• Colony PCR or “dirty lysates”1. Select an isolated colony from an agar plate2. Transfer a portion to a PCR tube (0.2 mL
tube)3. Microwave Time dependent!4. Add water5. Add PCR reagents & thermal cycle
Concepts of Primer Design
• Design is crucial to successful amplification of target DNA by PCR
• Determine the size and location of PCR product• Well-designed primers can deter amplification of
background and non-specific products• Poorly designed primers result in no or very low
PCR product yield• Several computer programs are available for
selecting primers
Concepts of primer design
Goal Balance specificity and efficiency of amplification
Primer selection/analysis software assess these two criteria by evaluating the following criteria:– Primer length– Terminal nucleotide– G + C content and Tm– PCR product length– Placement in target
sequence
Concepts of primer design
• Primer Length:
– Primers between 18-24 nucleotides in length tend to be very sequence-specific if the annealing temperature is set within a few degrees of the primer Tm
– Optimize PCR by using the minimum primer length that ensures Tm of 54oC or higher
Concepts of primer designTerminal Nucleotides:
– 3’ terminal positions are essential for controlling mis-priming
– 3’ end of primers must be carefully selected to prevent homologies within the primer pair known as primer-dimer where the PCR product is amplification of primers
GC content and Tm– Primers with 50% G+C content have a Tm between 56-
62oC– Tm and GC content should be similar between primer
pairs– A/T = 2°C– G/C= 4°C
Concepts of primer design
• Use multiple sequences to design/validate primers if possible– WHY?
• PCR Product Length and Placement within Target Sequence– Length of PCR product affects efficiency of
amplification– Size of the PCR product depends on application
Degenerate primers• Primers with mixed base pairs Isolate 1 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 2 5’ ATGCCATCTGACTGACACCACCTCAATCAA 3’Isolate 3 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 4 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’
Primer sequence 5’ ATG(G/C)CATCTGACTGACACC 3’50% of primer synthesized with each nucleotide
• InosineIsolate 1 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 2 5’ ATGGCATCAGACTGACACCACCTCAATCAA 3’Isolate 3 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 4 5’ ATGGCATCCGACTGACACCACCTCAATCAA 3’
Primer sequence 5’ ATGGCATC(I)GACTGACACC 3’
Concepts of primer design
• Hypothetical DNA and primer sequences
5’ ATGCCGCAATTCGTTATTACTTCGATCCG 3’*reverse primer 3’… TAGGC 5’
5’ ATGCC … 3’ *forward primer3’ TACGGCGTTAAGCAATAATGAAGCTAGGC 5’
5’-3’ primer sequencesF - atgccR - cggat
Primer design exercise• You will be provided a hand-out with the DNA
sequence for Salmonella enteritidis invA
• Design a set of primers to amplify a 600 base pair region of this gene
• Write down the sequence of both your primers in the 5’ to 3’ orientation (requested by primer synthesis companies)
• Calculate G+C content for your primers to make sure they are similar
Lecture 34 PCR Product Detection
FS 362
Components in a PCR Reaction
•••••••
Cycling Temperatures
?°C
?°C
?°C ?°C
?°C
1-2 min
1-2 min
1-2 min 5-7 min
∞
?°C
2-10 min
25-40 cycles
*Denaturation
*Annealing
*Extension
*Initialdenaturation *Final extension
DNA Quantity & Quality
• Presence/Absence of DNA target and PCR product Agarose Gel Electrophoresis
• Quantity of DNA target & PCR Nanodrop, Bioanalyzer
• Quality of PCR product Bioanalzyer, Nanodrop
PCR Product EvaluationBefore a PCR product is used in further applications
(e.g., DNA sequencing) we need to make sure:
– There are bands; not every PCR is initially successful and optimization is usually required
– The bands are the correct size; it is possible for primers to anneal to an untargeted location on the genome
– There is only one band per reaction; if primers fit on other parts of the genome multiple non-specific bands may be present
Detection & Analysis of PCR Products
• Agarose gel electrophoresis
• PCR products visualized when stained EthidiumBromide (EtBr)
• EtBr intercolateswith DNA bases & fluoresces upon exposure to UV light
Agarose gels
• Cast by melting agarose in buffer until solution is clear– Pre-cast gels are commercially available
• Gel casting tray contains combs to create wells• Upon cooling, agarose solidifes
– Density of agarose matrix determined by concentration of agar in solution
• Negatively-charged DNA migrates through the gel matrix when electric field is applied.
