Gang BaoDepartment of Biomedical Engineering

Georgia Institute of Technology and Emory UniversityAtlanta, GA 30332

Fluorescent Probes for Live-Cell Gene Detection

Gene Expression Dynamics in Live Cells

• Recent studies confirm that mechanical forces can alter almost all cellular processes, including cell growth, differentiation, movement, signal transduction, protein production/secretion and gene expression• An example is altered gene expression in endothelial cells under shear flow. We found that eNOS mRNA increased its level by ~4.5 fold under laminar shear for 24 hr, while Klf2 mRNA level increased more than 25 fold with just 2 hr of laminar shear. No change in eNOS and Klf2 mRNA level under oscillatory shear

ST LS 2h LS 8h LS 24h OS 2h OS 8h OS 24h

Rel

ativ

e hK

lf2 m

RN

A a

mou

nt

(nor

mal

ized

by

18S

rRN

A)

0

10

20

30

40Shear Stress-induced Changes in KLF2 mRNA Level in EC

Shear Stress-induced Changes in eNOS mRNA Level in EC

Experimental Challenges in Studying the Dynamics of Live Cells under Mechanical Forces

How to visualize the dynamics of proteins, protein complexes and subcellular structures in living cells in real time?

How to quantify changes in gene express in living cells in real time?

How to monitor changes in protein-protein, protein-DNA, protein-RNA interactions in living cells in real time?

Live-cell Imaging MethodsOptical microscopy is one of the most widely used imaging methods

in biomedical research due to its molecular specificity and fast image acquisition. Optical microscopy methods include Bright field, Dark field, Phase contrast, Differential interference contrast (DIC), Fluorescence, Confocal laser scanning, and Deconvolution microscopy

However, the spatial resolution of conventional optical microscopy, classically limited by the diffraction of light to ~250 nm, is substantially larger than typical molecular length scales in cells

Advanced optical microscope technologies, including STED-4pi, stochastic optical reconstruction microscopy (STORM), photo-activated localization microscopy (PALM), and structured illumination (SI) have been developed recently to overcome the diffraction limit

Stochastic Optical Reconstruction Microscopy (STORM)

STORM uses photo-switchable fluorescent probes to temporally separate the otherwise spatially overlapping images of individual molecules, allowing the construction of high-resolution images.

STORM can achieve three-dimensional, multicolor fluorescence imaging of molecular complexes, cells, and tissues with ~20 nm lateral and ~50 nm axialresolutions.

Xiaowei Zhuang

Tagging Methods for Live-cell Imaging of Proteins

Fluorescent ProteinsOrganic FluorophoresQuantum Dots FlAsH, ReAsHSNAP, HaLo

No existing method that can be used for imaging endogenous proteins in living cells

Study the Assembly and Disassembly of HR and NHEJ Machines that Repair DNA Double Strand Break

HR NHEJ• NHEJ and HR have different features in repairing DSBs. However, HR is likely more accurate than NHEJ in DSB repair• Not clear what controls pathway choice (role of cell-cycle stage)

• Need to understand both NHEJ and HR pathways

• Similarities and differences in design principles

• Foci structures

Tagging NHEJ with Fluorescent Proteins

Dynan Lab

Orthogonal Protein Tagging/targeting

• Fluorescent protein (FP) and quantum dot (QD) based approaches each has its pros and cons:

- FP based tagging is highly specific and easy to color-multiplex, but it’s difficult to visualize the formation of a single NHEJ in a living cell. Low signal level, photobleaching, and possible interference are major issues

- QDs have high signal intensity and photostability, and the advantage of color multiplexing. But functionalized QDs are large (12-20 nm), may interference with complex assembly, and have low signal-to-noise ratio

• There is a need to develop better probes and tagging strategies with small size and using organic fluorophores

SNAP tag and Tetra-cysteine Tag

SNAP tag Benefits:1. Stable covalent labeling2. One tag, multiple

substrates, flexible color choice

3. Higher signal intensity4. Better photostability

ReAsH Labeling Molecule ReAsH – TC complex (Non-Fluorescent) (Fluorescent)

