Fpr1 engages in key protein-protein interactions with heat

shock response proteins Hsp90, Hsf1, and Tor1

Adam Harding ∙ Maddiah Mazahr ∙ Joseph Brightmore ∙ Stefan Millson

Abstract

The heat shock response (HSR) is triggered within cells during cell stress. Proteins within the HSR include Hsp90, Hsf1, and Tor1. Tor1 phosphorylates Hsf1 on Serine-326, upregulating Hsp90 transcription. Tor1 is a target in cancer treatment, as it is over-expressed in cancer cells, leading to cell resistance. The inhibitor drug to Tor1 is rapamycin. Fpr1 is a rapamycin binding partner, and interacts with Hsp90. Fpr1 interactions with other proteins in the HSR are unknown. The aims of this investigation were to identify protein-protein interactors of Fpr1 and other HSR proteins, and observe the effect of rapamycin. The interactions would be tested using yeast 2-hybrid screens. Saccharomyces cerevisiae cells were transformed with vectors pADC and pBDC, and grown under varying temperatures and rapamycin concentrations before being screened for interactions. The vector DNA contained a Lac Z operon to allow for interaction strength to be reported via ß-galactosidase activity. Results showed that Fpr1 interacts with Tor1, Hsf1, Hsp90, and itself under 26°C conditions, with rapamycin inhibiting all interactions except Fpr1-Hsp90. At 39°C, identical interactions were found, but with the addition of Tor2- Hsp90 and Fpr1. Rapamycin no longer inhibited Fpr1-Tor1 interactions, while Hsf1-Tor1 and Fpr1-Hsp90 interactions increased. Low levels of rapamycin resulted in an Hsp90-Tor1 interaction. Hsf1 is therefore seemingly dependent on Fpr1 in order to bind Tor1. This dependence is suspected to also be required for Hsf1-Hsp90 interactions, suggesting that Fpr1 plays a more essential role in the HSR than initially thought. Key Words: Fpr1 ∙ Hsp90 ∙ Tor1 ∙ Yeast 2-Hybrid ∙ Rapamycin

Background

Cancer

Cancer is a clonal disease characterised by the

abnormal and prolific growth of cells as a result of the

inhibition of certain cell division mechanisms

originating in a single cell—primarily due to the cell

developing an autonomy from signal pathways

(Hejmadi, 2010) (Fig. 1).

Despite its notoriety and prevalence throughout

society, with 14.1 million cases reported each year

(Cancer Research UK, 2012), the mortality rates are

consistently decreasing each year (SEER, 2012) as

research shifts to work around the challenges of

acquired cancer resistance. This resistance is a

fundamental factor in cancer cell survival against

therapeutics, and insensitivity to drug-induced apoptosis

(Gottesman, 2002).

Accumulated drug resistance of cancer cells adds

another level of complexity to successful treatment, as

managing to successfully damage a cancer cell would

guarantee the death of a healthy cell—as is exemplified

in the form of current chemotherapy methods. Whilst

chemotherapy capitalises on the speed at which cancer

cells divide in order to damage them, the caveat is that

healthy cells also die (albeit slower) as treatment affects

the reproduction mechanism used in both cell types

(Cancer Research UK, 2015).

There are several methods in treating cancer: drugs;

radiotherapy; immunotherapy—commonly monoclonal

antibodies; and surgery (Cancer Research UK, 2014).

Whilst radiotherapy and surgery are relatively

straightforward—targetting a tumour with either focused

energy or a scalpel respectively—and often used in

conjunction for the best outcome, drugs are a very broad

and less predictable category of treatment (i.e. side

effects vary between individuals, as does response to the

drugs themselves) (NHS, 2013).

As such, the versatility and treatment potential of

drugs makes them one of the key areas of focus in terms

of research, with novel and unexpected origins, such as

with oleocanthal in olive oil (LeGendre, 2015) or

malaria proteins (Salanti A et al., 2015).

The high potential of drug therapy forms the basis of

this investigation, focusing on a pathway which involves

A Harding ∙ M Mazahr ∙ J Brightmore ∙ S Millson (✉)

School of Life Sciences, Joseph Banks Laboratories,

University of Lincoln, Brayford Pool, Lincoln LN6 7TS,

UK

E-mail: smillson@lincoln.ac.uk

Phone: 01522 88 6995

4 seemingly linked proteins which are vital to cell

survival and, crucially in the context, relied on by cancer

cells to survive: the TOR pathway, which features

(mammalian) TOR, Hsp90, Hsf1, and, potentially, Fpr1

(Fig. 2).

Rapamycin & TOR (Target of

Rapamycin)

The Target of Rapamycin, TOR (in yeast:

mammalian TOR in humans; mTOR), is a serine/

threonine phosphoinositide 3-kinase-related protein

kinase, responsible for controlling cell growth in

response to nutrients and other growth factors. TOR

signalling is frequently upregulated in cancers, whilst

the protein itself is deregulated to enable the prolific

growth needed to sustain the cancer (Ballou, 2008 &

Yang, 2013). Whilst functionally crucial on its own,

TOR recruits the proteins RAPTOR (Regulatory-

Associated Protein of TOR), RICTOR (Rapamycin

Insensitive Companion of TOR) and mLST8, to form

vital complexes in the pathway known as TORC1 & 2

(Fig. 3) (Ballou, 2008).

RAPTOR is a conserved adaptor protein with

multiple functions within the TOR pathway, and is

encoded by the RPTOR gene highly expressed in

skeletal muscle. Amino acid availability dictates the

levels of RPTOR within the lysosomes; and in stressed

cells, RPTOR associates with SPAG5 and accumulates

in stress granules, leading to a considerable reduction of

presence within the lysosomes.

RAPTOR and TOR form a stoichiometric complex,

stabilised by nutrient deprivation and other conditions

contributing to the suppression of the TOR pathway.

RAPTOR also associates with eukaryotic initiation

factor 4E-binding protein-1 (4EBP1) and S6 kinase:

upregulation of S6 kinase results in downregulation of

TOR. RAPTOR also further helps to maintain cell size

and TOR expression (Lieff, 2015).

mLST8 is thought to be a requisite activating subunit

of TOR complexes (TORC1 & 2), with a

structure suggestive of mLST8 being able to influence

the organisation of the active site. If mLST8 is not

present, TOR associates with Heat Shock Proteins

(HSPs) (Ballou, 2008).

Rapamycin (pharmaceutically known as sirolimus)

and its analogues (or ‘rapalogues’) are drugs with TOR

as the primary target. These drugs bind to a domain

separate from the catalytic site of TOR, blocking a

subset of TOR functions. They are also highly selective

for TOR, so are very effective in cancer treatment,

however they can potentially activate a TOR dependant

survival pathway which results in treatment failure

(Ballou, 2008). In contrast, small molecules that

compete with ATP in the TOR catalytic site would

inhibit all of the kinase-dependant functions of TOR,

without activating the survival pathway. Despite the

wide acceptance of Rapamycin as a treatment, it has

poor aqueous solubility and poor chemical stability, and

is hepatotoxic when used long term, restricting its use

(Mita, 2008).

The current rapalogues, which show promising

antiproliferative activity against a large array of

malignancies, include: Everolimus; Temsirolimus; and

Ridaforolimus (formerly known as Deforolimus), which

currently has few indications of success and is currently

not clinically approved (Benjamin, 2011).

TOR contains an intrinsically active kinase

conformation, with catalytic residues and a catalytic

mechanism similar to other canonical protein kinases.

The active site is highly recessed due to a domain

known as the FKBP12-rapamycin-binding (FRB)

domain, and an inhibitory helix located from the

catalytic cleft. TOR-activating mutations correspond to

structural framework that holds these elements in place,

Fig. 1. Basic illustration of oncogenesis. A mutation controlling growth forms in a single cell, which begins to grow uncontrollably and proliferates. Over time, more mutations form to the point where the cells become cancerous, and eventually

detach from the origin site and spread throughout the body (metastasis) to form tumours.

showing that the kinase is controlled by restricted access.

In vitro biochemistry also shows that the FRB domain

acts as a gatekeeper, with the rapamycin-binding site

interacting with substrates to allow them access to the

restrictive active site (Yang, 2013).

TORC1 & 2 Pathways

Whilst both incorporating TOR and mLST8, the

primary difference between TORC1 and TORC2 is their

incorporation of RAPTOR and RICTOR proteins,

respectively (Fig. 3) (Lieff, 2015).

TORC1 is defined by the Raptor subunit, and is

comprised of TOR, Raptor, and mLST8. The primary

role of TORC1 is to phosphorylate the ribosomal protein

S6 kinase and the translation repressor 4EBP1.

Importantly, TORC1 is rapamycin sensitive.

TORC1 regulates some biological processes within the

cell, including translation; ribosome biogenesis;

autophagy; and glucose metabolism.

TORC2 is defined by the Rictor subunit, and is

comprised of TOR, RICTOR (Rapamycin-Insensitive

Companion of TOR), mLST8, and mSin 1 (target of

rapamycin complex 2 subunit MAPKAP1). The primary

role of TORC2 is to phosphorylate the protein kinase

Akt (involved in cell growth). Due to the RICTOR

subunit, TORC2 is rapamycin insensitive. The full extent

of the biological influence of TORC2 is less known than

TORC1, although it is suggested that it controls cell

survival and organisation of the actin cytoskeleton

(Ballou, 2008).

When rapamycin is introduced into the TOR system,

Fpr1 (FKBP12 as the human orthologue) extends from

the FRB towards mLST8, almost entirely capping the

catalytic cleft of the molecule. At their closest, FKBP12

and mLST8 are only 8 amino acids apart. As such, it is

suggestible that rapamycin-FKBP12 partly causes

inhibition by considerably reducing the accessibility of

the already highly recessed active site within the

catalytic cleft. The rapamycin-binding site corresponds

to the FRB surface closest to the active site, further

suggesting that the binding site itself interacts with

substrates to facilitate entry into the active site of TOR

(Yang, 2013).

