Thursday, 9th August 8.30 am

FLUORESCENT NUCLEIC ACIDS AS CHEMICAL TOOLS FOR BIOLOGY

Eric T. Kool1* 1Department of Chemistry, Stanford University, Stanford, CA, USA. * Correspondence to: kool@stanford.edu

ABSTRACT A new modular approach to the design and

discovery of fluorophores and sensors built on a DNA backbone is described. Fluorescent designer nucleosides are synthesized into short oligomers; their close interactions results in highly efficient reporters with properties not seen in standard fluorophores. Applications in sensing of molecules, ions, and enzymes in water and in the vapor phase are described.

INTRODUCTION, RESULTS AND DISCUSSION, CONCLUSION

Fluorescence is perhaps the mostly widely used analytical tool in biology, and hundreds of small molecule fluorophores and sensors now exist for widespread applications. Despite this progress, current small-molecule fluorophores have the substantial limitation of requiring separate filter sets for multianalyte imaging. Fluorescent sensors also have this spectral limitation, and importantly, are available for a relatively limited set of biological species.

Here we describe a new approach to design and discovery of fluorophores and sensors, by use of the DNA backbone to organize multiple chromophores. The close proximity of the chromophores in ssDNA gives rise to sequence-dependent electronic properties that are not present in the components alone. The oligomeric sensors are water soluble, and can be taken up by human cells. Many different sensors can be excited and visualized at one time. Data show that they can show complex fluorescence responses to the recognition of other

molecules and ions. We discuss their use in addressing multiple biologically important problems, such as simultaneous sensing of multiple classes of enzymes in cells, and in identifying bacteria by their volatile metabolites. Like DNA, these short DNA-like reporters can be rapidly and conveniently synthesized in automated fashion from a relatively small set of phosphoramidite monomers.

REFERENCES 1. Ren, R. X. F., Chaudhuri, N. C., Paris, P. L., Rumney, S., Kool, E. T. Naphthalene, Phenanthrene, and Pyrene as DNA base analogues: Synthesis, Structure, and Fluorescence in DNA, J. Am. Chem. Soc. 1996, 118, 7671-7678. 2. Gao, J., Strässler, C., Tahmassebi, D. C., Kool, E. T. Libraries of Composite Polyfluors Built from Fluorescent Deoxyribosides, J. Am. Chem. Soc. 2002, 124, 11590-11591. 3. Wilson, J. N., Teo, Y. N., Kool, E. T. Efficient Quenching of Oligomeric Fluorophores on a DNA Backbone, J. Am. Chem. Soc. 2007, 129, 15426-15427. 4. Teo, Y. N., Wilson, J. N., Kool, E. T. Polyfluorophores on a DNA Backbone: A Multicolor Set of Dyes Excited at a Single Wavelength, J. Am. Chem. Soc. 2009, 131, 3923-3933. 5. Dai, N., Teo, Y. N., Kool, E. T. DNA-polyfluorophore Excimers as Sensitive Reporters of Esterases and Lipases, Chem. Commun. 2010, 46, 1221-1223. 6. Samain, F., Ghosh, S., Teo, Y. N., Kool, E. T. Polyfluorophores on a DNA Backbone: Sensors of Small Molecules in the Vapor Phase, Angew. Chem. Int. Ed. 2010, 49, 7025-7029. 7. Tan, S. S., Kool, E. T. Differentiating Between Fluorescence-Quenching Metal Ions with Polyfluorophores on a DNA Backbone, J. Am. Chem. Soc. 2011, 133, 2664-2671. 8. Koo, C. K., Wang, S., Gaur, R. L., Samain, F., Banaiee, N., Kool, E. T. Fluorescent DNA Chemosensors: Identification of Bacterial Species by Their Volatile Metabolites, Chem. Commun. 2011, 47, 11345-11347. 9. Wang, S., Guo, J., Ono, T., Kool, E. T. DNA-polyfluorophores for Real-time Multicolor Tracking of Dynamic Biological Systems, Angew. Chem. Int. Ed. 2012, in press.

Figure 1. Fluorescent monomer nucleosides incorporated into short oligomeric sensors of enzymes, ions and small molecules.

Thursday, 9th August 9.05 am

THE SYNTHESIS OF ULTRA-LONG-MER OLIGO POOLS FROM HIGH-FIDELITY MICROARRAYS

Siyuan Chen1, Jeremy G. Lackey1 and Emily M. Leproust,1*

1Agilent Technologies – Genomics Division, 5301 Stevens Creek Blvd., Santa Clara, CA, USA, 95051, *Correspondence to: emily_leproust@agilent.com

ABSTRACT

Using high fidelity microchip synthesis via inkjet printing we are able to obtain high quality ultra-long-mer oligonucleotide libraries (hundreds-of-thousands to millions of 300-mers) in a single run. We expect this technology to have a major impact on biotechnology.

INTRODUCTION In the past 5 years there has been a huge boom in the

use of ultra-longer-mer oligonucleotide libraries for many applications in biotechnology such as targeted-re-sequencing,1 gene synthesis,2 high throughput mutagenesis,3 gene silencing4 and others.5 The most high-fidelity, cost effective and least time consuming method of Oligonucleotide Library Synthesis (OLS) is via microarray inkjet printing. In this way, inkjet printheads for each nucleoside phosphoramidite monomer and activator precisely place picoliter drops of the activated building blocks in desired spots on a glass slide, which is followed by oxidation and detritylation allowing the synthesis of hundreds-of-thousands of oligonucleotides in parallel. Once the synthesis has been completed, the oligonucleotides are then cleaved from the surface, deprotected, and pooled.