DNA Migration in Agarose Gels
• Molecular size of DNA– Larger molecules migrate more slowly than
smaller molecules• Larger molecules experience more friction• Larger molecules wiggle through pores in
agar matrix slower• Agarose concentration
– Lower concentrations allow better separation of large fragments
– Higher concentrations allow better separation of smaller fragments
DNA Migration in Agarose Gels
• Voltage – At low voltage, rate of DNA fragment migration is
proportional to voltage applied– As voltage increases, range of fragment separation
decreases• Electrophoresis buffer
– Buffers stabilize pH and provide ions for conductivity– Composition and ionic strength of electrophoresis buffer
used to make agarose gel affects mobility of DNA
DNA Migration in Agarose Gels
• Molecular size of DNA– Larger molecules migrate more slowly than
smaller molecules• Larger molecules experience more friction• Larger molecules wiggle through pores in agar
matrix slower
• Voltage applied– At low voltage, rate of DNA fragments migration is
proportional to voltage applied– Range of separation of fragments decreases as voltage
increases• Electrophoresis buffer
– Buffers stabilize pH and provide ions for conductivity– Composition and ionic strength of electrophoresis
buffer used to make agarose gel affects mobility of DNA
DNA Migration in Agarose Gels
Staining DNA in Agarose Gels
• Ethidium bromide– Contain planar group that intercalates between
stacked bases of DNA– Ethidium bromide dye bound to DNA shows
increased fluorescence than dye in free solution
– DNA can be detected in the presence of free ethidium bromide in gel
Agarose Gel Electrophoresis of PCR Products
pGEM N301 N302 N303 N304 N305 N306 N307 N308 N309 +con -con pGEM
DNA & Spectrophotometry
• DNA absorbs light at 260nm• Protein absorbs light at 280nm• Salts, phenol, EtOH absorb light at 230nm
Greater the absorbance, the greater the concentration
• 260/280 ratio indicator DNA purity• 260/230 ratio indicator of residual salts
Nanodrop Spectrophotometry
Nanodrop Results
Quality
• Spectrophotometry can’t determine if DNA target or PCR product is dsDNA (intact DNA)
• Alternative methods are required to determine DNA integrity Agilent Bioanalyzer
• Gel on a chip
Agilent Bioanalyzer Overview
Agilent Bioanalyzer
Listeria monocytogenes total RNA
PCR-based foodborne pathogen detection methods & applications in
the food industryFS 362
Review
• What is polymerase chain reaction (PCR) and what is the purpose of this reaction?
• What role does temperature play in PCR?
• What role do primers play in PCR?
• Characteristics of well-designed primers.
• 5 ways to optimize a PCR reaction.