Mutation of Ser 2035, a rapamycin contact at the

centre of the region, reduces phosphorylation of S6K1

and 4EBP1, which also explains how rapamycin can

inhibit TORC1 & 2 in the absence of FKBP12

(however, the concentrations needed are 100-fold

greater than when FKBP12 is present). This reduction

can be as great as 80% inhibition of phosphorylation of

cis-S6K1, and up to 75% inhibition of trans-S6K1

(Ballou, 2008).

As promising as focusing on inhibiting TOR would

seem, studying the interactions and potential inhibiting

effects of the other proteins in the pathway would be of

great benefit. If a cancer cell acquires resistance to TOR

inhibitors, then an alternative is needed.

Heat Shock Factor 1 (Hsf1) & Heat Shock

Protein 90 (Hsp90)

When cells are subjected to immense heat or

proteotoxic stress, a collection of proteins known as the

heat shock proteins (HSPs) build up as a defence

mechanism. Alongside their involvement in the stress

response, many of the HSPs act as molecular

chaperones, such as Hsp60 and Hsp70, whilst some are

more specific to the stress response, such as Hsp90

(Chou, 2012).

Regardless of their association within the response,

these molecules are essential in conducting quality

control of cell machinery. They can aid in the folding

and maintenance of new proteins, or can lead to the

degradation of incorrect/incomplete proteins (Goodsell,

2008). Hsp90 is an interesting and highly viable target

due to its central role in cell signalling and hormone

pathways; it is essential for maintaining the activity of

some 200 proteins, and, crucially, interacts within the

TOR pathway (Jackson, 2013 & Trepel, 2010).

TOR is not only responsible for regulating cellular

processes resulting from nutrient availability, but also

Fig. 2. TOR and its interacting proteins. TOR regulates Hsf1, which regulates Hsp90. Fpr1 is known to regulate

TOR, with an unknown method of regulating Hsp90 directly.

Fig 3. Diagram of the Raptor incorporated TORC1 (left), and Rictor incorporated TORC2 (right) molecules (Lieff,

2015)

plays a large role in responses to stresses. A reduction in

TOR levels leads to increased sensitivity to heat shock,

which in turn causes malfunctions in proteins

maintaining their optimal shape and activity. Alongside

this, a reduction in TOR is accompanied by a drastic

reduction in cellular ability to synthesise HSPs (Chou,

2012).

HSP transcription itself is regulated by heat shock

transcription factor 1 (Hsf1) (Fig. 4). Hsf1 is a trimeric

heat shock transcription factor, responsible for

regulating the heat-shock response. Hsf1 is a primary

regulators of HSPs: specifically, Hsp90-family

chaperones Hsc82 and Hsp82, and Hsp90. As part of a

negative feedback route, Hsf1 negatively regulates TOR

signalling to prevent overexpression if TOR is the origin

of the upregulation (Medillo et al., 2012).

Hsf1 is regulated by being phosphorylated by TOR

on Serine-326 (S326), one of the major transcriptional

activation residues. This interaction occurs immediately

after heat shock is induced, alongside other stress

responses. If S326 is mutated into an alanine, the cell

loses the ability to activate an Hsf1-regulated

promoter-reporter construct. As such, the TOR-S326

complex has a pivotal role in regulating Hsf1, in turn

regulating the HSPs, as Hsf1 requires TOR protein

kinases to activate. Furthermore, TOR inhibitors, such

as rapamycin, also prevent Hsf1-S326 phosphorylation,

suggesting that TORC1 is involved in Hsf1 regulation

(Medillo et al., 2012).

Inhibition of Hsp90 promotes activation of Hsf1,

which in turn upregulates of other HSPs.

Simultaneously, Hsf1 activation downregulates TORC1

activity and sensitises the cell to rapamycin (Bulman,

2001)).

Fpr1 / FKBP12

Fpr1, in yeast, or FKBP12 as the human orthologue,

is a peptidyl-prolyl cis-trans isomerase, and aids in the

correct folding of proteins. It is also a rapamycin-

binding protein which inhibits TORC1 in the presence

of rapamycin. Fpr1 is part of a group of prolyl

isomerases made up of three structurally unrelated

families: the FKBPs, such as FKBP12, (which are

FK506 binding proteins), the cyclophilins, and the

parvulins (Koltin et al., 1991).

Fpr1 binds rapamycin, and the immunosuppressant

macrolide FK506. Binding to either results in the

inhibition of its peptidyl-prolyl isomerase activity, and is

toxic to yeast. This toxicity is not due to the inhibition -

as Fpr1 null mutants are viable - but rather by the

interactions caused by the binding itself: Fpr1-FK506

complexes bind to the calcineurin A subunit and

negatively regulates calcineurin function; and Fpr1-

rapamycin binds to TOR1 & 2 (Limson, 2010).

A basic summary of Fpr1's features can be found in

Table 1.

When rapamycin is bound to its target in yeast - the

peptidyl-prolyl isomerase Fpr1 - the Fpr1-

rapamycin complex inhibits activity of kinases in

TORC1 complexes. To this extent, inhibition of TORC1

by rapamycin is seemingly dependent on Fpr1.

Furthermore, deletion of the Fpr1 gene also removes the

inhibitory effects of rapamycin. When rapamycin binds

to Fpr1 it competitively releases other proteins which

also interact with Fpr1: Hmo1 and Fap1 (Dolinski,

1999). These are both DNA-binding proteins.

Therefore, rapamycin and Fpr1 interact in a way

which potentially affects transcription and/or repair

mechanisms within the cell, adding to the potential for

rapamycin to knock-out fundamental mechanisms in

cancer (Limson, 2010).

Application in Cancer Treatment

Around 3% of intracellular Hsp90 is located within

cell nuclei (Trepel, 2010), regulating several nuclear

events. One such regulation is of steroid hormone

receptors (SHRs): Hsp90 regulates their location,

stability, ligand binding competencies, and

transcriptional activities. Some SHRs within the nucleus

have been shown to be carcinogenic, making Hsp90 a

promising target for inhibition (Zhao, 2005).

Fig. 4. Summary of Hsf1 activation and DNA interaction to activate HSPs (Image credit: Åkerfelt, 2010)

Table 1. Summary of Fpr1 features in yeast

Due to the number of proteins that Hsp90 chaperones,

some are inevitably involved in either carcino- or onco-

genesis. Interestingly, some of them interact with Hsp90

as a benefit to cancer; such as in the case of Hsp90-BCL-

6 complexes in diffuse large B cell lymphomas (Trepel,

2010); whilst others a detriment, such as with Hsp90-

IRF1 interactions in acute myeloid leukaemia (Choo et

al., 2006 & Trepel, 2010).

In theory, based on these examples and the large

number of proteins that Hsp90 chaperones, there is a

chance that there are more client proteins which have a

key role in cancer, be they beneficial or detrimental. As

such, the versatility of Hsp90 proves it to be a promising

and highly potential target for inhibition to help treat

various cancers. In conjunction, the close interaction of

Hsp90 with TOR, Hsf1, and Fpr1 highlight these

proteins as potential targets as well, with potentially

increased positive results in multi-drugging scenarios.

Materials & Methods

Fpr1 Amplification & Cloning

The genomic sequence for Fpr1 was used to design

the necessary primers (Eurofins Genomics) to transform

the protein-coding sequences into cells. The first 17

bases of both forward and reverse primers corresponded

to yeast primers, designed by Professor Stan Fields

(Fields, 2000), and contained a starting ATG codon to

which 6 codons of Fpr1 sequence were then added.

Primers for a nested PCR were also designed to form the

overhangs between the protein DNA sequence and yeast

vector DNA, to allow for a successful recombination

into the host cells during the transformation.

For use in affinity chromatography, a HIS tag

sequence was included within the forward primer. Nickel

has a high affinity for HIS tags (repeated sequences of

the codon CAT), and was the reasoning behind this. 6

repeats were used here, but longer sequences can be

effective, especially in larger proteins which may contain

folds that obscure the HIS tagged region. Both the

forward and reverse primers featured longer overhang

sequences to combine with the vector, and 7 codons of

Fpr1 were then included in the sequence.

The designed primers were:

Non-HIS Forward: AATTCCAGCTGACCACCATGTCTGAAGTAATTGAA

GGT Non-HIS Reverse:

GATCCCCGGGAATTGCCATGTTAGTTGACCTTCAA

CAATTC

Nested Forward:

CTATCTATTCGATGATGAAGATACCCCACCAAACC

CAAAAAAAGAGATCGAATTCCAGCTGACCACCATG

Nested Reverse:

CTTGCGGGGTTTTTCAGTATCTACGATTCATAGA

TCTCTGCAGGTCGACGGATCCCCGGGAATTGCCA

TG

HIS Tag (underlined) Forward:

ACAGAACCAATAGAAAAATAGAATCATTCTGAAA

TATGCATCATCATCATCATCATTCTGAAGTAATT

GAAGGTAAC

HIS Tag Reverse:

CATAAATCATAAGAAATTCGCCCGGAATAAGCTT

GGTTAGTTGACCTTCAACAATTC

An initial polymerase chain reaction (PCR) was used

to extend and amplify the primer sequences with a yeast

genomic DNA template to fully sequence the coded

protein for use in cell transformation. Several iterations

of PCR were performed to attain an optimal primer

melting temperature (Tm) value, as the included

overhangs on the primer sequence lowered the true Tm

value from the provided value. The reaction mixture for

both the PCR and nested PCR can be found in Table 2.

dNTP mix in solution contained dATP, dCTP, dTTP,

dGTP; final concentration of 2 mM (Fermentas, York,

UK) Phusion High Fidelity DNA Polymerase

(Invitrogen, Thermo Fisher Scientific, UK). The

parameters used in the PCR can be found in Table 3.