RESULTS AND DISCUSSION The successful synthesis of ultra-long DNA

oligonucleotides (>200-mers) using phosphoramidite chemistry requires high stepwise efficiency and low side reaction. Through optimization of our OLS process we have reduced depurination – the most prevalent side reaction – by 10 fold, leading to a 10 fold yield improvement for ultra-long oligonucleotides. We have also achieved cycle efficiency of 99.8%. The cycle efficiency is calculated from one single-base deletion in ~500 bases (deletion rate of 0.2%), which is determined using the Sanger sequencing method. We are also able to determine the error rates of other failure modes that may occur during OLS synthesis such as insertions and substitutions. We have achieved insertion rate of 0.005% (1 in ~20,000 bases), and substitution rate of 0.01% (1 in ~10,000 bases).

To demonstrate the high quality synthesis of ultra-long oligonucleotides, we synthesized four sequences; 150, 200, 250, and 300 bases in length using our microarray platform. These long-mers were then analyzed using PAGE (Figure 1A) to illustrate their integrity. These sequences were then amplified by PCR and the amplicons were analyzed by agarose gel (Figure 1B) and capillary

electrophoresis (Figure 1C) which shows the correct and clean PCR product in all cases. These results clearly demonstrated we can achieve excellent sequence integrity of ultra-long-mers up to 300 nucleotides in length, which represents a new milestone in oligonucleotide synthesis.

Figure 1. A) 10% denaturing PAGE of long-mers synthesized via microarray inkjet printing. B) 3% agarose gel of PCR amplicons. C) Capillary electropherogram from an Agilent 2100 Bioanalyzer of PCR amplicons.

CONCLUSION Through the use of novel chemistry and the

optimization of our microarray inkjet printing technology, we are able to produce extremely high quality ultra-long-mer oligonucleotide libraries. The use of these complex oligonucleotide pools have had a major impact on biotechnology and have huge potential in many future applications such as systems and synthetic biology. We will continue to improve our OLS process as the need for ultra-high quality oligonucleotide pools grows.

REFERENCES 1.��Gnirke,�A.,�Melnikov,�A.,�Maguire,�J.,�et.�al.�Nat�Biotech�2009,�27�(2),�182�189.�2.��Kosuri,�S.,�Eroshenko,�N.,�LeProust,�E.�M.�et�al.�Nat�Biotech�2010,�28�(12),�1295�1299.�3.��Patwardhan,�R.�P.;�Lee,�C.;�Litvin,�O.,�et�al.�Nat�Biotech�2009,�27�(12),�1173�1175.�4.��Bassik,�M.�C.,�Lebbink,�R.�J.,�Churchman,�L.�S.,�et�al.�Nat�Meth�2009,�6�(6),�443�445.�5.��Baker,�M.�Nat�Meth�2011,�8�(6),�457�460.�

Thursday, 9th August 9.40 am

FLUORESCENCE IMAGING OF EXTRACELLULAR CHEMICAL TRANSMITTER DYNAMICS USING SYNTHETIC APTAMER SENSOR

Takeshi Tokunaga,1 Shigeyuki Namiki,2 Katsuhiro Yamada,1 Takahiro Imaishi,1 Hiroshi Nonaka,1 Kenzo Hirose,2 and Shinsuke Sando1*

1INAMORI Frontier Research Center, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395, Japan and 2Department of Neurobiology, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033,

Japan. * Correspondence to: Email ssando@ifrc.kyushu-u.ac.jp

ABSTRACT

We demonstrate that a cell-surface immobilized synthetic fluorescent aptamer sensor can be used as a practical tool for analyzing extracellular chemical transmitter dynamics. In particular, the present research enables the real-time monitoring of gliotransmitter release from brain astrocytes using the fluorescent aptamer sensor.

INTRODUCTION

Nucleic acid aptamer is a promising material that works as a Host molecule to recognize target Guest molecules.1 Because of its high specificity and affinity, there has been a continuing challenge for application of aptamers to sensors.

Especially when we focus on sensing of cellular biomolecules, fluorescence-signalling aptamer is one of the most attractive choices. However, number of examples for cellular application is still limited.

In this presentation, we show that a cell-surface immobilized synthetic fluorescent aptamer sensor can be used as a practical tool for analyzing extracellular chemical transmitter dynamics (Figure 1).

RESULTS AND DISCUSSION

We attempted to apply fluorescent aptamer sensors for the analysis of extracellular biochemical events, e.g., molecule-mediated cell-to-cell communications. Our target extracellular messenger molecules is adenine-nucleotides, mainly adenosine triphosphate (ATP). Recent investigations have revealed that ATP works as one of the major gliotransmitters, which function to control neuron-glial networks in brain. Such gliotransmission is known to be associated with the regulation of neuronal network function. Therefore, a tool for real time monitoring of extracellular ATP dynamics is highly required in further neurochemical studies. We took up a challenge of using fluorescent aptamer2 as an adenine-nucleotide sensor for this purpose.

In order to analyze extracellular molecules with high spatio-temporal resolution, we developed an easy and efficient immobilization of the fluorescent aptamer sensor with retaining a performance as a fluorescent sensor. The method was applied for brain astrocyte cells and actually

realized the imaging of adenine-nucleotide efflux from living cells.

