Journal of Equine Veterinary Science 33 (2013) 628-636

Journal of Equine Veterinary Science

journal homepage: www.j -evs.com

Original Research

First Report on Molecular Detection of Equine Upper RespiratoryInfectious Viruses in Republic of Korea

Sungjin Ko DVM, PhD a, Jun-Gu Kang DVMa, Jung-Yong Yeh DVM, PhD b,Jin-San Moon DVM, PhD b, Gui-Cheol Choi DVM, PhD c, Sohyun Won BS a,Joon-Seok Chae DVM, PhD a

a Laboratory of Veterinary Internal Medicine and Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, Seoul,Republic of Koreab Foreign Animal Disease Division, National Veterinary Research and Quarantine Service, Anyang, Republic of Koreac Seoul Race Park, Korea Racing Authority, Gwacheon, Republic of Korea

a r t i c l e i n f o

Article history:Received 16 July 2012Received in revised form18 October 2012Accepted 7 November 2012Available online 15 March 2013

Keywords:HorseInfectionKoreaRespiratoryVirus

Corresponding author at: Joon-seok Chae, DVVeterinary Internal Medicine, College of VeterinarNational University, 1, Gwanak-ro, Gwanak-gu, Seoul 1Korea.

E-mail address: jschae@snu.ac.kr (J.-S. Chae).

0737-0806/$ - see front matter � 2013 Elsevier Inc. Ahttp://dx.doi.org/10.1016/j.jevs.2012.11.001

a b s t r a c t

The prevalence of equine respiratory virus infections among a suspected population ofrace horses was examined using polymerase chain reaction (PCR). One or more of fiveequine respiratory viruses were detected in the nasal swabs of 45 of 89 horses (50.6%),and the detection rate of equine herpesvirus type 1 (EHV-1), equine herpesvirus type 4(EHV-4), equine herpesvirus type 5 (EHV-5), equine rhinitis A virus (ERAV) and equinerhinitis B virus (ERBV) were 5.6%, 7.9%, 39.0%, 2.2%, and 6.7%, respectively. Among the 45infected horses, 7 were co-infected with EHV and/or equine rhinitisvirus (ERV). Equineinfluenzavirus and equine arteritisvirus were not detected in any samples. Specificantibodies to EHV-1 and/or EHV-4 were detected in 59 of 73 tested sera (80.8%), usinga virus neutralization test. This investigation suggests that equine respiratory viruses areendemic at Seoul Race Park and that the impact of viral infections on race horses’ healthin Republic of Korea should be evaluated.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

For race horses, infectious respiratory disease is one ofthe greatest threats affecting racing results [1]. Respiratorydisease caused by viruses is responsible for incalculableeconomic losses within the horse racing industry [1,2].Respiratory tract illnesses are a very common problem inhorses, having a wide range of causes, including bacterialand viral infections, as well as a number of noninfectiousfactors. The major transmission pathogens are virusesincluding equine influenzavirus (EIV), equine herpesvirustype 1 (EHV-1), equine herpesvirus type 2 (EHV-2), equine

M, PhD, Professor,y Medicine, Seoul51-742, Republic of

ll rights reserved.

herpesvirus type 4 (EHV-4), equine herpesvirus type 5(EHV-5), equine arteritisvirus (EAV), equine rhinitis A virus(ERAV) and equine rhinitis B virus (ERBV) [1-3].

EIV is one of the most important respiratory virusesin horses because of its rapid spread among the horsepopulation. EIV infection causes development of typicalrespiratory signs including acute onset of pyrexia, nasaldischarge, coughing, and depression [4,5]. EIV infectionoften results in cancellation of horseracing events nation-ally, as well as prohibition of movement of horses inter-nationally [5].

EAV infection in horses has recently been identified incountries such as Australia, New Zealand, and South Africa,which were previously thought to be largely or completelyfree of the virus [6-9]. This apparent global disseminationand rising incidence of EAV likely reflects the rapid nationaland international movement of horses for competitionand breeding, as well as heightened diagnostic scrutiny as

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636 629

a consequence of increasing concern over the potentialthreat of EAV infection [10].