Following this PCR, gel electrophoresis was used to

positively identify the presence of a correct sequence.

Formed bands within the gel were then extracted and

mixed in 15µl dH2O for use as the DNA template in the

subsequent nested PCR. The parameters used in the

nested PCR can be found in Table 4.

The gel electrophoresis was a 1% agarose gel,

containing: agarose (Bioline Ltd., UK); dissolved in 1x

Tris-acetate (TAE) buffer (0.04 M Tris-acetate; 1 mM

EDTA, pH 8.0); with 1.5µl of SYBR Safe (Invitrogen,

Thermo Fisher Scientific, UK) added for visualisation.

Linearised Vector Formation

The vectors to be combined with the relevant DNA

sequences (FPR1, HSF1 and HSP90) were pADC

Table 2. PCR and nested PCR reaction mixture

('prey', containing a leucine auxotrophic marker) and

pBDC ('bait', containing a tryptophan auxotrophic

marker). Both contained a Lac Z operon to allow for

later observations in ß-galactosidase activity. These

vectors were chemically transformed into competent E.

coli (BL21 DE3): 50µl of E. coli were mixed with 0.5µl

of vector and heat shocked; 10 minutes on ice, 1 minute

at 42°C, and returned to ice for 5 minutes; 500µl of SOC

was then added and the mixture incubated at 37°C for 90

minutes. After incubation, the mixtures were centrifuged

at 3,000xg for 30 seconds and 400µl of the resultant

supernatant removed. The remaining 100µl E. coli

mixture was then pour plated onto LB-Ampicillin agar

(See agar setup section, below) and incubated at 37°C

overnight. Individual colonies were then transferred to

solutions containing 10ml LB and 20µl ampicillin,

which was incubated further overnight at 37°C.

Following this incubation, pure vector DNA was

extracted using QiaPrep™ Spin Miniprep Kit and

procedure (QiaGen, UK).

Once the pure vectors had been obtained, the DNA

was cut using restriction enzymes in the following 50µl

volume setup: 26µl of dH2O; 10x Restriction Buffer;

10µl of vector DNA (2 separate setups - 1 for pADC and

1 for pBDC); 2µl of Pvu II; and 2µl of NCO I (New

England Biolabs, UK).

This mixture was gently mixed by inverting and then

incubated at 37°C overnight to form linearised vectors.

Yeast Transformation

The yeast strains used for the transformations were

PJ69-4a and PJ69-4α, to be transformed with pADC and

pBDC, respectively. Prior to the transformations, the

yeast cells were cultured and diluted in YPD for 3 hours

to ensure that they were in the log growth phase.

2 sets of transformations were made for each strain:

PJ69-4a:

Control - 5µl of pADC vector

Fpr1 “DNA Mix” - 10µl of nested PCR product + 5µl of

pAD vector

PJ69-4α:

Control - 5µl of pBDC vector

Fpr1 “DNA Mix” - 10µl of nested PCR product + 5µl of

pBD vector

For the transformation, the cultures were centrifuged

at 3,000xg for 5 minutes, and washed twice in ~5ml

dH2O. The pellets were resuspended in 20ml of dH2O

and centrifuged for a further 5 minutes at 3,000xg,

before being resuspended in 1ml dH2O. 1.5ml of

solution (≥500µl from wet cell volume) was transferred

to microfuge tube and centrifuged at 3,000xg for 15

seconds. 1ml of 100mM Lithium Acetate (LiAc) was

added, and cells resuspended. The cells were then left to

incubate at room temperature for 30 minutes, before

aliquoting between eppendorfs (aliquots were dependent

on how many transformation plates were required—i.e.

2 plates would use 500µl, etc.). These were centrifuged

at 3,000xg for 30 seconds, and the LiAc poured off. The

following were then added and vortexed until a

homogenous solution formed: 240µl 50% PEG, 50µl

1M LiAc, 50µl ssDNA from salmon sperm, and the

“DNA Mix”. The mixtures were then left to incubate at

room temperature for 20 mins, before being centrifuged

at 8,000xg for 1 minute. The supernatant was then

poured off, and the pellets resuspended in 200µl of

water, ready for spread plating.

Following this procedure, the PJ69-4a and PJ69-4α

samples were spread onto –Leucine (–Leu) and

–Tryptophan (–Trp) agar respectively, and incubated for

3 days at 28°C.

Yeast PCR

To check if the transformation of the plasmids were

successful, individual colonies were taken from each

plate containing the Fpr1 sequence and transferred to a

PCR tube, before being lysed via bead beating in dH2O,

or alternatively in a microwave for 2 minutes in the

presence of water to act as a microwave sink. To each

PCR tube containing the cells, a reaction master mix

(totalling 25µl per PCR tube used) was added, which

included: dH2O; HF 5x Phusion Buffer; dNTPs; forward

and reverse nested PCR primers; and Phusion HF DNA

polymerase. The PCR parameters used for this PCR can

be found in Table 4.

Table 3. Initial PCR parameters Table 4. Nested PCR and Yeast PCR parameters

HIS-Tagged Sequences

For stages involving HIS-tagged protein (See Protein

Extraction and Purification, below), the PCR stages

followed the same procedure as the nested PCR to create

non-HIS-tagged sequences. Due to not requiring ß-

galactosidase to provide information, pADC/BDC were

vectors were not used. The vector used instead was

HSC, and was cloned into the yeast strain PP30.

Cell Growth

Due to the auxotrophic markers within the vectors

pADC and pBDC, each vector can be grown on

Synthetically Designed Complete (SDC) media minus

Leucine (-Leu) and Tryptophan (-Trp) respectively. This

allows for the identification of whether the

transformation of the vectors into the PJ69-4 strains

were successful or not. The resultant hybrids could be

positively identified by observing growth/amount of

growth on their selective agar.

The HSC vector, used in HIS-tagged transformations,

is capable of growing on -Leu media, and serves for the

same selection purpose.

Media Used

The following media were those used at various

stages throughout the growth cells. Total volume of

water added as per the requirement of media varied

throughout. If the media required was agar, 2% agar was

added.

YPD: 1% Peptone; 1% Yeast Extract; 2% D-

Glucose

-Leu: Yeast Nitrogen base minus amino acids,

6.9g/L; complete amino acid supplement -Trp, -Leu,

640mg/L; Tryptophan, 250mg/L; 2% D-Glucose

-Trp: Yeast Nitrogen base minus amino acids,

6.9g/L; complete amino acid supplement -Trp, 740mg/

L; 2% D-Glucose

-LTHA (Agar only): Yeast Nitrogen base minus

amino acids, 6.9g/L; complete amino acid supplement –

Trp –Leu –His –A; 2% D-glucose

-LTH + 4mM 3AT: Yeast Nitrogen base minus

amino acids, 6.9g/L; complete amino acid supplement

–Trp –Leu –His –Ade, Adenine, 50mg/L; 2% D-

glucose; 500mM 3AT, 8ml/L

D-Glucose from Thermo Fisher Scientific Inc., UK.

Yeast nitrogen bases and complete supplements from

Formedium™, UK

Agar from Melford Biolaboratories, UK.

All media were autoclaved after the solution pH was

made to 6.5 to dissolve. If agar, media was pour plated

under aseptic conditions before being stored at 2°C until

required for use.

Protein Extraction and Purification

Colonies expressing HIS-tagged protein were

inoculated in 500ml of YPD media at 28°C overnight in

a shaking incubator at 180rpm. The cultures were

pelleted at 10,000xg for 10 minutes, then washed and

resuspended in 10ml of dH2O, and transferred to a 50ml

Falcon tube. The cells were further pelleted at 5,000xg

for 5 minutes and resuspended in twice the wet cell

volume of bead beater buffer (1 PBS tablet + Pierce™

EDTA-Free Protease Inhibitor Tablet (Thermo Fisher

Scientific, UK)).

The solution was transferred to 1ml eppendorfs, with

unwashed glass beads added, and the solutions bead

beaten for 90s. The mixtures were then centrifuged at

13,000xg for 2 minutes, and the lysates from each

sample collated in one universal tube.

The lysate mixture was roughly diluted to ~20ml

with 20mM Imidazole in PBST, and a Nickel-column

fast performance liquid chromatography (FPLC) was

performed, washing through with 3 gradient

concentrations of 500mM against 25mM Imidazole: 0%,

25%, and 75%.

Once these fractions were collected, they were loaded

and run through SDS-PAGE with a product to dye ratio

of 2:1. Once run, the SDS gels (see Table 5 for

compositions) were transferred in 1x transfer buffer

(buffer from 10x stock solution: 36.25g glycine, 72.5g

Tris base, 4.625g SDS pellets, 1L dH2O) onto

nitrocellulose membrane, with a HIS-antibody stain and

follow-up Western Blot performed through the

following procedure:

The membrane was submerged in Ponceau red

staining solution (Sigma-Aldrich, UK) for ~10 seconds,

and rinsed with water. Excess membrane not containing

the gel silhouette was cut away. PBST was then made,

volume dependent on number of blots required (~200ml

per membrane) by adding 1 PBS tablet (Melford

Biolaboratories, UK) per 100ml of H2O + 0-1% Tween.

50ml of Blocking Buffer (BB) was then made by adding

2.5g Bovine Serum Albumin (BSA) (Sigma-Aldrich,

UK) to 50ml of PBST for each membrane (i.e. 2

membranes required 100ml BB). Each membrane was

washed in ~15ml of BB for 1 hour, before pouring off

BB. 15ml BB was added to each membrane + 3.75μl

Anti-HIS antibody (1:4000 dilution) for 30-60 minutes.