CONCLUSION

Cell surface-immobilized fluorescent aptamer sensor achieved the real-time monitoring of gliotransmitter release from brain astrocytes.3 From a more general point of view, the present strategy expands the research field of fluorescent aptamer sensors.4 Details will be discussed in this presentation.

REFERENCES 1. (a) Ellington, A. D., Szostak, J. W. Nature 1990, 346,

818–822. (b) Tuerk, C., Gold, L. Science 1990, 249, 505–510

2. Jhaveri, S. D. et al. J. Am. Chem. Soc. 2000, 122, 2469–2473.

3. Tokunaga, T., Namiki, S., Yamada, K., Imaishi, T., Nonaka, H., Hirose, K., Sando, S. J. Am. Chem. Soc. 2012, 134, 9561–9564.

4. Other example of extracellular molecular analysis using fluorescent aptamer sensor, see for example: Zhao, W. et al. Nat. Nanotech. 2011, 6, 524.

Figure 1. Illustration of fluorescent aptamer sensor immobilized on astrocyte cells.

Thursday, 9th August 10.05 am

TRENDS IN APTAMER SELECTION FOR SMALL MOLECULAR TARGETS

Maureen McKeague,1* Jose Cruz-Toledo,1 Michel Dumontier,1 and Maria C. DeRosa1 1Carleton University, 1125 Colonel By Drive, Ottawa, Canada. * Correspondence to: maureen_mckeague@carleton.ca

ABSTRACT This presentation focuses on the selection of

aptamers for small molecular targets using the Systematic Evolution of Ligands by Exponential enrichment (SELEX) process. We have performed several SELEX experiments for novel targets, using a variety of selection strategies. For comparison purposes, all aptamer SELEX experiments from the literature were compiled into the Aptamer Base, a new comprehensive aptamer database. Using our data and the Aptamer Base, we have elucidated several trends in SELEX and their resultant aptamers. INTRODUCTION

Aptamers are single-stranded oligonucleotides that are selected for their ability to bind to targets with high affinity and specificity. Like antibodies, aptamers have many therapeutic, research and diagnostic applications. However, aptamers are synthetically engineered using an in vitro procedure termed SELEX1,2. Despite aptamer technology existing for over 2 decades, relatively few novel aptamers have emerged for practical small molecular targets. We propose that one of the reasons for this lack in production is due to the difficulty in the technology used in the development and testing of aptamers for small targets.

Our research focuses on both the development of aptamers for practical small molecule targets as well as improving aptamer selection. We have developed high affinity DNA aptamers, displaying dissociation constants (Kd) in the nM and low �M range for several targets e.g. ATP (MW= 507.18 g/mol, Kd= 3.6 μM), fumonisin B1 (MW= 721.83 g/mol, Kd = 100 nM), and L-homocysteine (MW= 135.18 g/mol, Kd = 700 nM). For these selections we have used several different techniques including FluMag SELEX. Additionally, we have used computational methods to generate initial DNA libraries for SELEX that display an increased structural diversity. We have shown that these complex libraries can lead to the selection of aptamers displaying improved binding properties.

Finally, we created a new comprehensive database that stores structured information about aptamers and the conditions under which they were selected and tested. This database describes all verified aptamers that have been selected and published to-date. This database gives us the unprecedented ability to examine relationships between selection conditions and the results. Using this database, we sought to examine the relationships between sequence length, affinity and target information for aptamers developed for small molecules.

RESULTS AND DISCUSSION Information from the database was extracted and

statistically manipulated to reveal several trends between aptamer binding affinity, target type and aptamer length. Figure 1 shows the relationship between the -log of Kd and sequence length grouped by target type. While there was no trend between aptamer affinity and sequence length, it is clear that aptamers for larger targets such as proteins display higher affinities compared to small molecular targets. This further corroborates the statement that small molecules are more challenging targets for aptamer selections.

Figure 1. Relationship between dissociation constant and

the sequence length of all DNA grouped by target type.

Another challenge in the development of aptamers for small molecular targets is the difficulty posed by the methods required for characterizing aptamer binding with small molecules. We tested several affinity methods using aptamers for ochratoxin A (OTA, MW = 403.81 g/mol) as a model small molecule. Kds were determined for the same aptamer using several well-known methods for measuring aptamer-target binding affinity. The large variance in the measured Kd values indicates that not all affinity methods may be practical for small molecule targets. These findings were compared to the information in the database in an effort to determine which methods for measuring affinity are most reliable.

CONCLUSION Data mining of aptamer literature in combination with

experimental analysis shows that there are several factors that lead to the difficulty in obtaining aptamers for practical small molecule targets. Future work will seek to use these findings to help improve the speed and efficiency of small molecule aptamer selection.

REFERENCES 1. Ellington, A.D., Szostak, J.W. Nature, 1990, 346,

818-822. 2. Tuerk, C., Gold, L., Science, 1990, 249, 505-510.

Thursday, 9th August 11.05 am

A JOURNEY FROM MODIFIED NUCLEOSIDES TO DNA

Frank Seela

Laboratory of Bioorganic Chemistry and Chemical Biology, Center for Nanotechnology, Heisenbergstraße 11, 48149 Münster, Germany and Laboratorium für Organische und Bioorganische Chemie, Institut für Chemie, Universität

Osnabrück, Barbarastraße 7, 49069 Osnabrück, Germany. *Correspondence to: Frank.Seela@uni-osnabrueck.de

ABSTRACT

This lecture reports on modified nucleosides, their synthesis and incorporation in nucleic acids. It discusses chemical, physical and biological properties of monomers and their function as constituents of DNA.