ReAsH Labeling Molecule ReAsH – TC complex (Non-Fluorescent) (Fluorescent)

ReAsH-EDT2 tag

Orthogonal Tagging Strategies

enzyme catalyst

NH2biotin

biotin ligase

NH2 HN lipoatelipoic acidligase

Simultaneous labeling and imaging of two receptors in HEK cells. HEK cells coexpressing a LAP-LDLR fusion and either AP-EGFR (a) or AP-EphA3 (b) were labeled by first treating with LplA, biotin ligase, azide 7 and biotin, followed by cyclooctyne-Cy3 to derivatize the azide, followed by monovalent streptavidin-Alexa Fluor 488 to detect the biotin.

Ting Lab

Alice Ting

Major Issues and Challenges in Imaging Protein Machines in Live Cells

Visualizing low-copy-# proteins in a single cellular machine

Requires orthogonal tagging and multi-color imaging

Need high signal intensity and low photobleaching to increase signal-to-noise

Potential issues with interference and spatial resolution

Tagged proteins vs. endogenous proteins, free components vs. assembled components, bound probes vs. unbound probes

The Central ‘Dogma’ of Biology

Imaging Gene Expression in Living Cells• The need to detect gene expression in vivo

– Monitor in real-time the changes in mRNA expression level due to disease states, toxic assaults, stimuli, drug leads, etc

– Study mRNA processing, localization, and transport, and quantify the knock-down effect of siRNA

– Perform disease detection and diagnosis

• In vitro methods such as real time PCR, Northern blotting and DNA microarrays rely on the use of cell lysates and therefore cannot obtain temporal & spatial information• FISH (fluorescence in situ hybridization) assays require washing to achieve specificity, cannot be used for live cells • GFP and other reporter systems cannot measure endogenous mRNA expression in living cells

Fluorescent Probes for Live-cell RNA Detection

Cellular Delivery of Probes

SLO CCP

SLO + NLS

How to Design a Molecular BeaconSurvivin cDNA: total 429a tgggtgcccc gacgttgccc cctgcctggc agccctttct caaggaccac

cgcatctcta cattcaagaa ctggcccttc ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat ccactgcccc actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct ggaaggctgggagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact ggacagagaa agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt tgaggaaact gcgaagaaag tgcgccgtgccatcgagcag ctggctgcca tggattga

• Select sequences of 15-20 bases that are unique to the target gene

• Add stem sequences and determine the melting temperature

• Perform solution studies to determine signal-to-noise ratio

• Perform cellular studies to check the target accessibility

Different mRNA localization in Living Cells

Survivin mRNA in MiapaCa-2 β1-integrin mRNA in MG63 AR mRNA in LNCaP

Target accessibility

• In designing molecular beacons it is necessary to avoid targeting sequences that are double-stranded, or occupied by RNA binding proteins

• It is often necessary to select multiple(3-12) unique sequences along the target mRNA, and have correspondingmolecular beacons synthesized, testedand validated

Rhee et al, NAR, 2008

A molecular beacon design issue

Molecular Beacon Designs for Targeting BMP-4 mRNA

All target sequences are unique to BMP-4

MB1: Start codon regionMB4: FISH probe binding siteMB2, 6: siRNA binding sitesMB7, 8: Anti-sense oligo

binding sitesMB3, 5: Loop region based

on mFOLD

Rhee et al, NAR, 2008

Live-cell Imaging of BMP-4 mRNA

Rhee et al, NAR, 2008

MB8b

GFP

MB8a

GFP

5’ GTTGAAAAATTATCAGGAGATGGTGGTAGAGGGGTGTGGAT 3’MB8b

MB8

MB8a

MB8

GFP

Rhee et al, NAR, 2008

Viral Infection Detection

Molecular Beacons targeting the genome of RSV

White-light image of lung epithelial cells

Fluorescence image of viral genome (red) and viral protein (green)