The membrane was then washed for 5 minutes, at least 5

times in ~15ml PBST. Another 15ml BB was then added

+ 3.75μl Mouse antibody (1:4000 dilution) for double

the length of time Anti-HIS antibody was applied. The

membrane was washed again in the same way

previously. Excess PBST was then drained from the

membrane and dab-dried. Amersham™ ECL™ (GE

Healthcare Life Sciences, UK) solution (composed of

300µl solution A & B) was then gently applied to cover

the membrane. The image was then developed onto X-

ray paper (Thermo Fisher Scientific, UK).

Yeast 2-Hybrids

Once transformations were shown to be successful,

either by yeast PCR or significant enough difference

between control and transformation agar plates, the baits

and preys were mated to recombine the vectors,

allowing the Lac Z reporter gene to activate in the

presence of ß-galactosidase. The greater the strength of

the interaction between bait and prey proteins, the

greater the reporter signal.

Mating involved streak plating colonies from the

transformation plates onto their required media (note

that colonies on the transformation plate itself can be

used—in this instance a streak was taken to allow for

repeated matings). Once grown, colonies from bait and

prey plates were mixed in individual eppendorf tubes

containing 400µl of YPD media, and thoroughly

resuspended to mix. The mates were then incubated at

28°C overnight, and streak plated onto complete

supplement agar with tryptophan and leucine dropouts

(SDC-LT), and incubated at 28°C for a further night. If

recombination occurred, the combined auxotrophic

markers would allow for effective growth. The mating

combinations of baits and preys can be found in Table 6.

When successfully mated, the hybrids were screened

across a variety of conditions, including heat shock and

drugged environments. Initially, single colonies were

grown at 28°C overnight in 20ml SDC-LT media, before

Table 6. Yeast 2-hybrid bait and prey mating combinations. AD-Hsp90 was not created, therefore BD-Hsf1 and BD-Fpr1 were mated without.

being diluted typically 1:3 for 2-3 hours to return them

to logarithmic growth phase (if less/more cells appeared

to be present, the dilutions were lowered/increased

respectively). Following dilution, the conditions to treat

the cells with were applied. These included: control

temperature of 26°C incubation, heat shock conditions

of 39°C water bath incubation, and the addition of

Rapamycin (Melford Biolaboratories, UK) at varying

concentrations (from 1mM stock solution). All

treatments lasted for 90 minutes, and were allowed to

return to roughly room temperature before continuing.

After treatment, the cells were pelleted at 5,000xg for 5

minutes. Pellets were then resuspended in 1ml dH2O and

transferred to 1.5ml screw-top microfuge tubes, and

washed, pouring off the water.

1ml of Z Buffer (Miller Buffer, 2-mercaptoethanol

(2.7nM), and ONPG (30mM) (Sigma-Aldrich, UK)) was

then added to each tube , followed by unwashed glass

beads (roughly 1:1 with wet cell volume). The samples

were then homogenised over a period of 90 seconds via

bead beating.

The samples were then observed for colour change to

yellow. When that point was reached, the time was

noted, and the reaction was stopped using 200mM

CaCO3 solution.

The samples were then shaken to ensure cell debris

was evenly suspended in solution, and 4x100µl of each

sample was pipetted into one lane of a 96-Well plate

(Sarstedt AG & Co., DE). Each plate used was limited

to only one bait under one condition at a time, both due

to quantity of samples and to avoid confusion. Once

each lane contained 4 rows of samples of cell debris, the

microfuge tubes were centrifuged at 8,000xg for 1

minute. The remaining lysates were pipetted in the next

4 rows of each lane (See Fig. 5 for visual representation

of setup).

The plates were then vortexed at 800rpm to ensure

the cell-debris wells were not settled at the bottom,

followed by photo spectrometry readings being taken of

each plate at 420nm and 595nm. The readings were then

used to calculate the ß-galactosidase intensity in Miller

Units (MU), using the following equation:

Table 5. SDS Gel compositions to create 2 gels

Drug Assays

Drug assays were conducted on several mutated yeast

strains to check for regrowth and inhibition to use as

comparisons against the yeast 2-hybrid results, to

potentially further identify how interactions are affected.

The strains used in assays were: unmodified strain

(wild type), ΔTOR1, ΔFPR1, rapamycin resistant TOR1

(T1.1), rapamycin resistant TOR2 (T2.1), and rapamycin

resistant TOR2 with TOR1 delete (ΔT1 T2.1).

Single colonies were grown at 28°C overnight in

20ml YPD media, before being diluted 1:100 for 2-3

hours to return them to logarithmic growth phase

(dilutions were lowered/increased as per amount of cells

grown). 200µl of each strain were pipetted into the first

lane well of a 96-well plate, followed by addition of

either 10nM Rapamycin or 100mM sodium molybdate

(a Hsp90 inhibitor) (Sigma-Aldrich, UK).

The samples were then serial diluted 10 times down

to 1:1,000, with a control well containing undiluted and

non-drugged cells. The plates were then incubated at 28°

C for 3 days. Following incubation, the plates were

vortexed and read at 595nm. To calculate % regrowth of

cells over the growth period, the following equation was

used:

Where X were diluted samples (lanes 1-11), and C were

control samples. Subtracting 0.08 negates the

interference from the growth media. % inhibition was

calculated by subtracting % regrowth from 100.

Results

Fpr1 PCR & Transformations

A 2-step nested PCR was required to synthesise the

necessary DNA sequence that would both allow for the

transcription of Fpr1 (and Hsf1, also being developed

in a project alongside by Maddiah Mazahr), and also be

successfully integrated into the yeast vector. The first

step was constructing the Fpr1 coding sequence onto

yeast genomic DNA, whilst the second was attaching

overhanging codons to the end of the Fpr1-DNA

sequence, which complemented to the exposed ends of

a restricted yeast vector (either AD-preys or BD-baits)

during the yeast transformations.

Both steps utilised different primers to achieve the

correct sequences, which therefore required different

thermocycler setups to optimise the PCR reaction. The

optimal setups were eventually found, and are shown in

Table 2 and 3 in methods. The results of the step 1 and

step 2 PCRs can be found in Fig. 6 (A & B

respectively).

The yeast transformations required the DNA

sequences to include overhanging codons to

complement and recombine with the ends of pADC and

pBDC vector DNA, linearised via restriction digest. A

gel electrophoresis followed to identify if the vector

DNA was the correct size and a suitable quantity to be

transformed (Fig. 6C).

Despite a high concentration of DNA, only the

subsequent transformation into PJ694-α yeast strains

was presumed successful, as the colony numbers across

each transformation suggested success (Table 7), with

no growth from the PJ694-a cells. Despite this success,

the low vector acceptance into cells also resulted in the

PJ694-α cells not actually containing the Hsf1 and Fpr1

plasmids, as seen in the yeast PCR gel image in Fig. 8.

The nested PCR was repeated (Fig. 7A) with 6 samples

to increase the chances of a successful reaction and

second transformation. The outcome of this repeat led

to successfully transformed Fpr1 preys, but not baits, as

indicated by a colony count (Table 8), which was

unsurprising given the low concentration of DNA

present. Due to time constraints, not having a bait for

Fpr1 was deemed acceptable at this time, and that yeast

2-hybrid work would be prioritised.

Throughout work on the yeast 2-hybrids, the nested

PCR was repeated with 4 samples – 2 using PCR DNA

Fig. 5. 96-well plate setup to perform the yeast 2-hybrid screens. Each lane contained a total of 8 samples (4 debris,

4 lysate) of mated hybrids (i.e. BD-Hsf1 + AD-Fpr1, etc.)

Table 7. Colony counts of initial, unsuccessful transformation

Where L is Lysates, D is the cell Debris samples, and

Time is time taken for colour change in minutes. If

values were <0.045, 0.04 was substituted.

and 2 using gel extraction as DNA templates – to

attempt more transformations, as the results for the

screenings suggested that Fpr1 was involved in some

interactions, and therefore a bait was required. The

result of this PCR was significantly more positive than

previous attempts (Fig. 7B), and 3 transformations were

Fig. 6. Nested PCR gel electrophoresis images of Fpr1 and restriction digest of yeast DNA vectors. A) First stage PCR, a clear band between 200-400bp reference markers is present, showing clear presence of the Fpr1 DNA sequence. B) Sec-

ond stage PCR, a clear and high concentration band is present between 400-600bp reference markers, showing the over-hang codons successfully integrated into the Fpr1 DNA sequence. C) Restriction digest electrophoresis shows clear bands

at ~10kbp, confirming the vector DNA is present and at appropriate size.

A B C

A B

Fig. 7. Second rounds of the nested PCRs. A) Multiple, low concentration bands of Fpr1 formed, later being transformed and unsuccessfully accepted into the cell, as shown by the yeast PCR (Fig. 3). B) 4 PCR products, 2 utilising DNA ex-

tracted from the gel of previous round of PCR (E1 and E2), and 2 using the previous round PCR product itself (P1 and P2). P1 and P2 were used in a successful transformation as they showed the clearest and highest concentration of Fpr1

DNA.

Fig. 8. Gel image of the yeast PCR of cells transformed with Fpr1 and Hsf1 DNA, both pADC and pBDC. No samples showed positive, with only dimer primers forming for every sample. Whilst some appear between 200-400bp, the amount

of smearing indicated a negative result.

Table 8. Colony counts of successful transformation for all but BD-Fpr1 cells

performed to provide the best possible chance of

successful bait transformation.

Yeast 2-Hybrids

As Hsf1 and Hsp90 baits had been successfully

transformed, yeast 2-hybrids were mated from these

using Fpr1 in prey only form until a bait was

successfully created, whilst troubleshooting the

transformations to aim for positive Fpr1 baits. The full

list of mates used in this yeast 2-hybrid can be found in

Table 4.

