Functional characterisation of the regulatory subunit of cyclic

AMP-dependent protein kinase A homologue of Giardia lamblia:

Differential expression of the regulatory and catalytic

subunits during encystation*

Candace Gibson, Brian Schanen, Debopam Chakrabarti, Ratna Chakrabarti *

Department of Molecular Biology and Microbiology, University of Central Florida, 12722 Research Parkway, Orlando, FL 32826, USA

Received 1 September 2005; received in revised form 19 November 2005; accepted 25 November 2005

Abstract

To understand the functional roles of protein kinase A (PKA) during vegetative and differentiating states of Giardia parasites, we studied the

structural and functional characteristics of the regulatory subunit of PKA (gPKAr) and its involvement in the giardial encystment process.

Molecular cloning and characterisation showed that gPKAr contains two tandem 3 05 0-cyclic adenosine monphosphate (cyclic AMP) binding

domains at the C-terminal end and the interaction domain for the catalytic subunit. A number of consensus residues including in vivo

phosphorylation site for PKAc and dimerisation/docking domain are present in gPKAr. The regulatory subunit physically interacts with the

catalytic subunit and inhibits its kinase activity in the absence of cyclic AMP, which could be partially restored upon addition of cyclic AMP.

Western blot analysis showed a marked reduction in the endogenous gPKAr concentration during differentiation of Giardia into cysts. An

increased activity of gPKAc was also detected during encystation without any significant change in the protein concentration. Distinct

localisations of gPKAc to the anterior flagella, basal bodies and caudal flagella as noted in trophozoites were absent in encysting cells at later

stages. Instead, PKAc staining was punctate and located mostly to the cell periphery. Our study indicates possible enrichment of the active gPKAc

during late stages of encystation, which may have implications in completion of the encystment process or priming of cysts for efficient

excystation.

q 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Giardia; PKA; Regulatory subunit; Kinase activity; Localisation; Expression; Encystation

1. Introduction

Giardia parasites are common unicellular water-borne

intestinal pathogens that experience two life cycle stages.

Giardia cysts, the infective and propagating stage, are ingested

through contaminated water and when exposed to acidic pH in

the stomach and proteinases in the upper small intestine excyst

to release vegetative trophozoites, the replicative form.

Trophozoites colonise the intestine, replicate and remain

attached to the mucosal cells through their adhesive discs

(Adam, 1991, 2001; Lewis and Freedman, 1992). Detached

0020-7519/$30.00 q 2006 Australian Society for Parasitology Inc. Published by E

doi:10.1016/j.ijpara.2005.11.008

* Nucleotide sequences reported in this paper, are available in GenBank

database under accession number AY662690.* Corresponding author. Tel.: C1 407 882 2258; fax: C1 407 384 2062.

E-mail address: rchak@mail.ucf.edu (R. Chakrabarti).

trophozoites pass through the lower small intestine, sense the

altered environmental conditions and encyst.

Encystation is a biological process for adapting to adverse

environmental conditions as cysts pass into the environment in

faeces. The physiological signal for Giardia encystation has

not yet been defined but in response to cholesterol starvation

Giardia trophozoites undergo rapid cellular changes to

differentiate into cysts (Lujan et al., 1996). The encystment

process is initiated by a signal transduction event which

triggers transcriptional changes in Giardia. This leads to

translational activation of key proteins and onset of a series of

events including endoreplication and nuclear division to

achieve a ploidy of 16 (4 N per nuclei, four nuclei) (Bernander

et al., 2001), synthesis of cyst wall protein (CWP; Lujan et al.,

1996), biogenesis of encystation-specific vesicles (ESV;

McCaffery and Gillin, 1994; Reiner et al., 2001; Lanfredi-

Rangel et al., 2003) for transporting CWP to the cell membrane

International Journal for Parasitology 36 (2006) 791–799

www.elsevier.com/locate/ijpara

lsevier Ltd. All rights reserved.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799792

(Marti et al., 2003) and assembly of the cyst wall (Ali and Hill,

2003). Although much information on encystation of giardial

trophoizoites has been acquired in the last few years, in-depth

understanding of the signaling processes to induce encystation

is still lacking.

Cyclic AMP (cAMP)-dependent protein kinase A (PKA)-

mediated signaling is one of the major pathways operative

during cell differentiation (Marques Mdo et al., 1992; Mann

et al., 1994; Telgmann et al., 1997; Cassano et al., 1999; Pan

and Heitman, 1999; Zhao et al., 2004). In vertebrates and

invertebrates, PKA function is tightly regulated by ordered

expression and interaction of various isoforms of the catalytic

(C) and regulatory subunits (R) (Herberg et al., 1996). The C

subunit of the holoenzyme is held in an inactive form by

association with the R subunit until the intracellular concen-

tration of cAMP increases in response to extracellular signals.

Binding of cAMP to the two cAMP-binding domains of the R

subunit dissociates the C subunit, which becomes catalytically

active to phosphorylate key proteins essential for induction of

cell differentiation (Mann and Firtel, 1993).