INTRODUCTION

A considerable number of modified nucleosides have been isolated from natural sources as monomers or constituents of nucleic acids. Their occurrence inspired us to make them synthetically available and to use them as leads for the design of new bioactive molecules with potential antibiotic, antiviral or anticancer activity. For this, nucleobase anion glycoslation was developed as a new stereoselective method for the synthesis of 2’-deoxyribonucleosides. Novel nucleoside triphosphates were designed for DNA sequencing or for DNA or RNA functionalization. Stability and base pair recognition was studied on duplexes, triplexes and larger assemblies. New fluorescent nucleosides or conjugates were developed and used for mismatch sensing. Site selective cross-linking of DNA was performed with bi-functional azides using click chemistry. Entirely new nucleic acid structures such as parallel DNA were constructed using modified nucleosides. Recently, modified nucleosides were used for the construction of DNA-based nanomaterials.

RESULTS AND DISCUSSION

This presentation will focus on earlier work and recent studies performed in our laboratory. The following topics will be discussed: 1. Synthesis of purine related 2’-deoxyribonucleosides by stereoselective nucleobase anion glycosylation, their functionalization and transformation in DNA building blocks.

2. Design of fluorescent nucleosides for DNA sensing and nucleobase specific quenching of pyrene conjugates [1, 2].

3. DNA cross linking by click chemistry with bifunctional azides [3].

4. Parallel DNA as orthogonal nucleic acid structure [4].

REFERENCES

1. Ingale, S. A., Pujari, S. S., Sirivolu, V. R., Ding, P., Xiong, H., Mei, H., Seela, F. J. Org. Chem. 2012, 77, 188�199.

2. Jiang, D., Seela, F. J. Am. Chem. Soc. 2010, 132, 4016-4024.

3. Pujari, S. S., Xiong, H., Seela, F. J. Org. Chem. 2010, 75, 8693-8696.

4. For additional references see: www.seela.net

O

HO

N

N

N

HO

NH2

O

HO

N

N NN

HO

NH2

O

HO

NN

N N

N

HO

NH2

O

HO

N

N N

HO

NH2

O

HO

N

N NN

N

HO

NH2

Thursday, 9th August 11.50 am

BASE-MODIFIED NUCLEOSIDES AND NUCLEOTIDES AS NEW CYTOSTATICS OR BUILDING BLOCKS FOR POLYMERASE SYNTHESIS OF FUNCTIONALIZED NUCLEIC ACIDS

Michal Hocek,1,2* 1Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Gilead & IOCB

Research Center, Flemingovo nam. 2, CZ-16610 Prague 6, Czech Republic. and 2Department of Organic and Nuclear Chemistry, Faculty of Science, Charles University in Prague, Hlavova 8, CZ-12843 Prague 2, Czech Republic.

* Correspondence to: hocek@uochb.cas.cz

ABSTRACT

New base-modified nucleosides, nucleotides and nucleoside triphosphates derived from 5-substituted pyrimidine and 6- or 7-substituted 7-deazaadenine were prepared. Some deazapurine ribonucleoside derivatives were found to be nanomolar cytostatics. Title base-modified nucleoside triphosphates served as substrates for polymerase construction of base-modified nucleic acids for applications in bioanalysis or chemical biology.

INTRODUCTION

Base-modified nucleosides often display biological activities (antiviral, cytostatic) and/or are building blocks for the synthesis of modified oligonucleotides (ONs). In this presentation we will summarize the synthesis and activities of 7-deazapurine nucleosides, the synthesis of modified deazapurine and pyrimidine 2'-deoxyribonucleoside triphosphates (dNTPs) and their polymerase incorporation to DNA.

RESULTS AND DISCUSSION

Development of aqueous cross-coupling reactions of unprotected halogenated nucleos(t)ides allowed single-step synthesis of base-modified nucleos(t)ides.

Systematic synthesis and screening of 7-deazapurine ribonucleosides substituted at the position 6 or 7 revealed two new classes of potent nucleoside cytostatics: 6-hetaryl-7-deazapurine ribonucleosides1 and 7-hetaryl-7-deaza-adenosines.2 Both groups of compounds exerted nanomolar in vitro cytostatic activities against a broad panel of leukemia and tumor cell lines and selected examples aleo showed in vivo activities in mouse in vitro cytostatic activities against a broad panel of leukemia and

tumor cell lines and selected examples aleo showed in in vivo activities in mouse syngenic or xenograft models. The mechanism of action involves depletion of RNA synthesis in both cases but through different pathways.

The aqueous cross-couplings of halogenated dNTPs allowed the synthesis of base-modified dNTPs for polymerase incorporations. Diverse 5-substituted pyrimidine or 7-substituted 7-deazapurine dNTPs were prepared in this way and served as substrates for DNA plymerases. Primer extension or PCR was used for the construction of base-functionalized DNA and ON probes3 bearing redox or fluorescent labels, reactive groups for bioconjugations or triggerable groups for modulation of protein binding.

CONCLUSION

Cross-coupling reactions are an efficient tool for direct modifications of nucleosides, nucleotides and dNTPs. Two classes of new nucleosides cytostatics were discovered and the modified dNTPs were used for polymerase synthesis of functionalized DNA or ON probes. This work was supported by the Czech Science Foundation (grants: 203/09/0317, P207/11/0344).