Numerous sets of yeast 2-hybrid screens were

designed: the first were designed to identify interactions,

if any, between BD-Hsp90 & BD-Hsf1 baits and the AD

-prey proteins mated with them (Fig. 9). This screen

showed that the recombination had been successful, and

the screens could now involve varying conditions to

observe the effect on interactions. The second set of

screens involved control and heat shock temperatures

(26°C and 39°C respectively), and rapamycin at a

100nM concentration to check the intensity of ß-

galactosidase activity between the interacting proteins

(Fig. 10).

Initial Interactions

As CDC37 and SHE4 are previously identified

interactors of Hsp90 (Millson et al., 2014), it was

unsurprising that both interacted under both control and

heat shock conditions, with CDC37 showing

considerable interaction at ~25 and ~11 MU

respectively.

With the remaining unknown interactors, Hsf1

showed some interaction under control conditions (~7

MU), but increased considerably under heat shock

conditions (16 MU). This result further supports the

initial theory that Hsf1 is an important regulator of

Hsp90 within the heat shock response. As it is thought

that TOR directly phosphorylates Hsf1, the decreased

interaction in the presence of rapamycin supports this.

TOR1 showed good interaction under control conditions

(14 MU), with a slight increase under heat shock

conditions (17 MU), suggesting a slight role of TOR1

impacting Hsp90 during the heat shock response. TOR2

showed a considerable increase between control and

heat shock conditions of ~16 MU, suggesting that there

is a far more direct interaction with Hsp90 compared to

TOR2. Fpr1 showed good interaction, with a slight

decrease under heat shock conditions. As the nature of

the interaction between Hsp90 and Fpr1 is currently

unknown, this only suggests a different pathway for

Fpr1 during heat shock.

Hsf1 interacted with both TOR1 and TOR2, which

increased slightly between the control and heat shock

conditions. An interaction was also seen with Fpr1,

which behaved similarly to TOR in that there was a

slight increase in interaction strength between control

and heat shock conditions. Some small galactosidase

activity was seen with SHE4, but to no significant level

to be suggestive of any relevant or notable interactions.

CDC37 had, by far, the most intense interaction at ~35

MU. As the increase was so slight between control and

heat shock conditions, it suggests CDC37 consistently

interacts, but to no extent as part of a heat shock

response interaction with Hsf1. Interestingly, the

control (empty vector) protein had stronger interactions

with Hsf1 than SHE4, suggesting self-activation of

Hsf1 and its binding partners was occurring.

These screens consistently showed the expected

decrease in all interactions in both BD-Hsp90 and BD-

Hsf1 in the presence of rapamycin, as supported by the

current theory that both Hsp90 and Hsf1 rely on TOR

activity.

Rapamycin Interactions

Given the drop in interactions were considerable

across all samples, the following screen involved

concentrations of rapamycin samples 4 times greater

and weaker than the previous screen, 400nM and 25nM

respectively, as well as a control of no rapamycin. 26°C

was the constant temperature, with no heat shock

occurring. 400nM rapamycin is concentrated enough to

be toxic to the cells, making the far weaker 25nM the

concentration of interest.

The results (Fig. 11) showed a considerable increase

of Hsf1 interaction at 25nM, over twice that of no

rapamycin. Simultaneously, TOR1 interactions with

Hsf1 are considerably lower in the presence of

rapamycin. This provides a problem with the current

Fig. 9. Initial yeast 2-hybrid screen to ensure that recombination was successful and interactions were taking

place between BD– Hsp90 and Hsf1 and the AD-Interactor proteins. AD-Hsp90 was not available, hence BD-Hsf1 was

tested only against AD-Hsf1.

A B

Fig. 10. Yeast 2-hybrid screens of BD- Hsp90 (A) and Hsf1 (B) under various conditions: 26°C (control), 39°C (heat shock), and 100mM Rapamycin at 26°C. Interactions fell considerably in the rapamycin samples, prompting a repeat using varying

concentrations.

A B

Fig. 11. Yeast 2-hybrid screens of BD– Hsp90 (A) and Hsf1 (B) under varying concentrations of rapamycin at 26°C. Unlike the previous screens, rapamycin levels affect in various ways as opposed to simply stopping most interactions. The spike at

25nM rapamycin in BD-Hsp90 vs AD-Hsf1, the constant interaction strength of BD-Hsp90 vs AD-Fpr1, and the increase in activity with no rapamycin in BD-Hsf1 vs AD-TOR1, led to the speculation of an alternate pathway than initially thought.

400nM rapamycin samples showed unexpectedly high activity in most samples, suggesting artifacting due to too great a concentration. BD-Hsf1 vs AD-Control remains unusually high in activity.

A B

Fig. 12. Yeast 2-hybrid screens of BD– Hsp90 (A) and Hsf1 (B) under varying concentrations of rapamycin at 26°C. 100nM rapamycin was reintroduced to provide a theoretically smoother curve of ß-galactosidase activity. This smooth increase did

occur between BD-Hsp90 vs Fpr1, which also had the highest activity even at 400nM rapamycin (>3 MU). BD-Hsf1 vs Fpr1 also show an interesting increase in activity, but only at 25nM rapamycin, before activity drops and appears to climb steadily

again. BD-Hsf1 vs Control again shows activity.

Fpr1 baits were eventually successfully created, and

mated with all of the preys used in the initial yeast 2-

hybrids. The Fpr1 mates were also grown with the

same Hsp90 and Hsf1 mates as the most recent screen

(Fig. 12 setup), so that the Fpr1 interactions, if any,

would be in line with those of the other baits and show

consistent results.

The setup involved Rapamycin combined with the

mates in 0nM, 25nM, 100nM, and 400nM

concentrations. In addition, a set of control and heat

shock environments were included (26°C and 39°C

respectively). Both temperature conditions would

provide information on the interactions of BD-Fpr1, as

well as indicating any changes in interactions with BD-

HSP90/Hsf1 in the presence of varying Rapamycin

concentrations. After screening, all results showed

uncharacteristic spikes at 400nM, potentially due to

artifacting occurring as a result of such a high

concentration. As such, all 400nM readings were

excluded from the results.

The results for Hsp90 (Fig. 13) showed results

similarly consistent to previous screens, especially with

Fpr1 at 39°C, where interactions showed no

considerable change. The largest notable result from

this screen was with AD-Hsf1 under 26°C, where a

considerable increase in interaction occurred at 100nM

(MU increase 4-fold). Interestingly, this increase

mimics that of what was seen in the previous heat

shock screen (Fig. 10), but where there was no

rapamycin present. A similar, yet not as large, increase

in interaction also occurred with AD-TOR1 at 25nM

Rapamycin in 39°C., also similar to the previous heat

shock screen. Under heat shock conditions, AD-Control

showed more increased interactions than before.

The results for Hsf1 (Fig. 14) showed more of note

than the BD-Hsp90 screen, and also supported previous

results. At 26°C, an increase in concentration of

Rapamycin causes a decrease in interaction between all

AD-interactors—most notably AD-TOR1. At 39°C,

there is a considerably strong interaction between BD-

Hsf1 and AD-TOR1 when no Rapamycin is present—a

far greater interaction than any other protein at this

temperature. This interaction dramatically decreases

(dropping 3 MU) when rapamycin is introduced at

25nM, with a slight increase at 100nM, but not as

greatly as the 0nM peak. Interestingly, this spike

mimics the interactions seen previously, but under 26°

C conditions. Interactions with AD-Fpr1 increase

between 0nM and 25nM rapamycin, but then decrease

as the concentration reaches 100nM. This is similar to

the screen seen in Fig. 12, but to a lesser extent,

showing slight consistency. Unlike all previous screens,

interactions with AD-Control are low and do not

change.

theorised pathway (Fig. 2), where TOR1 activates Hsf1,

which in turn activates Hsp90. Instead, a down-

regulation of Hsf1 by TOR1 suggests an up-regulation

of Hsp90 by Hsf1. Conversely, TOR2 maintained

consistent interactions with Hsp90, with no notable

increases, in respect to decreasing rapamycin strengths,

with Hsf1. Fpr1, however, showed a surprisingly

consistently high level of interaction with Hsp90 (~5

MU), with rapamycin concentrations displaying no

effect. Fpr1 interactions increase slightly with Hsf1 in

respect to decreasing rapamycin, but to a similar effect

as TOR2. Fpr1 is a rapamycin binding partner, which is

supported by the previous hybrid screen and the Hsf1

interaction here. However, the consistent level of

interaction with Hsp90, and the large increase of

interaction between Hsp90 and Hsf1 at 25nM, suggests

Fpr1 is somewhere involved. As such, focus shifted at

this point to successfully transforming BD-Fpr1 cells, as

well as testing the effect of rapamycin on the

interactions of BD-Hsp90, AD– Hsf1, Fpr1 & TOR1,

and BD-Hsf1, AD– TOR1 and Fpr1. AD– SHE4,

CDC37, and TOR2 were ignored due to the former 2

having known interactions, and the latter showing

consistent from all screens so far.

These screens were conducted for two reasons: to

once again identify the interactions, but also to try and

provide some clarity on the so-far very different results.

As such, 100nM rapamycin was reintroduced as a

sample type, along with 0, 25 and 400nM. Again, no

heat shock was implemented at this stage.

The screens (Fig. 12) showed some increase in

interaction between Hsp90 and Hsf1 at high levels of

rapamycin, whilst TOR1 interactions—as expected and

as seen consistently so far—decreased in the presence of

rapamycin, dropping to ~2MU in both Hsp90 and Hsf1

baits. As before, BD-Hsf1 and the control showed

greater interaction than some of the other preys.

Interestingly, Fpr1 showed increasing interactions with

BD-Hsp90 as rapamycin concentration increased to

400nM, at which point the interaction falls considerably.

Against BD-Hsf1, interaction spiked in 25nM

rapamycin to nearly triple the other concentrations.

The interactions seen by Fpr1 not only pressed the

issue of obtaining Fpr1 baits, but also raised questions

due to the unexpected reporter activity. As rapamycin

levels increase, and Fpr1 subsequently binds it, its

removal is suggested from any active pathways.