The functional specificity of PKA is largely dependent on

targeting of the C subunit to the proximity of specific substrates

at precise locations in the cells. This is accomplished by the

A-kinase-anchoring-protein (AKAP) family, which are bound

to subcellular structures and recruit PKA through interaction

with the R subunit. In mammalian and other eukaryotic cells

two distinct isoforms PKAI and PKAII have been identified

that are selectively localised to the intracellular structures

(Barradeau et al., 2002). In lower eukaryotes, cAMP-

dependent signaling is often mediated through a single type

PKA (Primpke et al., 2000; Shalaby et al., 2001; Syin et al.,

2001). The single R subunits from Saccharomyces cerevisiae

and Caenorhabditis elegans show homologies with RI and

partially with RII subunits of the mammalian PKA (Lu et al.,

1990; Pan and Heitman, 1999).

The structural features retained by all R subunits include an

autoinhibitor site at the N-terminal end that resembles either a

pseudosubstrate- or an inhibitor-binding site. This autoinhi-

bitor site binds the active site of the C subunit and acts as a

competitive inhibitor of the substrates of PKA C subunit (Su

et al., 2003). The C-terminal end of the R subunit contains two

cAMP binding domains A and B. In metazoans (except

C. elegans), PKA contains two isoforms of the R subunit RI

and RII which respond to intracellular cAMP at different

intensity. PKA RI has a higher binding affinity to cAMP and

thereby responds to low cAMP concentration while PKA RII

needs a higher cAMP concentration to become dissociated

(Barradeau et al., 2002).

Our previous studies have shown that a functional Giardia

ortholog of cAMP-dependent PKA is essential for Giardia

excystation and that gPKA C subunit colocalises with centrin

to the basal bodies and anterior flagella, the structures involved

in generating force for flagellar movement (Abel et al., 2001).

Here, we report structural and functional characteristics of the

Giardia homolog of the R subunit, interaction between the C

and R subunits and possible involvement of PKA in Giardia

differentiation into cysts.

2. Materials and methods

2.1. Maintenance of giardia culture and encystation

Giardia lamblia (WB clone C6 ATCC. No. 50803)

trophozoites were maintained in TYI-S-33 medium (pH 7.1)

(10% calf serum and 0.75 mg/ml bovine bile) at 37 8C.

Encystation was induced using a modified method described

by Kane et al. (1991). Briefly, cells were grown to confluency

in TYI-S-33 (pH 7.1) medium and the attached trophozoites

were exposed to encysting medium (TYI-S-33 with 10 mg/ml

bovine bile, pH 7.8) for the specified time. Encysting cells were

harvested at different times and used for subsequent

experiments.

2.2. PCR amplification and screening of a cDNA library

Initially, a 1.1 kb fragment of the regulatory subunit of PKA

(gPKAr) was PCR amplified using giardial genomic DNA and

primers (Forward 5 0AGCGCCCTGACAGAAACCTAT3 0 and

Reverse 5 0TGCAGCCTCACCGAAGTAAC3 0). Primers were

designed using the sequence information available from the

Giardia genome sequence database (http://www.mbl.edu/

Giardia) maintained at the Marine Biological Laboratory in

Woods Hole, Massachusetts. The amplified DNA fragment was

sequenced and used as a probe for screening a Giardia lZapII

cDNA library made in our laboratory. The probe was

radiolabeled using a strand specific primer, [32P]-dATP

[3000 Ci/mmol, 10 mCi/ml] and the Prime-It II kit (Stratagene)

according to the manufacturer’s protocol. A 1.42 kb fragment

containing a coding sequence of 1383 bp was isolated and

subjected to PSI BLAST analysis of the NCBI database. The

sequence was further analysed by a multiple sequence

alignment using the Megalign program of DNASTAR

(Madison, WI) software and a motifs scan against the PROSITE

database (Falquet et al., 2002).

2.3. Expression and purification of recombinant protein

The open reading frame (ORF) of gPKAr was cloned into

the T7 polymerase-driven bacterial expression vector pET41

(Novagen) between Pst1 and EcoRI sites. The ORF of gPKAr

was amplified using primers (Forward 5 0AGCCTGCAG

GTCAAGGGCGGCAACC3 0 and Reverse 5 0CCGAATTC

ATGGAACCCA CCACCG3 0) containing the restriction sites

for cloning. BL21 (DE3) Escherichia coli cells were

transformed using the expression constructs and induced with

1 mM isopropyl beta thioglactopyranoside (IPTG) (gPKAr) to

express the recombinant proteins as GST-6XHis and S-tagged

(gPKAr) fusion proteins. His-tagged recombinant gPKAc was

expressed using 0.5 mM IPTG as described previously (Abel et

al., 2001). Expressed proteins were purified through cobalt

affinity column (TALON superflow resin, Clontech Labora-

tories) and used for subsequent assays and generation of rabbit

polyclonal antibodies (gPKAr) through a commercial vendor

(CoCalico, Reamstown, PA). The GST-His and S-tagged

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799 793

(pET41 PKAr) sequences added 38 kDa of molecular mass to

the fusion proteins.