Today
• PCR platforms• Advantages/Disadvantages of PCR detection
systems• Characteristics of high quality assays• Good Laboratory Practices
The Central DogmaDNA
mRNA
Protein/Enzymes
Toxins & other metabolites
Molecularmethods
Classicalmethods
DNA replication
Translation
Transcription
Post-translation
DNA-based detection by PCR
• Detects chromosomal or extra-chromosomal DNA (i.e. plasmids)
• Advantages: –––
• Disadvantages:––
DNA
DNA-based detection by PCRDNA
mRNA
DNA replication
Transcription
Examples used in industry
• hly assay for Listeria monocytogenes– Listeria spp. v. L. monocytogenes
• invA assay for Salmonella– Salmonella v. non-Salmonella
• Multiplex for STEC – Detection of multiple genes required to identify
strain likely to cause severe disease
Multiplex PCR
• Used to target multiple genes in a single test– Advantages
• More information from a single test• Use less reagents/consumables• Save on time
– Disadvantages• Requires time for optimization
• Single PCR reaction that contains multiple, unique primer sets– Each primer set must amplify fragments of varying sizes specific to different
DNA sequences – Annealing temperatures for each primer set must be similar in order to work
correctly within a single test
Multiplex & STEC
stx1 = 534 bpstx2 = 384 bpeaeA = 255 bpEHEC hlyA = 180 bp
• stx2 > stx1• eaeA required• hlyA required
RNA-based detection by PCR• Reverse-transcriptase
PCRDNA
mRNA
Protein/Enzymes
Toxins and other metabolites
Reverse transcriptase
cDNA
RNA-based detection by PCR
• Advantages:––
• Disadvantages:––
DNA
mRNA
Reverse transcriptase
cDNA
Applied Biosystems Salmonella & L. monocytogenes Rapid Detection System
Step 2
Step 3 RT-PCR
Step 4: Analysis
Real-time PCR• Works just as conventional PCR does except:
– Involves fluorescent dye(s)– Data collection throughout the PCR process
• Allows detection of target in real time during DNA amplification
PCR Chemistries Used to Detect Foodborne Pathogens
• SYBR Green• Hydrolysis probe-based (e.g., TaqMan)• Molecular Beacon• Scorpion
SYBR Green• Binds to double-stranded DNA
– Binds to minor groove of dsDNA– Prefers G and C base pairs
• Light is emitted upon excitation– Optimal excitation/emission wavelengths of 497/520 nm
• Advantages– Inexpensive, easy to use– Minimal effort to design– Works well with a single defined target
• Disadvantages– Binds to any double-stranded DNA
• Primer dimers• Non-specific products
– Dissociation curve or melt curve must follow the PCR protocol
Idaho Technoloogy Inc.
Melt curve analysis
EXAMPLE:• BAX system for detection of
L. monocytogenes or Salmonella
Probe-based PCR: Principle of FRET• Fluorescence Resonance Energy Transfer• Quencher dye and reporter dye
– The excited reporter dye transfers energy to a quencher dye rather than fluorescing
– Quencher dye must be in close proximity to a reporter dye in order to have a “quenching” effect
Close proximity Separation
Reporter/donor excitation
QuencherReporter
Hydrolysis probe-based PCR• Also referred to as TaqMan assay• Takes advantage of 5’→3’ exonuclease activity of Taq
Labeled probe hybridizes to DNA target sequence
Intact probe, the reporter does not fluoresce
Taq cleaves the fluorogenictag from the probe
RT-PCR
Multiplex Real-Time PCR
TET
FAM
Cy5 Texas Red
Probe-based real-time PCR
• Advantages– Increased specificity– Able to detect multiple targets– Allows for quantification– Faster than conventional PCR
• Disadvantages– Expensive to synthesize
PCR Controls
• PCR Controls– Negative – Use water as the “template”– Positive – DNA that will give the expected result
• Internal or amplification control– Monitor for PCR inhibition
• Reverse-transcriptase PCR– RT-negative control – Sample with no reverse
transcriptase enzyme– Indicator for level of contaminating genomic DNA
How to evaluate PCR detection methods (i.e., LIFE SKILLS)
• What is the target gene?– How/why was it chosen– What data are available to support the choice
• Virulence data? Sequence data?
• What is the target molecule?– DNA? mRNA? rRNA?– How is expression of mRNA assured?
• What is the assay and assay format?– PCR, other amplification method, detection
without amplification (e.g., ACCUPROBETM)
How to evaluate molecular detection methods II
• How was the assay validated– Pure cultures, spiked foods, or “real samples”
• What isolates or samples were used• What was used as “gold standard”
- What are the most likely reasons for false positives and false negatives- What does a false negative most likely mean (e.g., does it
suggest an avirulent variant) - How does the assay perform in the presence of
competitive microflora - What controls are included in the assay
- Internal positive control?
Good Laboratory Practices for PCR
• Separate pre-PCR and post-PCR activities– Perform in physically separate areas– Minimize potential contamination with amplified
product– PCR can be set up in sterile hood to minimize
contamination issues. • Use aerosol resistant pipette tips
– Use new pipette tips when transferring samples– Prevent aerosolization when ejecting the tip
• Use powder-free gloves– Change gloves frequently
GLPs for PCR
• Spin tubes (e.g., sample tubes) briefly to bring contents away from lid– Avoid touching rim/inside lids of tube to
ensure no cross-contamination occurs.