However, these results showed the direct opposite with

the Hsp90 bait, and a considerable opposite at 25nM

with the Hsf1 bait. We therefore posited that, whilst

Fpr1 does bind to rapamycin, there must be a second

binding site to allow the continued interactions with the

bait proteins.

Rapamycin, Heat Shock, and Fpr1

A B

A B

A B

Fig. 13. Yeast 2-hybrid screens of BD-Hsp90 in the presence of various rapamycin concentrations under 26°C non-heat shock (A) and 39°C heat shock (B) conditions. A great interaction is shown between Hsp90 and Hsf1 at 26°C 100nM, whilst TOR1

shows a spike of interaction at 39°C 25nM.

Fig. 14. Yeast 2-hybrid screens of BD-Hsf1 in the presence of various rapamycin concentrations under 26°C non-heat shock (A) and 39°C heat shock (B) conditions. Interaction with TOR1 decreases as rapamycin concentration increases at 26°C,

whilst a spike in interaction is seen with TOR1 at 39°C. Fpr1 interactivity decreases with rapamycin at 26°C, but conversely increases at 39°C. As before, interaction is seen with the Control at 26°C, but not at 39°C as before.

Fig. 15. Yeast 2-hybrid screens of BD-Fpr1 in the presence of various rapamycin concentrations under 26°C non-heat shock (A) and 39°C heat shock (B) conditions. Interactions between TOR1 and Fpr1 at 26°C effectively exchange between 0nM and

25nM rapamycin, the most notable feature of which is that Fpr1 interacts greatly with itself when it cannot bind to rapamycin. At 39°C, interaction with TOR1 is at its greatest, before considerably dropping at 25nM rapamycin. Interestingly, Fpr1 no

longer interacts with itself, even in the presence of no rapamycin.

the 3 day samples.

The outcomes (Fig. 16) confirmed the main

suspicion that BD-Hsf1 was self activating: all 3AT

samples (Fig. 16I) showed effective growth, to almost

the same extent as –LT (Fig. 16C). AD– TOR2 and

Fpr1 were the only exceptions, although growth was

still notable. –LTHA plates (fig. 16F) however

displayed little to no growth, showing that the

recombination had still worked and was preventing the

cells from producing their own histidine/adenine, and

preventing growth.

Similarly, BD-Fpr1 showed strong self activation

with the control on the 3AT plates (Fig. 16G), as well

as a small amount with AD-TOR1. Interestingly,

growth of the control on the –LT plates (Fig. 16A) was

notably poorer than the other AD-interactors, with

TOR1 having not grown much better. Negligible

growth was seen across all mates on the –LTHA plate

(Fig. 16D).

The Hsp90 baits displayed almost all expected

results, with good growth on –LT (Fig. 16B), less

growth on –LTHA (Fig. 16E), showing good promoter

inhibition, and very little growth on the 3AT plates

(Fig. 16H), showing little to no self activation. The

only exception was AD-Fpr1, which grew quite

effectively on the –LTHA plate, but not to the same

extent as most of the BD-Hsf1 samples.

Drug Assays

No discernible information was found with the drug

assays. This was primarily due to continuous

contamination of the plates used to grow the cells in

both agar and assay forms.

Western Blots

The western blots of HIS-tagged Fpr1 varied

somewhat in their success. Interestingly, purified

protein from FPLC run through SDS-PAGE

continuously resulted in negative blots where no bands

formed. Lysing the cells directly and running the

resulting lysate directly through SDS-PAGE showed

the bands, however not within the region of 12kDa.

This was presumed to be the case as no anti-Fpr1

antibody has been commercially developed, therefore a

successful blot relied on very efficient binding of the

anti-HIS antibodies. Peer troubleshooting speculated

that these antibodies had degraded.

Discussion

Rapamycin Interference

The results for BD-Fpr1 (Fig. 15) include the most

notable interactions, despite no previous screens to draw

from. At 26°C, interactions between AD– Hsf1, CDC37,

SHE4, and Control all decrease as rapamycin

concentration increases. The interactions with Hsf1 and

Control are similar in intensity, suggesting some self

activation with the empty control vector similar to BD-

Hsf1 previously, which was tested with selective media

plates (Fig. 16). Interaction with AD-TOR2 increases

slightly at 25nM from 0nM, before dropping to the same

level at 100nM, showing some influence by rapamycin.

The most notable of interactions occur between AD-

TOR1 and AD-Fpr1, however. At 0nM, interaction with

TOR1 is second highest at 1 MU, whilst Fpr1 spikes to

~2 MU. At 25nM, these intensities switch, with TOR1

dramatically spiking to ~2 MU, and Fpr1 dropping to 1

MU. Both interactions further drop at 100nM to 0.5 MU.

At 39°C, interactions with AD– CDC37 and SHE4

drop as rapamycin concentration increased. As before,

interactions with AD– Hsf1 and Control are similar,

both of which drop greatly between 0nM and 25nM,

before rising slightly at 100nM. Interaction with AD-

Fpr1 remained consistently low. Once again however,

the greatest interaction occurs with AD-TOR1, which is

considerable at 4.5 MU at 0nM, before dropping off

greatly to <1 MU at 25nM, followed by a slight increase

at 100nM. Unexpectedly, AD-TOR2 also shows good

interaction, reflected by the second highest ß-

galactosidase activity at 2 MU at 0nM rapamycin. This

significantly drops at 25nM, but interestingly does not

rise again at 100nM as AD– Hsf1, TOR1, and Fpr1 did.

Selective Media Plates

As BD-Hsf1 and AD-Control consistently showed ß-

galactosidase activity greater than some other AD-

interactors, in addition to results varying greatly

between screens of the other yeast 2-hybrids, selective

agar was used to check for self activation and growth

promotion. These were tested using –LTH + 4nM 3-

Amino-1,2,4-triazole (abbreviated here to 3AT) plates,

and –Leu –Trp –His –Ade (–LTHA) plates respectively.

If self activation was occurring, 3AT would not

competitively inhibit the cells and they would grow

effectively, with similar principles applying to the –

LTHA plates, but relying on the relevant ORFs in the

yeast DNA. –Leu –Trp (–LT) plates were also used to

act as controls, as the yeast 2-hybrids had already shown

they could grow reliably due to continuous streak plates

being created to maintain cell health. Cells were grown

on the media over 3 days and observed. Note that 3AT

has an effective time of 3-11 days, so cells were

returned to incubation following this observation,

however no noteworthy differences occurred in this

time. As such, images and the following analysis refer to

A B

C D

E F

Fig. 16. Selective media plates after 3 days of growth. Plate setups were:

SDC–LT with Fpr1 (A), Hsp90 (B), and Hsf1 (C) hybrids;

SDC–LTHA with Fpr1 (D), Hsp90 (E), and Hsf1 (F) hybrids;

SDC–TLH + 4nM 3AT with Fpr1 (G), Hsp90 (H), and Hsf1 (I) hybrids.

All –LT plates grew effectively. BD-Hsp90 v AD-Fpr1 displayed quite effective growth on –LTHA agar, whilst all other

samples did not. Very little growth was seen with any Hsf1 bait on this agar. Hsp90 baits also did not grow effectively on –TLH

+ 4nM 3AT agar.

G H

I

and non-heat shock conditions respectively. However,

this was not replicated during the successive screens

and was removed from the list of interactors to be

tested. Interestingly, BD-Hsp90 interaction with AD-

Fpr1 was higher at 26°C compared to 39°C, whilst BD-

Hsf1 interaction was lower, indicating a greater

interaction with the latter during heat shock. However,

this indication was not supported in the BD-Fpr1

screen, with very little change occurring between low

and high temperature. In light of 100nM rapamycin

behaving as expected and reducing all interactions, the

notable difference in these screens was the extreme at

which the drop occurred—in all follow up screens, the

difference was rarely greater than 50%.

Several screens (Fig. 10, 11 & 12) indicated that

Hsp90 and TOR1 interacted in the presence of no

rapamycin, with interactions decreasing as

concentration of rapamycin increased. Further screens

also continued to show a strong interaction between

Hsp90 and Hsf1 in the presence of rapamycin at 25 and

100nM concentrations, whilst Hsf1 and TOR1

interaction decreased in the presence of rapamycin

(Fig. 14). This suggested that TOR1 interacts with Hsf1

to some extent regardless of heat shock conditions

when no rapamycin is present, and can no longer do so

in the opposite circumstance. Meanwhile, Hsf1 begins

to interact with Hsp90 as access to TOR1 is decreased

as a result of the rapamycin. The latter set of screens

(Fig. 13 & 14) further supported both of these

observations, where high interaction was seen between

Hsf1 and TOR1, and a considerable rise in interaction

between Hsp90 and Hsf1 occurs at 100nM rapamycin.

Whilst it became clear that rapamycin resulted in Hsf1

relocating to Hsp90, the mechanism of action remains

unclear.

Whilst it is unknown if the interaction between Hsf1

and TOR1 under these conditions is causing a

regulatory phosphorylation, which is known to take

place under heat shock (Mendillo, 2012), the stress

induced by rapamycin and the movement of Hsf1 to

Hsp90 is suggestive that this is the case in line with

published evidence.

Prior to obtaining the Fpr1 baits, an interaction that

proved interesting was between BD-Hsp90 and AD-

Fpr1 in the presence of rapamycin: two screens (Fig. 11

& 12) showed different results, the former showing no

change at all and the latter showing a steady increase as

rapamycin increased, but always at a consistently

higher level than the other interactors (with the

exception of Hsf1 at 25nm rapamycin). Despite no

Hsp90 prey available to test if the interaction was

mirrored when using Fpr1 baits, the high level of

interaction in the previous screen (Fig. 10) further

supported the theory that an interaction was present.

Once the Fpr1 bait had been obtained, the screens (Fig.