REFERENCES

1. Nauš, P.; Pohl, R.; Votruba, I.; Džubák, P.; Hajdúch, M.; Ameral, R.; Birkuš, G.; Wang, T.; Ray, A. S.; Mackman, R.; Cihlar, T.; Hocek, M. J. Med. Chem. 2010, 53, 460-470.

2. Bourderioux, A.; Nauš, P.; Perlíková, P.; Pohl, R.; Pichová, I.; Votruba, I.; Džubák, P.; Kone�ný, P.; Hajdúch, M.; Stray, K. M.; Wang, T.; Ray, A. S.; Feng, J. Y.; Birkus, G.; Cihlar, T.; Hocek, M. J. Med. Chem. 2011, 54, 5498-5507.

3. Raindlová, V.; Pohl, R.; Šanda, M.; Hocek, M. Angew. Chem. Int. Ed. 2010, 49, 1064-1066. (b) Balintová, J.; Pohl, R.; Horáková, P.; Vidláková, P.; Havran, L.; Fojta, M.; Hocek, M. Chem. Eur. J. 2011, 17, 14063-14073.(c) Kielkowski, P.; Mací�ková-Cahová, H.; Pohl, R.; Hocek, M. Angew. Chem. Int. Ed. 2011, 50, 8727-8730. (d) Riedl, J.; Pohl, R.; Rulíšek, L.; Hocek, M. J. Org. Chem. 2012, 77, 1026-1044.

Scheme 1. Examples of a cytostatic modified nucleoside and a modified dNTP used in polymerase synthesis of functionalized DNA

Thursday, 9th August 2.00 pm

STRUCTURAL DIVERSITY IN NUCLEOSIDE DRUG DESIGN

Katherine L. Seley-Radtke,1* Orrette Wauchope,1 Sarah Zimmermann1 and Hannah Peters1 1University of Maryland, Baltimore County, 1000 Hilltop Circle, Baltimore, USA.

* Correspondence to: Email address kseley@umbc.edu

ABSTRACT Nucleosides have long formed the cornerstone of

antiviral therapies, however problems with the development of resistance have increased the need for new and more effective therapeutic agents. In that regard, exploitation of the various aspects of the nucleoside and nucleobase scaffolds offer forth potentially rich targets for designing new drugs. Several strategic structural modifications, including the synthetic pathways and preliminary biological activity, are presented.

INTRODUCTION The need for new and more potent antiviral therapeutics

is critical due to increasing reports of drug resistance, as well as emerging new viral diseases. It has been reported that Tenofovir and Etravirine (Figure 1), both FDA-approved HIV drugs, can adapt conformationally and positionally to resistance mutations in the HIV reverse transcriptase binding site due to the flexibility in their structures.1,2 This allows them to retain their potency against resistant strains since they can "wiggle and jiggle" in the binding site, thereby avoiding unfavorable steric or electronic interactions and subsequently engage alternate amino acid residues.

Figure 1. Tenofovir and Etravirine – FDA approved HIV drugs.

Related to these findings, a flexible "split" guanosine triphosphate analogue developed in our laboratory (1, Flex-GTP, Figure 1) not only retained full potency against enzyme binding site mutations (in contrast to the normal substrate GTP, which was rendered completely inactive) but also exhibited increased affinity compared to GTP due to engaging secondary amino acid residues not previously involved in the mechanism of action.3,4 As a result, exploitation of conformational and positional flexibility in the nucleobase scaffold can be viewed as a powerful tool for developing drugs that can retain their effectiveness against rapidly mutating viral targets.

CHEMISTRY In that regard, several new series of fleximers have been

designed and synthesized in an effort to apply the flex-base scaffold to various sugar modifications. New series underway include 2'-deoxy analogues_ENREF_55, carbocyclic fleximers, and fleximers containing interesting sugar and acyclic moieties.

Figure 2. Flex-GTP and representative examples of new targets.

The synthetic pathways to the various targets were designed using several different strategies, including a linear approach6,7, organometallic cross coupling methodologies8 and a novel transpurination reaction. Once in hand, the target compounds were sent for broad screen biological testing, which is currently underway. Those results will be reported as they become available. REFERENCES 1. Das, K. et al. J Biol Chem 2009, 284, 35092. 2. Das, K.; Bauman, J. D.; Clark, A. D.; et al Proc Natl

Acad Sci U S A 2008, 105, 1466. 3. Quirk, S.; Seley, K. L. Biochemistry 2005, 44, 13172. 4. Quirk, S.; Seley, K. L. Biochemistry 2005, 44, 10854. 5. Wauchope, O. R.; Johnson, C.; Krishnamoorthy, P.;

Andrei, G.; Snoeck, R.; Balzarini, J.; Seley-Radtke, K. L. Bioorg Med Chem 2012, 20, 3009.

6. Seley, K. L.; Zhang, L.; Hagos, A.; Quirk, S.J Org Chem 2002, 67, 3365.

7. Wauchope, O. R.; Tomney, M. J.; Pepper, J. L.; Korba, B. E.; Seley-Radtke, K. L. Org Lett 2010, 12, 4466.

8. Seley, K. L.; Salim, S.; Zhang, L.; O'Daniel, P. I. J Org Chem 2005, 70, 1612.

Thursday, 9th August 2.35 pm

AQUEOUS PHOSPHORYLATION AND NUCLEOSIDE TRANSFORMATIONS: SYNTHESIS OF INITIATORS FOR THE PREPARARTION OF 5'-LABELLED RNAS

Paul M. Brear,1 Martin J. Cann,2 Richard J. Delley,1 Gemma R. Freeman,1 Milena Trm�i�,1 David Williamson,1 and David R. W. Hodgson1*

1Department of Chemistry and 2School of Biological and Biomedical Sciences, Durham University, Durham, DH1 3LE, United Kingdom. * Correspondence to: Email address d.r.w.hodgson@durham.ac.uk

ABSTRACT

We present simple, aqueous nucleoside transformations and phosphorylations. Guanosine systems, which normally show poor solubility, showcase these approaches. The use of some of these guanosines as 5'-initiators for T7 RNA polymerase is presented.