2.4. Western blot and His-tag pull-down assay

Crude cell extracts (50 mg) from trophozoites and encysting

cells at different time points were prepared in 100 mM Tris, pH

7.0 containing protease inhibitors [10 mM Tris acetate, 1% NP-

40, 100 mM NaCl, 1 mM sodium orthovanadate, 1 mM

phenylmethanesulfonyl fluoride (PMSF), 1 mg/ml leupeptin

and 2 mg/ml aprotinin] and used for immunodetection of

endogenous PKAr and PKAc using anti-gPKAr and -gPKAc

rabbit polyclonal antibodies, respectively. Expression of

CWP1 in encysting cells was detected by immunoblot analysis

using anti-CWP1 monoclonal antibody (kindly provided by Dr

Henry Stibbs, Waterborne, Inc.). Positive signals were detected

using a chemiluminiscence kit (Pierce Rockford, IL) and an

anti-rabbit horseradish peroxide (HRP)-conjugated secondary

antibody. For gPKAc and gPKAr interaction assays, purified

6!His tagged PKAc or purified 6!His tagged PKAr (30 mg)

was diluted in 500 ml protein binding buffer [50 mM NaH2PO4,

300 mM NaCl, 20 mM imidazole, pH 8.0], mixed with Ni-

NTA magnetic agarose beads (50 ml) (Qiagen) and incubated at

4 8C for 1 h. Next, beads were separated and suspended in

500 ml of interaction buffer [50 mM NaH2PO4, 300 mM NaCl,

20 mM imidazole, 0.005% Tween 20 pH 8.0]. Five hundred

micrograms of crude extracts were added to the beads and

incubated for 1 h at 4 8C. Bead-bound complexes were then

washed thoroughly in interaction buffer and eluted in 50 ml

elution buffer [50 mM NaH2PO4, 300 mM NaCl, 250 mM

Imidazole, 0.005% Tween 20, pH 8.0]. The eluted complexes

were separated in 10% SDS-PAGE gels and the presence of

PKAr or PKAc were detected by Western blot analysis using

anti-gPKAc or anti-gPKAr polyclonal antibodies.

2.5. Kinase assay

Trophozoites or encysting cells at different time points were

harvested in a lysis buffer containing protease inhibitors

[10 mM Tris acetate, 1% NP-40, 100 mM NaCl, 1 mM sodium

orthovanadate, 1 mM PMSF, 1 mg/ml leupeptin and 2 mg/ml

aprotinin] by freeze–thaw cycles in a dry ice-ethanol bath. The

crude cell lysates were centrifuged at 16,000!g for 20 min at

4 8C and passed through a 0.45 mm syringe filter to remove

cellular debris. The soluble proteins in the supernatant were

used for the kinase assays using kemptide (Calbiochem–

Novobiochem Corp.) as the substrate. Fifty micrograms of

crude extracts were used for the assay in a buffer containing

100 mM Tris, pH 7.5, 5 mM MgCl2, 0.2 mM ATP, 1.8 mCi

[32P]-ATP and kemptide (200 mM) in a 50 ml reaction volume.

The reaction mix was incubated for 30 min at 30 8C. Next,

30 ml of the reaction mix were spotted onto phosphocellulose

disks. Disks were washed with 1% H3PO4 and allowed to air-

dry. Incorporation of radiolabeled phosphates was quantitated

in a liquid scintillation counter (Beckman). In vitro kinase

assays were also conducted using recombinant PKAc

(100 pmol) and kemptide as the substrate with or without

adding varying amounts of purified recombinant PKAr.

Recombinant PKAc and PKAr were extensively dialysed

against a buffer (10 mM Mops, 50 mM NaCl, and 20 mM

MgCl2, pH 7.2) at 4 8C at a molar ratio of 1:0.6 or 1:1.2 to

remove cAMP associated with purified gPKAr (Yu et al.,

2004). Dialysed samples were subject to prior incubation with

ATP at room temperature for 10 min and used for kinase

assays. Similar assays using dialysed samples were done with

prior incubation with cAMP (5 mM) for 30 min at room

temperature. The reaction mix was incubated for 30 min at

30 8C.

2.6. Immunofluorescence analysis of trophozoites and encyst-

ing cells

Giardia trophozoites were inoculated in growth media (TY-

S-33) in 24 well tissue culture plates containing 12 mm glass

cover slips and allowed to grow on the cover slips for 65–70 h

in an AnaeroPack Jar (Mitsubishi Gas Chemical Company,

Inc.) at 37 8C (Abel et al., 2001). At the end of the incubation,

encystment media was added to the wells and coverslips

containing trophozoites were collected at different time-points

(0, 2, 10 and 48 h). Attached trophozoites were then directly

fixed in chilled methanol (K20 8C) and permeablised with

0.5% Triton X-100 in PBS for 10 min at room temperature.

Next, trophozoites were blocked for 1 h in a blocking buffer

containing 10% goat serum, 1% glycerol, 0.1% fish gelatin in

PBS and incubated with polyclonal antibody [PKAc-anti rabbit

1:2500] for 1 h at room temperature. After incubation, the cells

were washed with PBS and incubated with a secondary

antibody [anti-rabbit ALEXA 488 (Molecular Probes) diluted

to 1:800] for 1 h at room temperature. Cells were washed with

PBS and stained with diamidino-2-phenyindole (DAPI)

(0.1 mm) for 5 min. Cells were washed and post-fixed for

7 min with 4% paraformaldehyde (electron microscopy

sciences). Coverslips were rinsed with PBS and then mounted

on glass slides in Gel Mount (Biomeda Corp.). Localisation of

the target proteins was detected in a delta vision restoration

microscope using SoftWoRX image analysis software.