Throughout almost all yeast 2-hybrid screens

conducted, 400nM rapamycin caused the largest

inconsistencies in results. This effect can be attributed to

interference caused by aggregation of rapamycin due to

its cytotoxicity inhibiting effective cell function

(Thorne, 2010). This is especially apparent in the latter

of the screens conducted (Fig. 13-15), whereby 400nM

had to be excluded from the results altogether due to

such great interference. 400nM in the previous screens

(Fig. 11 & 12) also showed high levels of interaction,

but the level of this interference was considerably lower

and was therefore included.

Conversely, the initial screen involving rapamycin (Fig.

10) seemed to indicate that rapamycin wrongly inhibited

all interactions to an extreme, even at 100nM. However,

this was shown to be consistent in almost every

following screen, both in 26°C and 39°C conditions,

whereby 100nM rapamycin showed the lowest levels of

interaction at a high concentration, assuming 400nM

was excluded due to its interference.

The inconsistencies initially noted with rapamycin were

therefore ignored, as every successive screen contained

elements which supported its predecessor, allowing for

precise observations.

Known Interactors and the Control

Vector

Yeast 2-hybrid reporter activity between BD– Hsp90

& Hsf1 and AD– CDC37 & SHE4 all supported

previously published interactions (Millson et al., 2005 &

2014), whereby activity decreased during both heat

shock conditions and when rapamycin was present. BD-

Fpr1 also mimicked these interactions in ß-galactosidase

activity, but at such a lower level that it was almost

negligible. What became apparent from initial screens

and confirmed by the latter screens, was that Hsp90,

Hsf1, Fpr1, Tor1, and even Tor2, were involved in a

very sensitive pathway. Whilst BD– Hsf1 and Fpr1

seemed to interact consistently with the empty vector

(AD-Control), this was deemed to be a result of self-

activation via selective media (Fig. 16), almost

exclusively found between these proteins alone, and

therefore not affecting the rest of the results.

Interactions at 26°C and Updated

Pathway

As expected, in the early interaction screens Hsp90

and Hsf1 interacted greater under heat shock conditions,

as did Hsf1 and TOR1, supporting the theorised

pathway so far (Fig. 2). Both also notably interacted

with TOR2, with a considerable increase with Hsp90

and slight increase with Hsf1 when under heat shock

binding sites between interactor proteins and

rapamycin: low levels allow Fpr1 to bind effectively in

conjunction with rapamycin, but high levels inhibit

TOR1 action with Fpr1 altogether.

As described above, 100nM also causes a spike in

Hsp90-Hsf1 interaction, as well as a decrease in Hsf1-

TOR1 interaction. Coupled with the interaction seen

between Fpr1 and TOR1, this led to the speculation that

Hsf1 and Fpr1 were both required in order for each

other to bind to TOR1. Once phosphorylated by TOR1,

Hsf1 then relocates to Hsp90, releasing Fpr1 from itself

and subsequently TOR1, as supported by the

interactions seen in Fig. 13, 14 and 15.

This information allowed an updated pathway to be

identified between these key proteins (Fig. 17). Whilst

the initial theory (Fig. 2) was rudimentary in nature,

some basic similarities were maintained, but only in the

context of 26°C, and not taking rapamycin into

account. The updated pathway also highlights a key

change in that Hsf1 interacts with TOR1 as part of its

apparent dependence on Fpr1 to do so, rather than vice

versa.

Interactions at 39°C and Updated Pathway

At 39°C heat shock (HS), Hsp90 showed greater

interactions with Hsf1 than at 26°C, supporting the

already established interactions (Ali, 1998). Both

screens including heat shock (Fig. 10 & 13) also

showed an increase in interaction with Hsp90 and

TOR1. This interaction increased when 25nM

rapamycin was included. Simultaneously, interaction

between Hsf1 and Fpr1 also increased considerably at

25nM from relatively low interactions at 0nM, whilst

Hsf1-TOR1 interaction was considerably low. These

elements combined again suggest the role of Fpr1 being

13) once again showed that interactions between Hsp90

and Fpr1 remain almost identical, regardless of

rapamycin concentration, albeit at a very low level of ~1

MU.

As the interactions between Hsp90, Hsf1, and TOR1

became identified, focus shifted onto how Fpr1

interacts, with the expectation that some missing pieces

of the pathway would become clear.

The BD-Fpr1 screen (Fig. 15) curiously showed an

interaction with Hsf1, which decreased as rapamycin

concentration increased. This was equally reflected to a

similar degree in the Hsf1 screen conducted at the same

time (Fig. 14).

Alongside this, the most notable results of the screen

showed that Fpr1 interacts highly with itself when no

rapamycin is present. This is likely due to the

association Fpr1 has with the DNA-binding proteins

Hmo1 and Fap1 (Kunz, 2000), potentially causing Fpr1

to be involved in bridged interactions with other Fpr1 as

they compete for these proteins. When rapamycin is

present, Fpr1 favours it and is sequestered from any

previous interactions. This is supported by the

considerable drop of these self-interactions as rapamycin

concentration increases.

Interestingly, in conjunction with these high levels of

self-interaction, Fpr1 also interacted with TOR1 with

greater interaction than the remaining interactors when

no rapamycin was present. At 25nM rapamycin, this

interaction doubles, whilst the previously noted self-

interaction halves. This provided clear evidence that

rapamycin-bound Fpr1 relocates to TOR1, potentially to

begin inhibition of forming TORC1 complexes as a

result of the stress caused by the rapamycin. However,

at 100nM rapamycin concentration, this interaction

plummets to lower than when no rapamycin is present.

This is potentially due to the difference in TOR1

Fig. 18. The speculated pathway between Hsp90, Hsf1, Fpr1,

TOR1 and TOR2 at 39°C. ‘Low R’ represents rapamycin

concentrations of 25nM. ‘R’ represents rapamycin

concentrations ≥100nM. Double arrows represent

dramatically increased interaction relative to 26°C.

Fig. 17. The newly identified pathway between Hsp90, Hsf1,

Fpr1, and TOR1 at 26°C. ‘Low R’ represents rapamycin

concentrations of 25nM. ‘R’ represents rapamycin

concentrations ≥100nM

interaction with TOR1 and Hsp90. Equally, Hsp90 has

been suggested to bind to Fpr1 and other homologous

immunophilins (Cox, 2000), which was further

supported by the high levels of interaction in Fig. 10,

11A, 12A, and 13B.

As such, it was suggested that Fpr1 is constantly

associating with itself, Hsp90, and its associated

proteins Fap1 and Hog1 when no rapamycin is present.

When introduced, rapamycin causes Fpr1 to

disassociate from Hsp90 and begin binding rapamycin.

Simultaneously, the stress induced onto the cell from

the rapamycin elicits a response from Hsf1 to begin

transcription of the shock proteins. It hereby begins

binding to Fpr1, in greater amounts than Fpr1 to

rapamycin, in order to further bind to TOR1 and

become phosphorylated, followed by Hsp90

interactions. As Hsf1 interacts with Hsp90, Fpr1 is also

re-associated with Hsp90. The total movement of Fpr1

is relatively unchanged, and therefore no difference in

interactions occur between Hsp90 and Fpr1.

The alternative theory focused on the interactions

between Hsp90 and Fpr1 that do change. The core

process is a repeat of the previous theory, however

assuming that a either greater amount of Fpr1 binds to

Hsf1 than rapamycin, or Fpr1-rapamycin complexes

can bind to Hsf1 and not inhibit the activity of TOR1

phosphorylation.

One hurdle to consider in either theory is that of

Hsf1 under HS conditions; it translocates to the nucleus

during the shock response in order to begin its

transcription activity (Medillo, 2012). In order for the

proposed interactions to occur, Hsp90 must also

translocate to the nucleus to maintain/increase the level

of interaction with the Hsf1-Fpr1 complex. One

proposed idea to support the suggested theories is that

Fpr1 or Hsf1 might be involved in the regulation of a

Hsp90 co-chaperone responsible for modifying the C-

terminus of Hsp90. As Hsp90 is held within the cell

cytoplasm via an anchoring signal located between

amino acids 333-664 (Passinen et al., 2001), it is

possible that a modification could break this anchor,

and allow a Hsf1-bound Hsp90 to translocate to the

nucleus and maintain interactions. This modification is

potentially a result of other immunophilins, perhaps

even Fpr1 or other FK506 binding proteins (Dawson et

al., 1994).

Conclusion

Multiple yeast 2-hybrid screens revealed that a

linear pathway was not present between the heat shock

proteins Hsp90, Hsf1, TOR1, and Fpr1, but rather a

complex system of varying co-interactions. Evidence

suggested that Hsf1 and Fpr1 require association with

a binding partner to Hsf1, however this time evidence

indicated that it may be essential for Hsf1 to form any

bond.

This is supported further by the interactions seen

between Hsf1, Fpr1 and TOR1. Under HS with no

rapamycin, there is great interaction between Hsf1 and

TOR1, as well as between Fpr1 and TOR1. Both

intensities drop dramatically when 25nM rapamycin is

present, before rising slightly at 100nM. This direct

mirroring further indicates some degree of co-operation

between Fpr1 and Hsf1, compounded by a further

interaction mirroring with Hsp90-Hsf1 as previously

mentioned.

One intriguing interaction was with TOR2: both

Hsp90 and Fpr1 showed good interactions with it when

no rapamycin was present. The interactions with TOR2

dropped in both cases when rapamycin was present, in a

similar but less drastic way to TOR1.

The mechanisms of these interactions remain unknown,

as Hsp90 was initially thought to not share significant

direct interactions with TOR1 or TOR2, both of which

seem to be incorrect in light of results shown. In the

context of Fpr1, the interaction is likely due to the

structural similarity between TOR2 and TOR1,

indicating their interaction is caused by the same

mechanisms of rapamycin-bound Fpr1 binding to them.