INTRODUCTION

While there are many methodologies for nucleoside phosphorylation,1,2 they are often time-consuming because of their requirements for chromatographic purifications.

Guanosine nucleosides are further hampered by poor solubility properties. Even when using dipolar aprotic solvents such as trialkyl phosphates,3 solubility remains a problem, and dilute solutions of nucleoside must be employed.

RESULTS AND DISCUSSION

Dilute alkali solubilises guanosine nucleosides in concentrations of up to ~0.1 M via ionisation of the guanine (pKa~9.5). Elevated temperatures also increase aqueous solubility, and taken together, these factors have allowed us to prepare a range of guanosine derivatives using simple aqueous procedures that avoid chromatography (Scheme 1).4,5 A new reduction strategy for organic azides that employs inorganic thiophosphate as the reagent was discovered,6 and thiophosphoryl “Click” procedures allow the assembly of phosphodiester mimics from.7

We have used phosphoramidate, hydrazine and hydroxylamine systems as initiators for T7 RNA polymerase. We have found high levels of incorporation while maintaining high RNA yields. We labelled some RNAs using FITC, and shown these systems offer a

sensitive detection method avoiding the use of costly and legislatively burdensome 32P-based approaches.

CONCLUSION

We have developed simple aqueous transformations that access 5'-guanosine derivatives. Phosphoramidate, hydrazine and hydroxylamine derivatives are effective initiators for T7 RNA polymerase. Key results will be presented.

REFERENCES

1. Burgess, K., Cook, D. Chem. Rev., 2000, 100, 2047-2060.

2. Williams, Harris In Organophosphorus Reagents: a Practical Approach in Chemistry, Murphy, P. J., Ed.; OUP: Oxford, 2004.

3. Yoshikawa, M., Kato, T., Takenishi, T. Tetrahedron Lett. 1967, 5065-&.

4. Williamson, D., Cann, M. J., Hodgson, D. R. W. Chem. Commun., 2007, 5096-5098.

5. Brear, P., Freeman, G. R., Shankey, M. C., Trm�i�, M., Hodgson, D. R. W. Chem. Commun., 2009, 4980-4981.

6. Norcliffe, J. L., Conway, L. P., Hodgson, D. R. W. Tetrahedron Lett., 2011, 52, 2730-2732.

7. Trm�i�, M.; Hodgson, D. R. W. Chem. Commun., 2011, 47, 6156-6158.

Scheme 1. Aqueous transformations of guanosine systems.

Thursday, 9th August 3.00 pm

REVERSIBLE RIBONUCLEOSIDE 2’-MODIFICATIONS FOR EITHER RNA LABELLING OR RNA SYNTHESIS

Jacek Cie�lak, Cristina Ausín, Andrzej Grajkowski, and Serge L. Beaucage*

Division of Therapeutic Proteins, FDA-CDER, 8800 Rockville Pike, Bethesda, USA * Correspondence to: serge.beaucage@fda.hhs.gov

ABSTRACT

Conversion of 3’,5’-disilylated 2’-O-CH2SMe ribonu-cleosides to their 2’-O-CH2OPhth derivatives gave, after treatment of these derivatives with methanolic NH4F, 2’-O-CH2ONH2 ribonucleoside intermediates. Oximation of these intermediates with either aldehydes or ketones provided reversible or permanent ribonucleoside 2’-con-jugates, which were employed in the labelling of RNA sequences. Reversible ribonucleoside 2’-conjugates were efficiently used in the synthesis of native RNA sequences.

INTRODUCTION, RESULTS AND DISCUSSION, CONCLUSION

The 2’-hydroxyl function of ribonucleosides is an attractive target for conjugation reactions. However, the synthesis of ribonucleoside 2’-conjugates, which has traditionally been carried out through 2’-O-alkylation of native, 5’-O-protected or 5’- and 3’-O-protected ribonucleosides, lacks the regioselectivity needed for the production of conjugates free of isomeric impurities and/or results in notoriously poor yields of the desired 2’-conjugates. We rationalized that oximation of 2’-O-aminooxymethyl ribonucleosides with various functional groups through the aminooxy-aldehyde coupling reaction may lead to an innovative approach to either a permanent or reversible 2’-functionalization of ribonucleosides and RNA sequences. Indeed, thioacetalization of the 2’-hydroxy function of commercial 5’- and 3’-O-disilylated ribonucleosides in DMSO, Ac2O and AcOH produced the corresponding 2’-O-CH2SMe ribonucleosides in yields of 85-94%. Chlorination of these ribonucleosides by treatment with sulfuryl chloride resulted in the formation of their 2’-O-CH2Cl ethers, which were reacted without further purification with N-hydroxyphthalimide in the presence of DBU, to provide the 3’,5’-disilylated 2’-O-CH2OPhth ribonucleosides in yields of 66% to 94%. Reaction of these ribonucleoside derivatives with methanolic NH4F provided 2’-O-CH2ONH2 ribonucleosides after N-deacylation of the nucleobases upon exposure to concentrated aqueous NH3. Oximation of 2’-O-CH2ONH2 ribonucleosides with 1-pyrenecarboxaldehyde afforded reversible pyrenylated ribonucleoside 2’-conjugates (Fig. 1) in isolated yields of 69% to 82%. The reversibility of a pyrenylated uridine 2’-conju-gate was demonstrated by its complete conversion to uridine, with concomitant elimination of formaldehyde and formation of pyrene-1-carbonitrile as a side-product, upon treatment with 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF for 2 h at 55oC.