3. Results

3.1. Molecular cloning and characterisation of the regulatory

subunit of giardial PKA

To understand the involvement of the regulatory subunit in

functional activation of giardial PKA we cloned gPKAr. The

cDNA (1.38 kb) contained the ORF of the R subunit (GenBank

No. AY662690). Identity analysis of the translated amino acid

sequence (461 amino acids) indicated a maximum similarity of

37% with the R subunit of PKA from Dictyostelium

discoideum. Multiple sequence alignments and analyses of

the predicted amino acid sequence indicated that gPKAr

exhibits the general characteristics of the regulatory subunit I

from Bos taurus. This includes a degenerate inhibitory

sequence RGRRAAI (RRGAI in B. taurus) and two cAMP

binding domains in tandem (Fig. 1A and Supplementary data).

Fig. 1. Structural analysis of gPKAr by multiple sequence alignment. (A) Box I shows the inhibitory sequence, box II shows cAMP-binding domain A and box III

designates cAMP-binding site B. Asterisks indicate R306 in domain A, and E415 and R424 in domain B. Double asterisk shows replaced D297 in domain A. Triple

asterisks show G242 and V310 in domain A and I390 and Y412 in domain B that are important for cAMP mediated activation. Gl, Giardia lamblia; Dd, Dictyostelium

discoideum (NCBI Acc. No. P05987); Be, Blastocladiella emersonii (NCBI Acc. No. AAA33015); Sc, Saccharomyces cerevisiae (NCBI Acc. No. NP_012231); Cl,

Colletotrichum lagenarium (NCBI Acc. No. AAK31209); Cn, Cryptococcus neoformans (NCBI Acc. No. AAG30146); Tg, Toxoplasma gondii (NCBI Acc. No.

AAK01548); Pf, Plasmodium falciparum (NCBI Acc. No. NP_701584) and Bt, Bos Taurus (NCBI Acc. No. P00514). (B) Putative AKAP binding and dimerisation

domains. Residues important for AKAP binding and dimerisation are in bold. Solid boxes represent conserved and homologous or similar residues. Dotted boxes

represent residues that are conserved but are absent in gPKAr. Asterisks indicate cysteine residues that are crucial for binding to AKAP. Arrows indicate specific

residues critical for docking/dimerisation. AKAP: A-kinase anchoring protein.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799794

The inhibitory sequence and cAMP binding sites are required

for high affinity interaction of the C and R subunits (Vigil et al.,

2004). The in vivo phosphorylation site that is conserved for

mammalian PKA RI subunit (S81) is also present in gPKAr

(KKIT94–97) but contains a T (T97) residue. Sequence analysis

by motif scan predicted that gPKAr contains six putative

N-glycosylation sites (N125, N138, N162, N204 and N425) and one

amidation site (RGRR169–172). Alignment of the cAMP binding

sites indicated that three of the four conserved residues in

cAMP binding domains A (E200 and R209) and B (E324 and

R303) of bovine PKARI, which participate in cAMP binding are

present in gPKAr (R306 in domain A, and E415 and R424 in

domain B). The E residue in domain A is replaced by another

acidic residue D (D297) in gPKAr. The range of residues in

domains A and B (G296-A307 in domain A and G414-A426 in

domain B) that contain multiple contact points between cAMP

and the protein (Su et al., 1995) are present in gPKAr. Among

other residues that are important for cAMP-mediated acti-

vation, G242 and V310 in domain A and I390 and Y412 in domain

B are also present in gPKAr. The N-terminus of the gPKAr

contains a number of conserved residues or conserved amino

acid substitutions (L17, I22, C34 and F49) that are critical for

dimerisation/docking. These residues are also present in bovine

PKARI and C. elegans PKAR (Fig. 1B) (Leon et al., 1997).

There is only one conserved cysteine (C34) residue present in

gPKAr, instead of two (C17 and C38 in B. taurus) that form

disulphide bonds during dimerisation. A number of hydro-

phobic residues are also present within the first 65 amino acids

of gPKAr that are similar or showed conserved substitutions

for AKAP binding and dimerisation domains of bovine PKARI

(Fig. 1B, boxed). Alignment of the full-length amino acid

sequence of gPKAr is provided as Supplementary data.