The final curiosity that arose was again the affect of

rapamycin on the interaction between Hsp90 and Fpr1.

Similar to previous screens, the levels of ß-

galactosidase activity did not change in response to

rapamycin in the screens represented by Fig. 11A &

13A, but however did vary in Fig. 12A.

Collectively, this information allowed for the

construction of a pathway identifying the interactions

between these proteins (Fig. 18). The most notable

feature is the increase in number of interactions under

HS when compared to 26°C conditions, including the

appearance of the Hsp90-Fpr1 interaction and TOR2.

The pathway assumes that the changing interaction

between Hsp90 and Fpr1 found in Fig. 12A was as

relevant as the other screens, but does not account for

rapamycin having an influence based on this particular

scenario being the minority.

Hsp90 and Fpr1 Interactions

Given the inconsistency between the results of the

Hsp90-Fpr1 screens, whereby in the majority of cases ß

-galactosidase activity did not change in response to

rapamycin and in others it did, even regardless of HS.

Speculation arose as to which scenario was accurate

and, if so, what potential mechanisms were involved.

The initial theory was focused on the interactions not

changing in intensity. Evidence gathered suggested that

Hsf1 and Fpr1 required one another to form any

each other in order to bind TOR1, and potentially for

Hsf1 to bind Hsp90, before translocating to the cell

nucleus and reducing interactions. TOR2 interactions

were to a similar degree, but only under heat shock

conditions. Fpr1 showed strong self-interactions likely

as a result of associating constantly with Fap1 and

Hog1.

Rapamycin inhibited interactions between Hsf1, Fpr1,

and TOR1, as well as inhibiting Fpr1 self-interaction.

Interactions between Hsf1 and Hsp90 were promoted in

the presence of rapamycin under both normal and heat

shock conditions, while Hsp90 largely increased

interaction with TOR1 only under heat shock, which

was further upregulated in the presence of rapamycin.

Interactions between Fpr1 and Hsp90 remained

inconsistent, with only speculation as to why either set

of outcomes occurred.

Further work is required with a focus on the

and IRF2 transcription factors in leukaemogenesis.

Current Gene Therapy. 6(5):543-50

Chou SD, Prince T, Gong J and Calderwood S (2012).

mTOR Is Essential for the Proteotoxic Stress

Response, Hsf1 Activation and Heat Shock Protein

Synthesis. PLoS One. 7(6): e39679

Cox MB & Smith DF (2013). Madame Curie Bioscience

Database, NCBI Bookshelf. Available: http://

www.ncbi.nlm.nih.gov/books/n/eurekah/

Dawson TM, Steiner JP, Lyons WE, Fotuhi M, Blue M,

Snyder SH (1994). The immunophilins, FK506

binding protein and cyclophilin, are discretely

localized in the brain: relationship to calcineurin.

Neuroscience. 62(2):569-80

Dolinski KJ and Heitman J (1999). Hmo1p, a high

mobility group 1/2 homolog, genetically and

physically interacts with the yeast FKBP12 prolyl

isomerase. Genetics. 151(3):935-44

Fields S (2000). Fields Lab Home Page Protocols.

Available: http://depts.washington.edu/sfields/

protocols/primers.html

Gottesman M (2002). Mechanisms of Cancer Drug

Resistance. Annual Review of Medicine. 53:615-627

Goodsell D (2008). Hsp90. http://www.rcsb.org/

pdb/101/motm.do?momID=108

Hejmadi, M (2010). Introduction to Cancer Biology 2nd

Ed. P7-9.

Jackson SE (2013). Hsp90: structure and function.

Topics in Current Chemistry. 328:155-240.

Koltin Y, Faucette L, Bergsma DJ, Levy MA, Cafferkey

R, Koser PL, Johnson RK, Livi GP (1991). Rapamycin

sensitivity in Saccharomyces cerevisiae is mediated by

a peptidyl-prolyl cis-trans isomerase related to human

References

Åkerfelt M, Morimoto RI and Sistonen L (2010). Heat

shock factors: integrators of cell stress, development

and lifespan. Nature Reviews Molecular Cell Biology.

11:545-555

Ali A, Bharadwaj S, O’Carroll R, Ovsenek N (1998).

Hsp90 interacts with and regulates the activity of heat

shock factor 1 in xenopus oocytes. Molecular Cell

Biology. 18(9):4649-60

Ballou LM and Lin RZ (2008). Rapamycin and mTOR

kinase inhibitors. Journal of Chemical Biochemistry.

1:27-36.

Benjamin D, Colombi M, Moroni Christoph, Hall M N

(2011). Rapamycin and derivative compounds

(rapalogues): structures and approved drugs. Nature

Reviews Drug Discovery. 10:868-880.

Bulman AL, Hubl ST, Nelson HC (2001). The DNA-

binding domain of yeast heat shock transcription factor

independently regulates both the N– and C-terminal

activation domains. Journal of Biological Chemistry.

276(43):40,254-62

Cancer Research UK (2012). Worldwide Cancer

Statistics. Available: http://www.cancerresearchuk.org/

cancer-info/cancerstats/world/

Cancer Research UK (2014). Cancer Treatments.

Available: http://www.cancerresearchuk.org/about-

cancer/cancers-in-general/treatment/&http://

www.cancerresearchuk.org/about-cancer/cancers-in-

general/treatment/biological/types/

Cancer Research UK (2015). Chemotherapy. Available:

http://www.cancerresearchuk.org/about-cancer/cancers

-in-general/treatment/chemotherapy/

Choo A, Palladinetti P, Passioura T, Shen S, Lock R,

Symonds G and Dolnikov A (2006). The role of IRF1

interactions of Hsp90 and Fpr1, in addition to

identifying a comprehensive mechanism of action

between the binding of Hsf1 and Fpr1 to TOR1,

specifically that of how reliant on each other the proteins

are in order to form such a bond. Whilst there is good

external evidence to suggest that the Fpr1 self-

interactions are a result of its associating proteins,

additional work on this matter would also be

recommended, as the interactions may also be a result of

proteins within the heat shock response.

Acknowledgements

Thank you the University of Lincoln for providing state

of the art facilities and support staff. Many thanks to my

supervisor, Dr Stefan Millson, for being of constant

encouragement and support throughout the research

period. A big thank you to the folks in Bay 7 for

FK506-binding protein. Molecular and Cellular

Biology. 11(3):1718-23

Kunz J, Loeschmann A, Deuter-Reinhard M, Hall MN

(2000). FAP1, a homologue of human transcription

factor NF-X1, competes with rapamycin for binding to

FKBP12 in yeast. Molecular Microbiology. 37(6):1480

-93.

LeGendre O, Breslin PAS and Foster DA (2015). (-)-

Oleocanthal rapidly and selectively induces cancer cell

death via lysosomal membrane permeabilization.

Molecular & Cellular Oncology. 2(4)

Lieff J (2015). The Very Intelligent Protein mTOR.

Available: http://jonlieffmd.com/blog/intelligent-

protein-mtor

Limson MV & Sweder KS (2010). Rapamycin inhibits

yeast nucleotide excision repair independently of tor

kinases. Toxicology Sciences: An Official Journal of

the Society of Toxicology. 113(1):77-84.

Medillo ML, Santagata S, Koeva M, Bell GW, Hu R,

Tamimi RM, Fraenkel E, Ince TA, Whitesell L,

Lindquist S (2012). Hsf1 drives a transcriptional

program distinct from heat shock to support highly

malignant human cancers. Cell.150(3):549-562.

Millson S, Truman AW, King V, Prodromou C, Pearl

LH, Piper PW (2005). A Two-Hybrid Screen of the

Yeast Proteome for Hsp90 Interactors

Uncovers a Novel Hsp90 Chaperone Requirement in

the

Activity of a Stress-Activated Mitogen-Activated

Protein Kinase, Slt2p (Mpk1p). Eukaryotic Cell. 4

(5):849-860

Millson S, Oosten-Hawle P, Alkuriji MA, Truman A,

Siderius M, Piper PW (2014). Cdc37 engages in stable,

S14A mutation-reinforced association with the most

atypical member of the yeast kinome, Cdk-activating

kinase (Cak1). Cell Stress Chaperones. 19(5):695-703.

Mita M, Sankhala K, Abdel-Karim I, Mita A, Giles F

(2008). Deforolimus (AP23573) a novel mTOR

inhibitor in clinical development. Expert Opinion on

Investigational Drugs. 17(12):1947-54.

NHS (2013). Chemotherapy. Available: http://

www.nhs.uk/Conditions/chemotherapy/Pages/

Definition.aspx

Passinen S, Valkila J, Manninen T, Syvälä H, Ylikomi T

(2001). The C-terminal half of Hsp90 is responsible

for its cytoplasm localization. European Journal of

Biochemistry. 268(20):5337-42

Salanti A, Clausen TM, Sorensen PH (2015). Targeting

Human Cancer by a Glycosaminoglycan Binding

Malaria Protein. Cancer Cell. 28(4):500-514

SEER (2012). SEER Stat Fact Sheets: All Cancer Sites.

Available: http://seer.cancer.gov/statfacts/html/all.html

Thorne N, Auld DS, Inglese J (2010). Apparent Activity

in High-Throughput Screening: Origins of Compound-

Dependent Assay Interference. Current Opinions in

Chemical Biology. 14(3):315-324.

Trepel J, Mollapour M, Giaccone G, Neckers L (2010).

Targeting the Dynamic Hsp90 Complex in Cancer.

Nature Reviews Cancer. 10(8):537-549.

Yang H, Rudge DG, Koos J, Vaidialingam B, Yang HJ,

Pavletich NP(2013). mTOR kinase structure,

mechanism and regulation. Nature. 497:217-224.

Zhao R and Houry WA (2005). Hsp90: a chaperone for

protein folding and gene regulation. Biochemistry and

Cell Biology. 83(6):703-10.