Background signal of non-infected cells

Santangelo et al, JVI 80, 682 (2006)

Spreading of RSV infection

xzdtdx βλ −=

xzdtdy β=

zydtdz γα −=

Santangelo et al, JVI 80, 682 (2006)

Day2 post infection

Dynamics of Filamentous Vital Particles

Santangelo and Bao, NAR, 2007

Detection of Nuclear RNAs

• Understand the dynamics of RNA synthesis

• Localization and co-localization of nuclear RNAs

• Study nuclear RNA transport

Nitin & Bao, Bioconj Chem. 2009

U3 Small Nucleolar RNA U1 Small Nuclear RNA

Detection of U3 snoRNA and U1 snRNA

Nitin & Bao, Bioconj Chem. 2009

U2 snRNA and U1-U2 Colocalization

U2 small nuclear RNA U1/U2 colocalization

Nitin & Bao, Bioconj Chem. 2009

A New Model of Cancer Development

Reya et al, Nature 414:105, 2001

Need to isolate cancer stem cells from tumor and analyze them in order to develop new drug molecules

Surface marker protein

Fluorescence sorting/detection

Intracellular marker protein/mRNA

Limited to surfacemarker proteins

Flow cytometer

stem cell of interest

Magnetic sorting

Detection and Isolation of Cancer Stem Cells

• Typically only 1-10 cancer stem cells per 1,000,000 cancer cells. To have very sensitive detection, we need to target multiple cancer stem cell markers• Stem cell surface markers (e.g. SSEA-1) can be used to detect stem cells but they are very limited• Need to keep cells alive and minimize perturbation to cell biology• Many genes are highly expressed in stem cells, including Oct3/4, Sox2 and Nanog. Therefore, targeting mRNAs of these genes is very attractive• We target both mRNA and protein markers and use FACS to process cells

Targeting Oct 4 mRNA in Cancer Stem Cells Using Molecular Beacons

PCR results of Oct4 mRNA expression 4 days after retinoic acid treatment in mouse P19 embryonal carcinoma cells

Immunocytochemistry of Oct-4 protein (Red) before (UD) and after (RA) differentiation

WJ Rhee & G Bao, 2009

close to termination codon

Location of Target Sequences

WJ Rhee & G Bao, 2009

Signal from Oct-4 Targeting Molecular Beacons

Only MB3 and MB4 gave high signal levels, indicating good target accessibility, whereas all other MBs (MBs1-2, MB5-12) had low signal due to poor target accessibility

MB3 MB4

UD Differentiated UD Differentiated

WJ Rhee & G Bao, 2009

UD Differentiated

UD Differentiated

Total mRNA

Red: Oct-4 mRNA, Green: mitochondria, Blue: Nucleus

Fluorescence Imaging of Oct-4 mRNAand Total mRNA in live P19 Stem Cells

Green: total mRNAs, Blue: Nucleus

Control experiment using total RNA staining dye

WJ Rhee & G Bao, 2009

no probe with probes

UD Differentiated

Total mRNA

Sig Oct4 mRNA (red) and SSEA-1protein (green)

Oct

-4 M

B

Ran

dom

MB

Diff

eren

tiate

d

UD

Flow Cytometry Assay

Detection of Oct-4 mRNA and SSEA-1 Protein in Live P19 Stem Cells

SSEA

-1

Oct-4 mRNA

Mixed population

WJ Rhee & G Bao, 2009

Acknowledgements

Dr. Andrew Tsourkas (beacon solution studies)Dr. Phil Santangelo (viral infection studies)Dr. Wonjong Rhee (cancer stem cell studies) Dr. Nitin Nitin (nuclear RNA & beacon dynamics studies)Dr. Yiyi Zhang and Dr. Steve Dublin (NHEJ tagging using SNAP & ReAsH)

Dr. William Dynan (NHEL tagging using fluorescent proteins)Dr. Alice Ting (Orthogonal tagging)

NIH (PEN, CCNE, BRP, NDC), NSF