5’-O-Dimethoxytritylation of the pyrenylated uridine 2’-conjugate and its phosphitylation were performed as descri-bed earlier [1].

Figure 1. Chemical structures of pyrenylated ribonucleoside 2’-conjugates and of their fully protected phosphoramidite derivatives. B, Ura, Cyt, Ade, Gua; BP, Ura or N-acylated nucleobases; DMTr, 4,4’-dimethoxytrityl; R, pyren-1-yl or C(CH3)2CN

The single or double incorporation of the 2’-pyrenylated

uridine phosphoramidite (Fig. 1) into RNA sequences was performed using standard solid-phase techniques. The 2’-pyrenylated, RP-HPLC-purified and desalted RNA sequen-ces were then quantitatively converted to their native forms, within 3 h, when exposed to 0.5 M TBAF in DMSO at 55ºC. Several aldehydes have been investigated for the purpose of assessing the stability of each ribonucleoside 2’-conjugate to the conditions prevailing during synthesis and deprotection of RNA sequences, and evaluating the reversibility kinetics of these conjugates when reacted with TBAF in DMSO. In this regard, the acidity of the oximic proton was found to be a critical parameter affecting the reversibility kinetics of this class of 2’-conjugates. When R (Fig. 1) is C(CH3)2CN, the coupling efficiency of the monomeric phosphoramidites exceeded 99% over a coupling time of 3 min in the solid-phase synthesis of the 2’-modified chimeric RNA sequences r(U20)dT and r(AUCCGUAGCUAACGUCAUGG)dT. The reversibility rate of these 2’-modified RNA sequences to their native structures was found to be optimal when subjecting the sequences to 0.5 M TBAF in DMSO for 20 h at 55ºC.

Our findings may provide new opportunities for the discovery and implementation of novel 2’-functional groups, which are of crucial importance in the synthesis of native and/or modified RNA sequences in the context of RNA interference applications. Alternatively, our findings may lead to the development of creative approaches to improving the cellular/tissue delivery of nucleic acid-based drugs through the use of permanent or reversible RNA conjugates.

REFERENCES

1. Cie�lak, J., Grajkowski, A., Ausín, C., Gapeev, A., Beaucage, S. L. Nucleic Acids Res. 2012, 40, 2312-2329.

Thursday, 9th August 4.00 pm

CYCLIC DINUCLEOTIDES AS MUCOSAL VACCINE ADJUVANTS

Hongbin (Tony) Yana* and Wangxue Chenb* aDepartment of Chemistry, Brock University, 500 Glenridge Ave., St. Catharines, Ontario, Canada

bInstitute for Biological Sciences, National Research Council, 100 Sussex Dr., Ottawa, Ontario, Canada *Correspondence to: tyan@brocku.ca; Chen, Wangxue.Chen@nrc-cnrc.gc.ca

ABSTRACT

Cyclic dinucleotides, such as 3',5'-cyclic diguanylic acid (c-di-GMP), are found to be very potent immunostimulatory agents, and some are shown to be powerful mucosal vaccine adjuvants, providing protective immunity to mice against bacterial infections.

INTRODUCTION

3',5'-Cyclic diguanylic acid (c-di-GMP) was first found in Gluconacetobacter xylinus (formerly Acetobacter xylinum) as an allosteric regulator of cellulose synthase.1 In recent years, this molecule has been recognized as a universal bacterial second messenger essential for the regulation of a wide range of bacterial physiology.2

More recently, c-di-GMP has been shown to be very

effective in modulating host immune systems, either when administered alone as an immunostimulatory agent, or together with an antigen as a vaccine.3 This presentation summarize the recent work in our laboratories on the use of c-di-GMP and analogues as immunomodulators and mucosal vaccine adjuvants as a means to intervene bacterial infections.

RESULTS AND DISCUSSION c-di-GMP and analogues were prepared using the

modified H-phosphonate chemistry (Scheme 1).4

Scheme 1. Synthesis of cyclic dinucleotides using the modified H-phosphonate chemistry.

The fully deprotected cyclic dinucleotides are readily

characterized by NMR, mass spectroscopy and HPLC.

These cyclic dinucleotides were found to be extraordinary immunomodulator. For example, administration of c-di-GMP to mice 18 h prior to infection by Acinetobacter baumannii provided significant protection against intranasal challenges with A. baumannii, which is indicated by the reduction of bacterial burden in the lung and spleen.5 As mucosal adjuvants, some of these cyclic dinucleotides provided protective immunity to host against bacterial challenges at a level that is at least as good as, if not better, than Cholera toxin,6 the golden standard research mucosal adjuvant that can not be used in clinical applications due to its extreme toxicity. The protection is clearly evident with reduction of bacterial burden by at least one order of magnitude compared with control groups.

Work in our laboratories is ongoing towards the

synthesis of suitably labelled c-di-GMP, and the elucidation of the fundamental mechanisms of the immunomodulation of these cyclic dinucleotides on the host immune system.