• Work slowly – do not rush• Adequately chill cooling blocks before use.• Minimize freeze/thaw cycles for frozen
reagents.
DNA Sequencing
DNA sequencing• Biochemical process to determine of the order
of nucleotide bases – Chemical degradation
• (Maxam and Gilbert, 1977)
– Enzymatic synthesis• Sanger Method (Sanger et al., 1977)
• Generate sequences that begin at fixed point and terminate at a particular type of residue (A, T, G or C for Sanger Method)
DNA sequencingSanger method has served as the workhorse of
DNA sequencing projects for the past 30 years– Human genome sequencing project– >900 microbial genome sequences available– Multiple genome sequences available for many
foodborne pathogens• >20 genome sequences available for Listeria
monocytogenes
DNA sequencing
• Sequencing relies on DNA chain termination by dideoxynucleotide triphosphates (ddNTPs)
Cycle sequencing demonstration
DNA sequencing• Termination points are nucleotide specific but
occur randomly along length of target DNA• Generates many fragments of different lengths• Fragments resolved by electrophoresis
– Discriminate DNA’s that differ in length by as little as a single nucleotide
– Four populations loaded into adjacent lanes of sequencing gel, order of nucleotides along DNA can be read from gel image
Classic Sanger sequencing
• Sequencing performed in four separate reactions each containing one of the four ddNTPs
• Run on adjacent lanes in a denaturing polyacrylamide gel
• Short runs and can be difficult to interpret
Automation of Sanger Method• Cycle sequencing/Dye-terminator• 15-40 rounds of conventional thermal cycling
– Denaturation of double stranded DNA– Annealing of primer to sequence– Extension of primer by thermal stable DNA polymerase– Termination of extended strand by ddNTP incorporation
• Fluorescent dyes to ddNTPs that become incorporated to 3’ end of sequencing reaction products– Same primer in a single tube
• Capillary electrophoresis
Electropherograms
DNA sequencing success• Key to consistent successful cycle sequencing
is cleanliness of DNA template– Impurities (e.g., agarose, salts, proteins) cause
premature termination and pausing of DNA polymerase
– Degraded DNA cause false priming• DNA template should be purified and the
quantity and quality of DNA template should be assessed prior to submitting samples for sequencing
Illumina Sequencing by Synthesis
See link to URL on blackboard
Ion Torrent (Personal Genome Maching (PGM))
http://www.iontorrent.com/the-simplest-sequencing-chemistry/
Pulse Field Gel Electrophoresis
Introduction to PFGE
• DNA – Genetic information of an organism
• Chromosomal DNA – Sequence specificity for each species and even strain– Circular DNA molecule within bacterial cell– Carries all “normal” genes employed for growth and other
practical functions
2
Introduction to PFGE• Chromosome size variety of base pairs and genes for
bacteria:Bacteria Chromosome size (base pairs) Estimated number of genes
Escherichia coli 4,639,211 4,279
Campylobacterjejuni
1,641,481 1,654
Bacillus subtillus 4,214,814 4,112
SalmonellaTyphimurium
4,857,432 4,450
Listeria monocytogenes
2,866,709 2,873
3
Introduction to PFGE• Chromosome size variety of base pairs and genes for
L. monocytogenes:
• How does one differentiate between strains in a rapid manner?
L. monocytogenesstrain
Chromosome size (base pairs)
Estimated number of genes
10403S 2,866,709 2,873EGD-e 2,944,528 2,867
FSL J1-194 2,986,227 3,692FSL-J2-071 3,149,923 3,373FSL R2-503 3,001,696 4,767
4
What is PFGE?