3.2. Giardial PKA R subunit interacts with the C subunit

and inhibits the catalytic activity of gPKAc in vitro

Because the functional activation of PKA depends on its

interaction with the R subunit we studied their physical

interaction. The specificity of the gPKAr rabbit polyclonal

antibody was confirmed by Western blot analysis using

recombinant PKAr and crude trophozoite extracts. These

yielded single peptide bands of 82 kDa similar to the molecular

weight of the glutathione-S-transferase fusion protein (Fig. 2A)

and a 50 kDa peptide band similar to the predicted molecular

weight of the endogeneous PKAr (Fig. 3B). Western blot of the

crude trophozoite extract was conducted using different

dilutions of the antibody to confirm the authenticity of the

gPKAr antibody. For pull-down assays, magnetic bead-bound

Fig. 2. Immunoblot analysis of gPKAr and interaction between catalytic and regulatory subunits. (A) Lane 1, molecular weight marker. Lane 2, purified recombinant

gPKAr expressed in Escherichia coli. (B) Left panel: Western blot analysis of the recombinant GST- and His-tagged gPKAr using anti-gPKAr antibody (1:1000),

which recognised a single 82 kDa polypeptide band of gPKAr fusion protein; Right panel: Lane 1, pre-immune serum. Lanes 2–4, Western blot analysis of

endogenous gPKAr using different dilutions of anti-gPKAr antibody (1:1000, 1:2000 and 1:2500), which recognised a major 50 kDa peptide band. Lower bands

represent possible degradation products. (C) and (D) His-tag pull-down assays using Ni-NTA-bead bound recombinant gPKAc or gPKAr and crude trophozoite

extracts followed by western blot analysis using anti-gPKAr (1:1000) or anti-gPKAc (1:7000) antibodies. Results showed retention of endogenous 50 kDa gPKAr or

41 kDa gPKAc by the recombinant Giardia PKA subunits. (E) Inhibition of phosphorylation of kemptide by the dialysed PKAc/PKAr and restoration of activity

following addition of cAMP. Data indicates meanGSD of three separate experiments.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799 795

purified recombinant gPKAr or gPKAc were allowed to

interact with the endogenous PKAc or PKAr, respectively,

and bound interacting partners were detected by Western blot

analysis (Fig. 3C and D). We have used anti-gPKAc polyclonal

antibody, as described previously (Abel et al., 2001) and anti-

gPKAr antibody to detect pulled down subunits. The results

presented in Fig. 3C and D indicate that both recombinant

subunits of gPKA were able to tether the other partners present

in the crude trophozoite extracts. This observation confirms

that the degenerate sequence for the binding of the C subunit

present in the giardial R subunit is capable of interacting with

the C subunit.

To determine the ability of the gPKAr subunit to inhibit

catalytic activity of gPKAc we assayed kinase activity of the

recombinant gPKAc in the presence or absence of the

recombinant gPKAr. Because recombinant PKAr expressed

in E. coli is often saturated with cAMP and does not inhibit

PKAc activity efficiently, purified PKAr and PKAc were

extensively dialysed at 4 8C to remove cAMP and allowed to

form holoenzyme prior to kinase assays (Gibson et al., 1997;

Yu et al., 2004). Fifty percent inhibition of phosphorylation of

kemptide was obtained with dialysed samples at a molar ratio

of 1:1.2 (PKAc:PKAr). Catalytic activity was restored

substantially (86%) following addition of cAMP (5 mM) in

the reaction mix (Fig. 2E). Non-dialysed gPKAr was inefficient

in inhibiting gPKAc activity and 50% inhibition was achieved

at a ratio of 1:15 (PKAc:PKAr) (data not shown). We noticed

that non-dialysed gPKAr can interact with gPKAc in pull-down

assays but needed to be stripped off cAMP for efficient

inhibition of the catalytic activity at a lower stoichiometric

ratio. It is possible that a fraction of gPKAr became denatured

during the purification process and remained free of cAMP.

3.3. Differential expression of the R and C subunits

and increased activity of giardial PKA C subunit

during stages of encystation

Because PKA has a diverse function in cell proliferation as

well as in cell differentiation we were interested to describe any

role of gPKA in Giardia differentiation. We used a method of

Fig. 3. Immunoblot analyses of gPKAr, gPKAc, CWP1 and catalytic activity of gPKAc during encystation. (A) and (B) Differential expression of gPKAr and

gPKAc. Crude extracts from encysting cells at indicated times were immunoblotted with anti-gPKAr (1:1000) (A) and anti-gPKAc (1:7000) (B) antibodies. (C)

Western blot analysis of CWP1 using anti-CWP1 antibody (1:1!105) in encysting cells at different time points. (D) and (E) Densitometric analysis of the relative

concentration of gPKAr and gPKAc in encysting cells at different time points. (F) Phosphorylation of kemptide by endogeneous PKA at different stages of

encystation. Data represents meanGSD of three separate experiments.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799796

encystations that uses a higher concentration of bile, so

maximum cysts are obtained between 10 and 24 h (Kane et al.,

1991). Western blot analysis of gPKAr in encysting cells at

different time points after induction of encystation showed a

marked reduction in the concentration of gPKAr from 2 to 48 h

post-encystation (Fig. 3A and D). However, a parallel

immunoblot analysis of gPKAc showed no apparent change

in the total concentration of gPKAc during encystation (Fig. 3B

and E). Western blot analysis of the cyst wall protein 1 (CWP1)

as a marker for encystation showed a gradual increase in

expression of CWP1 from 2 to 48 h (Fig. 3C). Our results

suggest that the induction of encystation was associated with

accumulation of the active PKAc in these cells starting from

2 h and maintained until 48 h. To determine the activity of

phosphorylation of kemptide in gPKAc in encysting cells we

used crude extracts of encysting cells collected at different time

points for in vitro kinase assays. Earlier, we confirmed that

phosphorylation of kemptide in kinase assays using crude

trophozoite extracts was solely done by the endogenous PKAc

as immunodepletion of gPKAc inhibited kemptide phosphoryl-

ation (Abel et al., 2001). Analysis of the catalytic activity of the

endogenous PKA in encysting cells showed an increased

phosphorylation of kemptide starting at 2 h and reaching a peak

(3.5-fold) at 10 h (Fig. 3F). When we used recombinant

giardial centrin, which is a known substrate of PKA in

mammalian cells, as a substrate we have obtained a similar

profile of increased activity of gPKAc in encysting cells

(unpublished observation).