CONCLUSION

Cyclic dinucleotides can be readily synthesized using the modified H-phosphonate chemistry. Some of these cyclic nucleotides were found to possess extraordinary immunostimulatory property and adjuvanticity, both provided enhanced protection to mice against bacterial infections.5

REFERENCES

1. Ross, P., Weinhouse, H., Aloni, Y., Michaeli, D., Weinberger-Ohana, P., Mayer, R., Braun, S., de Vroom, E., van der Mare, G. A., van Boom, J. H., Benziman, M. Nature 1987, 325, 279-281.

2. Yan, H., Chen, W., Chem. Soc. Rev. 2010, 39, 2914-2924.

3. KuoLee, R., Yan, H., Chen, W. Vaccine, 2010, 28, 3080-3085.

4. Yan, H., Anguilar, A. L. Nucleoside, Nucleotides & Nucleic Acids 2007, 26, 189-204.

5. Zhao, L., KuoLee, R., Harris, G., Tram, K., Yan, H., Chen, W. Int. Immunopharmacol. 2011, 11, 1378-1383.

6. Yan, H., KuoLee, R., Tram, K., Qiu, H., Zhang, J., Patel, G.B., Chen, W. Biochem. Biophys. Res. Commun. 2009, 387, 581-584.

Thursday, 9th August 4.25 pm

DNA-TEMPLATED DYNAMIC LIGATION OF BORONONUCLEIC ACIDS

Jean-Jacques Vasseur,1* Anthony R. Martin,1 Renaud Barbeyron,1 and Michael Smietana 1 1 Institut des Biomolécules Max Mousseron (IBMM), Université Montpellier 2, Place Eugène Bataillon, 34095

Montpellier, France* Correspondence to: vasseur@um2.fr

ABSTRACT

5’-Borono analogues of 2’-deoxynucleotides were prepared and incorporated at the 5’-end of an oligonucleotide. Reversible DNA and RNA-templated ligation between the boronic function and a ribonucleoside at the 3’-end of another oligonucleotide is observed. The stability of the resulting overall double-stranded nucleic acid containing a boronate linkage is controlled by external stimuli.

INTRODUCTION

All living organisms depend on the self-assembly of molecular units into well-defined architectures. Inspired by nature, chemists have tried to develop adaptive synthetic systems featuring programmability and reversibility properties. The design of compounds able to increase molecular complexity through self-organization opens new perspectives ranging from the development of smart bio-materials to the comprehension of biological processes, and eventually to the study of the origin of life.

In this context, we developed an adaptive nucleic acid-

based system relying on the reversible formation of cyclic boronate internucleosidic linkages.

For this purpose, we designed a new set of 2’-deoxy-6’-boronoribonucleotide analogues 1-4 in which a 5’-linked C–B bond would mimic the monophosphate ester (Fig. 1) .[1-2] These compounds were synthesized and incorporated at the 5’-end of oligonucleotides. With these new artificial nucleotides analogues, we started the evaluation of their autoligation ability with ribonucleotidic partners.

ON

N

O

NH2

OH

BOHHO

2 (dCbn)

ON

HN

O

OH

BHO

1 (dTbn)

OHN

NN

N

NH2

O

OH

BOHHO

4 (dAbn)

N

N

N

NH

NH2

O

O

OH

BOHHO

3 (dGbn)

O

Figure 1. 2’-deoxyborononucleotides

RESULTS AND DISCUSSION

The assembly of this new borono-based helix has been dynamically accomplished through a DNA- and a RNA-templated ligation between two DNA strands: the first one carries a 5’-end boronic acid whereas the second one is 3’-ended by a ribonucleoside featuring the diol function

necessary for the formation of the boronate ester (Figure 2).

Figure 2. DNA-templated formation of a boronate linkage

We demonstrated that the system displays stimuli-responsive characteristics and preliminary results indicate that translation of genetic information can be achieved through the formation of multiple boronate junctions.[3-4] The modular qualities of these new architectures will be exposed.

CONCLUSION

DNA and RNA templates allow the formation of boronate linkages from boronic acid- and diol-containing oligonucleotides without either chemical or enzymatic activation. The control of the equilibrium between boronic acid/diol and boronate by external stimuli opens the way to dynamic “smart” nucleic acids.

REFERENCES

1. Luvino, D., Baraguey, C., Smietana, M., Vasseur, J.-J. Chem. Commun., 2008, 2352-2354.

2. Martin, A. R., Mohanan, K., Luvino, D., Floquet, N., Baraguey, C., Smietana, M., Vasseur, J.-J. Org. Biomol. Chem., 2009, 7, 4369-4377.

3. Martin, A. R., Barvik, I., Luvino, D., Smietana, M., Vasseur, J.-J. J. Angew. Chem. Int. Ed., 2011, 50, 4193-4196.

4. Smietana, M., Martin, A. R., Vasseur, J.-J. Pure Appl. Chem., 2012, http://dx.doi.org/10.1351/PAC-CON-11-09-28.

ACKNOWLEDGMENT

This project is supported by the Région Languedoc Roussillon through the project “Chercheur d’Avenir” and ANR through the project PRODIGU

N

NH2

O

NO

HO

O

NH

O

O

NO

O

B

TTTTTT

CCGTCG

HO

HO

OH

N

NH2

O

NO

O

NH

O

O

NO

O

O

TTTTTT

CCGTCG

B O

Recognition Ligation