• Pulse Field Gel Electrophoresis– Molecular method to produce a genetic “fingerprint” or
profile of a bacterial isolate– Creates and visualizes segments of DNA from a bacterial
sample to be compared with other samples– Achieved through breaking of chromosomal DNA into
segments by *restriction enzymes*– Advanced method of gel electrophoresis
5
PFGE Background
• First introduced in 1984 by Schwartz &Cantor in Cell 37:67-75– Described a way to differentiate yeast chromosomes
• Segment chromosomal DNA, utilize non-uniform electric current, compare DNA band profile
– Looked for a way to visualize segments of DNA• Old size limit (50 kilobase)• PFGE capability (10 megabase)
6
PFGE Applications
• Food Safety– Epidemiological studies– Tracking of outbreak strains
• Food Quality– Monitoring subtle changes in fermentation cultures
• Yogurt, beer, wine industries
7
PFGE Applications• Cancer Research
– Observations on dsDNA structure alterations by suspect carcinogens
– Changes in DNA density for specific molecular weight regions indicate structure alterations
• Genomics– Cloning fragments to be sequenced can be separated using
PFGE– DNA fingerprinting and physical chromosome mapping– Location of promoter sites due to DNase sensitivities with
chromatin
8
PFGE Applications
• Epidemiological studies and strain differentiation– Agencies such as PulseNet utilize PFGE to identify similar
or different bacterial strains to:• Differentiate food-related clinical cases based upon suspect
pathogen strain• Allows for accurate tracking of outbreak allowing for source
identification• Goal of improved food safety for the public
9
Segmentation of DNA
• Nuclease – enzymes that breakdown strands of nucleic acids
• Two ways to cut or “restrict” DNA to segments– Exonuclease
• Works from the outside inwards, essentially dismantling DNA piece by piece
• Systematically removes one nucleotide at a time from the end of dsDNA
• Two versions of exonucleases (3’ to 5’ and 5’ to 3’) used to “clean up” polymerase products and other processes
– Endonuclease
10
Restriction Endonucleases (RE)• Cutting or restriction of dsDNA from within the
molecule– RE works at a specific recognition site
• Recognition site is a specific sequence of nucleotides that are identified and cut leaving fragments
11
Restriction Endonucleases
• RE’s read through dsDNA from 5’ to 3’ ends on both strands (palindromes) until digestion site is recognized
• Thousands of different RE’s identified, some repetitive (same recognition site as another RE, called isoschizomers)
• Activity effected by – pH– Ionic strength– Temperature
• Altered activity by changing the above conditions results in slight alterations in recognition sites (referred to as star activity)
12
Restriction Endonucleases
• Employed in PFGE to “randomly” break the chromosome into fragments to be visualized following electrophoresis
• The same RE is used for all samples to be compared (should be the same bacterial species)– Comparison between Listeria monocytogenes isolates from
the same outbreak would use ApaI or AscI (example RE’s)
13
DNA Orientation and Subsequent Digestion
Supercoiled Chromosomal DNA
RE Digestion of DNA
14
DNA Visualization through Gel Electrophoresis• Traditional electrophoresis
– One dimensional application of electrical field– DNA sample size < 50 kb can accurately be visualized– Cause of method restrictions:
• One direction voltage application and strength• 1.0% and higher agarose is too complex/thick to allow large
molecules (> 50kb) to move at different rates meaning one band represents multiple segments
DNA FragmentsGel Particle
Pore
15
DNA Visualization through Gel Electrophoresis
• Pulse Field GE– Two dimensional application of pulses– Variation in direction of electrical fields
• These electric fields are altered throughout the same electrophoresis run
• Time between shifts or pulses allows for reorientation
– Avoids the limitations of molecular sieving by forcing the molecules to reorient themselves upon shifts in directions
• Application in one direction, pause, reorientation, application in another direction, repeat
• Causing zigzag transversals
16
Comparison of Electrophoresis Fields
_
+
Traditional PFGE
17
Field Inversion Gel Electrophoresis (FIGE)
• Periodical inversion of polarity of electrodes – Shift in pulse application at 180°– Molecules spend part of the time moving backwards
-/+
+/- 18
Transverse Alternating Field Electrophoresis (TAFE)• Employment of two different electrode groups