3.4. Differential localisation of gPKA C subunit during

encystation

During vegetative growth of giardial trphozoites the gPKA C

subunit is localised to distinct regions in the cytoplasm such as

marginal plates and axonemes associated with the anterior

flagella, eight basal bodies located between the nuclei and

caudal flagella. Because a dramatic reduction in the concen-

tration of the R subunit was noted in encysting cells we set out to

analyse the subcellular localisation of PKA C and R subunits

at different stages of encystation by immunofluorescence

analysis using anti-gPKAc and anti-gPKAr antibodies.

Trophozoites were treated with encystment media and

harvested at 0, 2, 10 and 48 h. To confirm the onset of

encystation, expression of CWP1 was monitored in parallel by

Western blot in attached parasites at different time points. At

0 h, localisation of gPKAc to the flagellar basal bodies, the

caudal flagella and the anterior flagella were evident (Fig. 4A,

panel 1). Following exposure to the encystment medium no

Fig. 4. Immunofluorescence analysis of subcellular localisation of gPKAc and gPKAr during encystation. (A) and (B) Trophozoites were seeded on coverslips and

treated with encystation medium and processed at the indicated time points. Localisation of gKAc (A) and gPKAr (B) was detected using anti-gPKAc antibody

(1:2500) or anti-gPKAr antibody (1:1000) and anti-ALEXA Fluor-488 (green). Nuclei were stained with DAPI (blue). A, Trophozoites; AF, anterior flagella; BB,

basal bodies; CF, caudal flagella. B, C and D, Encysting cells at 2, 10 and 48 h.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799 797

significant alteration in the localisation of gPKAc was noted at

2 h (Fig. 4A, panel 2). At 10 h, when the maximum numbers of

cysts were formed as observed by microscopic examination,

staining of gPKAc became punctate (Fig. 4A, panel 3). An

intense staining of gPKAc was noted at the cell periphery,

which became less pronounced but remained diffused at 48 h

(Fig. 4A, panel 4). Immmunolocalisation of gPKAr in

trophzoites at 0 h showed a similar profile of targeting to the

basal bodies and anterior and caudal flagella as noted for gPKAc

(Fig. 4B, panel 1). However, a substantial reduction in gPKAr

staining was seen in encysting cells at 2, 10 and 48 h compared

with trophozoites at 0 h (Fig. 4B, panels 2–4), which correlates

with the Western blot results. Despite the weak staining altered

localisation of gPKAr could also be seen in encysting cells,

which showed punctate staining of gPKAr at the cell periphery.

4. Discussion

Molecular cloning and amino acid sequence analysis of

gPKAr indicated an unusual N-terminus up to 150 amino acids,

which showed modest homologies with the N-termini of PKA

R subunits isolated from other species. In contrast, a number of

conserved features of the PKA R subunit from other species

were absent in Giardia PKAr. No N-terminal glycine for

myristoylation and no consensus AKAP-binding domain were

present. Although no Giardia homologue of A-kinase

anchoring protein (AKAP) has been identified, structural

features of the gPKAr subunit show a degenerate AKAP

binding domain, which contains some of the hydrophobic

residues crucial for binding to AKAP at the N-terminus. Two

C-terminal cAMP-binding domains of gPKAr contain the

conserved residues that act as contact points between cAMP

and the R subunit as well as the residues involved in cAMP-

mediated activation, suggesting a typical cAMP mediated

regulation of the C subunit activity.

Multiple sequence alignment also indicated that gPKAr

contains a degenerate inhibitory domain. In this study, we

provide evidence that gPKAr interacts with gPKAr as shown

by pull-down assays and is capable of inhibiting catalytic

activity of the recombinant gPKAc efficiently through

formation of holoenzyme in the absence of cAMP and that

addition of cAMP could restore the activity partially. This is in

support of our earlier studies where we have shown that

addition of cAMP to the crude trophozoite extracts increased

phosphorylation of the PKA-specific substrate kemptide (Abel

et al., 2001). However, the exact mechanism of in vivo

activation of Giardia PKA remains elusive.

Our studies on immunolocalisation of gPKAr in trphozoites

indicated targeting of the R subunit to the same subcellular

structures where gPKAc is targeted. In higher eukaryotes,

AKAPs are involved in anchoring discrete intracellular

structures and tethering R subunits to these structures and

thereby act as scaffold to bring the heterotetrameric PKA near

the substrates. Since the targeting domain is very divergent in

gPKAr it is uncertain whether this region of the R subunit is

involved in targeting the C subunit to the basal bodies and the

flagella. However, in unicellular organisms, localisation of

PKA to subcellular compartments is accomplished by a

mechanism different to that present in multi-cellular organ-

isms. Intracellular targeting of PKA by the regulatory subunit

Bcy1 without a canonical AKAP docking domain has been

reported in S. cerevisiae (Griffioen et al., 2000). Further,

studies are required to identify specific regions of the R subunit

involved in transporting the C subunit.

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799798

Our results showing differential expression of gPKAr and

gPKAc subunits during encystation indicate possible involve-

ment of PKA in the encystment process. A substantial decrease

in the gPKAr concentration and a subsequent increase in the

PKA catalytic activity without any change in the expression of

the C subunit suggest possible enrichment of the catalytically

active gPKAc during encystation. We speculate that an

increased PKA activity may be necessary for phosphorylating

proteins involved in proper folding and transport of encystation

specific proteins including cyst wall proteins. It is also possible

that the increased activity of PKA during encystation is a

preparation for an efficient excystment process. Earlier, we

have shown that active gPKAc is essential for the initiation of

excystation (Abel et al., 2001).

A distinct alteration in targeting of the PKA C subunit

during late stages of encystation is also evident from our study.

Western blot analysis showed a robust expression of CWP1 in

encysting cells at 10 h which confirms that the encystment

process is occurring in these cells. Importantly, distribution of

gPKAc to the cell periphery is specific and intense at 10 h when

the catalytic activity of gPKAc also reached a peak. This

observation further suggests possible involvement of PKA

during Giardia differentiation. However, because the concen-

tration of gPKAr was significantly reduced during encystation

it is uncertain how gPKAc is targeted to the cell periphery.

Further, studies are warranted to shed light on the role of PKA

during encystation in Giardia.

Acknowledgements

This work was supported by the Office of Research and

College of Health and Public Affairs, University of Central

Florida.

Supplementary data

Supplementary data associated with this article can be

found, in the online version, at doi:10.1016/j.ijpara.2005.11.

008. Alignment of full-length amino acid sequence of gPKAr.

References

Abel, E.S., Davids, B.J., Robles, L.D., Loflin, C.E., Gillin, F.D.,

Chakrabarti, R., 2001. Possible roles of protein kinase A in cell motility

and excystation of the early diverging eukaryote Giardia lamblia. J. Biol.

Chem. 276, 10320–10329.

Adam, R.D., 1991. The biology of Giardia spp. Microbiol. Rev. 55, 706–732.

Adam, R.D., 2001. Biology of Giardia lamblia. Clin. Microbiol. Rev. 14, 447–

475.

Ali, S.A., Hill, D.R., 2003. Giardia intestinalis. Curr. Opin. Infect. Dis. 16,

453–460.

Barradeau, S., Imaizumi-Scherrer, T., Weiss, M.C., Faust, D.M., 2002.

Intracellular targeting of the type-I alpha regulatory subunit of cAMP-

dependent protein kinase. Trends Cardiovasc. Med. 12, 235–241.

Bernander, R., Palm, J.E., Svard, S.G., 2001. Genome ploidy in different stages

of the Giardia lamblia life cycle. Cell. Microbiol. 3, 55–62.

Cassano, S., Di Lieto, A., Cerillo, R., Avvedimento, E.V., 1999. Membrane-

bound cAMP-dependent protein kinase controls cAMP-induced differen-

tiation in PC12 cells. J. Biol. Chem. 274, 32574–32579.

Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, C.J., Hoffmann, K.,

Bairoch, A., 2002. The PROSITE database, its status in 2002. Nucleic

Acids Res. 301, 235–238.

Gibson, R.M., Ji-Buechler, Y., Taylor, S.S., 1997. Interaction of the regulatory

and catalytic subunits of cAMP-dependent protein kinase. Electrostatic

sites on the type Ialpha regulatory subunit. J. Biol. Chem. 272 (26), 16343–

16350.

Griffioen, G., Anghileri, P., Imre, E., Baroni, M.D., Ruis, H., 2000. Nutritional

control of nucleocytoplasmic localization of cAMP-dependent protein

kinase catalytic and regulatory subunits in Saccharomyces cerevisiae.

J. Biol. Chem. 275, 1449–1456.

Herberg, F.W., Taylor, S.S., Dostmann, W.R., 1996. Active site mutations

define the pathway for the cooperative activation of cAMP-dependent

protein kinase. Biochemistry 35, 2934–2942.

Kane, A.V., Ward, H.D., Keusch, G.T., Pereira, M.E., 1991. In vitro

encystation of Giardia lamblia: large-scale production of in vitro cysts

and strain and clone differences in encystation efficiency. J. Parasitol. 77,

974–981.

Lanfredi-Rangel, A., Attias, M., Reiner, D.S., Gillin, F.D., De Souza, W.J.,

2003. Fine structure of the biogenesis of Giardia lamblia encystation

secretory vesicles. J. Struct. Biol. 143, 153–163.

Leon, D.A., Herberg, F.W., Banky, P., Tylor, S.S., 1997. A stable alpha-helical

domain at the N-terminus of the RIalpha subunits of cAMP-dependent

protein kinase is a novel dimerization/docking motif. J. Biol. Chem. 272,

28431–28437.