creating simple geometrical pulse angles• The pulse angle increases as the molecule moves
downwardsA (-)
A (+)B (+)
B (-)
19
Rotating Gel Electrophoresis (RGE)
• RGE is a new form of PFGE• Instead of having multiple or altering charges of
electrodes, the gel itself is moved
_
+ 20
Clamped Homogenous Electrical Field (CHEF)
• Most commonly used form of PFGE
• Applies multiple pulses from varying sources to create additional vectors
• Varying angles result in increased accurate separation and more clear resolution
21
Visualization
• Similar to PCR product visualization, following electrophoresis, PFGE gels are:– Stained with ethidium bromide– Visualized through exposure to UV light
22
Pulse Field Gel Electrophoresis Performance
Review of PFGE Theory
• PFGE– Production of a genetic “fingerprint”
• Creation of large genomic DNA fragments following restriction enzyme digestion
• Such fragments are visualized following gel electrophoresis• Comparing between lanes on the resultant gel allows for:
– Differentiation between strains – Designation of same strain samples
2
Steps for PFGE
1) Culture Preparation and Standardization2) Sample Treatment3) Sample Suspension/”Plug” Preparation4) Restriction Enzyme Digestion5) Pulsed Field Gel Electrophoresis6) Visualization7) Comparison
3
Culture Preparation• Physical removal of a pure culture from agar plate• Resuspension of culture in TE Buffer• Standardization of culture suspension
– Standard quantity of bacteria/mL– Less bacteria is more
• Increased lysis efficiency, increased resolution and sharpness of bands, similar band intensities
4
Sample Treatment• Cell suspension is treated to liberate DNA for further
manipulation– Lysozyme for cell wall digestion
• Hydrolyzes the 1,4-β-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in the peptidoglycan layer
– Proteinase K for degradation of proteins and inactivation of enzymes (DNases, RNases, etc.)
• Cleaves peptide bonds next to carboxyl groups of amino acids
Egg – source of LysozymeEngyodontium album – mold source of Proteinase K
5
Plug Preparation
• A “plug” refers to the physical suspension of the lysed bacterial sample in mixture of:– 1.5% Agarose– 1% Sodium Dodecyl Sulfate
• Detergent aiding in cell lysis steps previously described• Aids effectiveness Proteinase K
• Addition of agarose/SDS mixture to cell suspension– Can either have Proteinase K in cell suspension or plug
preparation• Placement of mixture into a mold to form a plug
6
What is a “plug”?• Comparison of plug
quality:
2mm width
7
Restriction Enzyme Digestion
• Restriction endonucleases employed to cut/digest DNA molecules at specific points (recognition sites)
• Plug treatments– Plug samples are submerged in RE mixture:
• RE• Buffer• Water
– Buffer type and treatment temperatures are specific for the RE used
• Thorough washing following RE treatment following treatment
8
Restriction Enzyme Digestion
• Reaction Conditions for high specificity (accurate restriction site location)– Buffer
• Provides adequate levels of ionic strengths (Na+, K+, Mg2+)• ~pH 8.0
– Temperature• Efficacy of digestion dependent on temperature of reaction• Related to ideal temperature for organism RE was isolated from
– Ex: RE from a thermophilic bacteria has an ideal temp above 50˚C while an RE from E. coli has an ideal temp at 37˚C
– Residual glycerol (>5%) effects reaction• RE shipped in glycerol
– Concentration of RE• Ideal ~ 40U
– Concentration and purity of DNA sample• Incorrect or partial digestions
– Addition of Bovine Serum Albumin (optional)• Protein shown to aid in binding and specificity
9
Restriction Enzyme DigestionRE Concentration
10U 20U 40U
Asc1 Apa1
Asc1 Apa1
10
Restriction Enzyme Choices
• Overall goal of PFGE: – Comparison of sample fingerprints to determine strain
identities and differentiation
• Accepted practice to do 2 different PFGE runs with at least 2 different RE’s
• RE pairs for specific pathogens have been determined and commonly used– Ex: L. monocytogenes – AscI and ApaI
• Common RE’s published by PulseNet
11
Gel Preparation• Thought PCR gel preparation and loading was challenging?
– Ensure level surface for pouring the gel– Placement of plug into agarose gel– Placement of plug onto comb prior to gel pouring (alternative)
• Following placement of plug in gel, fill in the hole with molten agarose to seal off chamber hole– Prevents the plug from floating out
12
PFGE Performance• Finally, time to run the actual electrophoresis• Components:
a. Gel Chamberb. Pumpc. Chillerd. Chef Mapper Pulse Source
a. d.
c.b.
13
Component Purposes
• Gel Chamber:– Application of pulses from electrodes– Hold gel in centralized locale
• Pump:– Continuously moves recycled buffer through the chamber
• Chiller:– Maintains temperature of buffer and therefore of gel in
chamber• Chef Mapper Pulse Source
– Applies programmed pulses, times, application profiles
14
Important Parameters• Pulse Angles
– Smaller angle of pulse application results in better separation of larger DNA molecules
• Ex: 106˚ vs. 180˚• Smaller molecules crammed together at the end of the run
– Larger angle of pulse application results in better separation of smaller DNA molecules but no separation of larger molecules
– Ideal compromise angle = 120˚
• Run Time– 19 to 24 hrs
15
Important Parameters
• Switch Times – Interval between
alternation of electric fields
• Consider enough time for molecule to reorient itself
• Switch Time Ramping– Altering the amount of
switch times over the length of the electrophoresis run
• Ex: Initial switch time at 30sec; Final switch time at 120sec
– Linear vs. Non-linear Ramping
45 sec 60 sec 90sec
16
Linear vs. Non-linear
17
Important Parameters• Voltage
– Strength of electrical field (pulses) in V/cm units• Large value – faster run, fine for small molecules• Small value – slower run, better resolution for large molecules• Compromise at 6 V/cm
– V/cm – Voltage applied over the distance between the electrodes applying pulses
• Ex: 200V/33cm = ~6V/cm
• Buffer Concentration– TBE 0.5X common
• Increase ionic strength = slower migration • Decrease ionic strength = faster migration, poorer quality
• Buffer Temperature– ~25˚C = fastest run times, poorest resolution and band separation– ~4˚C = slowest run times, best resolution and separation– ~14˚C = compromise, most commonly used
18
Visualization and Comparison• Ethidium Bromide
staining and UV visualization – Same as PCR
• Comparison of lanes– Use of BioNumerics
software to select lanes and produce statistical compatibility
19
Standards• PCR
– Employment of a ladder standard to quantify band size
• PFGE– Employment of universal strain as a standard
• Quantification of band size • Comparison with other PFGE profiles previously run• Allows for universal nature of gels and normalization on specific
band patterns• Standard strain – Salmonella serotype Braenderup H9812
– Digested with specific RE (Xba1)– Range of 20 to 1200kb
20
PFGE Conclusions
• PFGE is a common technique used to create a genetic fingerprint of a sample (bacteria, yeast, etc.)– Plethora of variability in parameters and conditions– Standard procedures for conditions stated by PulseNet
• Genetic fingerprints are compared to determine if samples are the same or different
• Generated similarity used to ID and track outbreak strains as well as other applications– PulseNet and other investigative bodies
21
Pulse Field Gel Electrophoresis;PulseNet
PulseNet
• PulseNet:– Responsible agency for investigating foodborne-related
outbreaks– Employs PFGE to type and store all outbreaks in recent history
for comparison and epidemiological work– Drives early ID of outbreak sources– Standardizes all procedures for molecular fingerprinting– Coordinated by the Center for Disease Control (CDC)– Collaborates with:
• State and local health departments along with other federal agencies (FDA, USDA, FSIS, CDC)
– http://www.cdc.gov/pulsenet/whatis.htm
2
PulseNet- Take on PFGE
• Positives– More discriminating
than ribotyping– Outside of RE choice,
entire process is universal for all bacteria
– Proven to be very reproducible
• Negatives– Time-consuming– High level of skill and
experience required– Bands are not sequences– Same bands are not
necessarily same DNA sequence
– Relatedness are guides not necessarily phylogenic proof
3
Optimization
• PulseNet driving improvement of PFGE– Standardization
• Protocols• Software• Equipment• Nomenclature of patterns
– Promote workshops for PFGE use
– Annual update symposia– Participants required to
be certified and trained
• Improvement to PulseNet itself– Increase participants– Real-time subtyping and
communication• Clinic to lab• Lab to isolate
differentiation• Isolate to profile
– Food industry?– International?
4
PulseNet International
• International organization spawning from PulseNet in the United States
• Agencies related to Public and National Health Agencies in foreign countries
• Collaboration between nations and research groups to investigate global outbreaks
5
6
PFGE Gel Interpretation
7
PFGE Gel Interpretation
8