Lewis, D.J., Freedman, A.R., 1992. Giardia lamblia as an intestinal pathogen.

Dig. Dis. 10, 102–111.

Lu, X.Y., Gross, R.E., Bagchi, S., Rubin, C.S., 1990. Cloning, structure, and

expression of the gene for a novel regulatory subunit of cAMP-dependent

protein kinase in Caenorhabditis elegans. J. Biol. Chem. 265, 3293–3303.

Lujan, H.D., Mowatt, M.R., Byrd, L.G., Nash, T.E., 1996. Cholesterol

starvation induces differentiation of the intestinal parasite Giardia lamblia.

Proc. Natl Acad. Sci. USA 93, 7628–7633.

Mann, S.K., Firtel, R.A., 1993. cAMP-dependent protein kinase differentially

regulates prestalk and prespore differentiation during Dictyostelium

development. Development 119, 135–146.

Mann, S.K., Richardson, D.L., Lee, S., Kimmel, S.R., Firtel, R.A., 1994.

Expression of cAMP-dependent protein kinase in prespore cells is sufficient

to induce spore cell differentiation in Dictyostelium. Proc. Natl Acad. Sci.

USA 91, 10561–10565.

Marques Mdo, V., Borges, A.C., de Oliveira, J.C., Gomes, S.L., 1992.

Coordinate pretranslational control of cAMP-dependent protein kinase

subunit expression during development in the water mold Blastocladiella

emersonii. Dev. Biol. 149, 432–439.

Marti, M., Regos, A., Li, Y., Schraner, E.M., Wild, P., Muller, N., Knopf, L.G.,

Hehl, A.B., 2003. An ancestral secretory apparatus in the protozoan parasite

Giardia intestinalis. J. Biol. Chem. 278, 24837–24848.

McCaffery, J.M., Gillin, F.D., 1994. Giardia lamblia: ultrastructural basis of

protein transport during growth and encystation. Exp. Parasitol. 79, 220–

235.

Pan, X., Heitman, J., 1999. Cyclic AMP-dependent protein kinase regulates

pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Cell. Biol.

19, 4874–4887.

Primpke, G., Iassonidou, V., Nellen, W., Wetterauer, B., 2000. Role of cAMP-

dependent protein kinase during growth and early development of

Dictyostelium discoideum. Dev. Biol. 221, 101–111.

Reiner, D.S., McCaffery, J.M., Gillin, F.D., 2001. Reversible interruption of

Giardia lamblia cyst wall protein transport in a novel regulated secretory

pathway. Cell. Microbiol. 3, 459–472.

Shalaby, T., Liniger, M., Seebeck, T., 2001. The regulatory subunit of a cGMP-

regulated protein kinase A of Trypanosoma brucei. Eur. J. Biochem. 268,

6197–6206.

Su, Y., Dostmann, W.R., Herberg, F.W., Durick, K., Xuong, N.H., Ten

Eyck, L., Taylor, S.S., Varughese, K.I., 1995. Regulatory subunit of protein

C. Gibson et al. / International Journal for Parasitology 36 (2006) 791–799 799

kinase A: structure of deletion mutant with cAMP binding domains.

Science 269, 807–813.

Su, Y., Ryder, J., Ni, B., 2003. Inhibition of Abeta production and APP maturation

by a specific PKA inhibitor. Fed. Eur. Biochem. Soc. Lett. 546, 407–410.

Syin, C., Parzy, D., Traincard, F., Boccaccio, I., Joshi, M.B., Lin, D.T.,

Yang, X.M., Assemat, K., Doerig, C., Langsley, G., 2001. The H89 cAMP-

dependent protein kinase inhibitor blocks Plasmodium falciparum

development in infected erythrocytes. Eur. J. Biochem. 268, 4842–4849.

Telgmann, R., Maronde, E., Tasken, K., Gellersen, B.E., 1997. Activated

protein kinase A is required for differentiation-dependent transcription of

the decidual prolactin gene in human endometrial stromal cells.

Endocrinology 138, 929–937.

Vigil, D., Blumenthal, D.K., Heller, W.T., Brown, S., Canaves, J.M.,

Taylor, S.S., Trewhella, J.D.K., 2004. Conformational differences among

solution structures of the type Ialpha, IIalpha and IIbeta protein kinase a

regulatory subunit homodimers: role of the linker regions. J. Mol. Biol. 337,

1183–1194.

Yu, S., Mei, F.C., Lee, J.C., Cheng, X., 2004. Probing cAMP-dependent protein

kinase holoenzyme complexes Ialpha and IIbeta by FT-IR and chemical

protein footprinting. Biochemistry 43, 1908–1920.

Zhao, Q., Tao, J., Zhu, Q., Jia, P.M., Dou, A.X., Li, X., Cheng, F., Waxman, S.,

Chen, G.Q., Chen, S.J., Lanotte, M., Chen, Z., Tong, J.H., 2004. Rapid

induction of cAMP/PKA pathway during retinoic acid-induced acute

promyelocytic leukemia cell differentiation. Leukemia 18, 285–292.