EHV-1 and EHV-4 are Alphaherpesviruses that causesevere lytic infection of host cells and are rapidly cytopathic[11]. Moreover, secondary bacterial infection is well docu-mented and known to be a contributory factor in thedevelopment of equine herpetic diseases [12-14]. Of greatestwelfare and economic importance of EHV-1 infections aresporadic outbreaks of respiratory, neurological disease, andcollective outbreaks of late term abortions that can have hitrates in excess of 50% [1,15-19]. EHV-4 is considered one ofthe major viral causes of equine acute respiratory disease[20]. In the Republic of Korea (ROK), there has been one caseof EHV-1 reported in an aborted fetus assayed by immuno-histochemistry [21]. EHV-2 and EHV-5, differentiated fromeach other in 1992 [22], are Gammaherpesviruses whichinfect host cells but are more slowly cytopathic than Alpha-herpesviruses. These viruses are widespread throughoutthe equine population and have been isolated from cases ofrespiratory disease in horses from different countries[14,23,24]. The pathogenesis of these Gammaherpesvirusescurrently remains unclear; however, various reports suggesttheir implication in causing respiratory disease [25,26].

ERAV and ERBV are equine respiratory viruses belongingto the family Picornaviridae. ERAV is the only nonefoot-and-mouth disease virus member of the genus Aphthovirus;and ERBV is the only representative of the genus Erbovirusand consists of three types (ERBV1, 2 and 3) by serologicalrelationship, acid stability, and genomic sequence data[27,28]. These viruses are considered to cause equinerespiratory disease and are potentially infectious to humans[29]. Despite the abundance of ERAV and ERBV in horsepopulations, there have been few reported studies of theseviruses, and little is known about their exact prevalence orpathogenesis.

Seoul Race Park (SRP) experienced yearly infectiousrespiratory disease epizootics, with an estimated incidenceof 29.6%, corresponding to 9.3%-13.9% of total veterinaryfees from 2001 to 2005 [30]. Treatments are hindered bycomplex origins and difficulty in determining a causativerole for the viral infection. Despite the costs and threatsassociated with equine respiratory viral infection, to thebest of our knowledge, there have been no publishedestimates of equine respiratory viral infection within theKorean horse population. This study investigated theprevalence and determined the possible involvement ofequine viruses in respiratory infectious diseases at SRP(1,574 horses), using molecular detection methods.

2. Materials and Methods

2.1. Reference Strains

Reference strain DNA (killed Equivac EHV-1/-4 equinerhinopneumonitis; Fort Dodge Animal Health, Fort Dodge,IA) and RNA (Duvaxyn IE Plus EIV vaccine, killed virus; FortDodge Animal Health; and Artervac equine viral arteritisvaccine, modified live virus; Fort Dodge Animal Health)were kindly provided by Dr. Nicola Pusterla, Department ofMedicine and Epidemiology, School of Veterinary Medi-cine, University of California, Davis. We screened EHV-5,ERAV, and ERBV without positive reference sequences.

Instead, to confirm PCR results, we analyzed nucleotidesequences of all conventional PCR products.

2.2. Samples

Horses were selected from 54 stables (1,574 horses) atSRP from January to December 2008. Trainers were queriedregarding the presence of respiratory symptoms in thehorses. Horses reported as having an increased frequency ofcoughing, mucopurulent nasal discharge, and at least oneadditional clinical symptom (fever, depression, decreasedappetite, anorexia, poor exercise performance, or enlargedlymph nodes of the head and neck) were diagnosed ashaving an infectious respiratory disease. A total of 89 horsessuffering from respiratory diseases were included in thestudy. SRP personnel administered EIV vaccine to racehorses, although no vaccines for EHV, EAV, ERAV or ERBVhave been administered to race horses in SRP. Individualvaccination histories of 89 horses were confirmed at theKorea Racing Authority homepage (http://studbook.kra.co.kr/studbook.jsp). Nasal swabs were collected from all sus-pected cases at least 2 weeks from onset of clinical symp-toms and were placed in 3 mL of transport mediumconsisting of Eagle’sminimal essentialmedium (MEM)withnonessential amino acid, 3% fetal bovine serum, 0.08 MNaOH3, 50 mL/mg ampicillin, 100 mL/mg gentamicin, and5 mL/mg amphotericin B (Invitrogen, US). Specimens weresubmitted to the laboratory and processed within a fewhours. Whole-blood samples were collected from 73 of 89horses; consent for the remaining horseswas refused by thehorses’owners. Bloodwas collected fromthe jugular vein byusing a 10-mL syringe for serological tests. Serum wasseparated, and samples were stored at�70�C until assayed.

2.3. Polymerase Chain Reaction and Reverse Transcription-PCR

Polymerase chain reaction (PCR) for detection of EHV-1,EHV-4, EHV-5, EIV, EAV, ERAV, and ERBV infections,including details of primers and probes used, are shown inTable 1. Both DNA and RNA viral nucleic acids wereextracted from 400 mL of nasal swab samples, usingQIAamp mini-kits (Qiagen, Germany) and viral RNA mini-kits (Qiagen, Germany) according to the manufacturer’sinstructions. For RNA viruses, RT-nested PCR and RT real-time PCR used extracted viral RNA as a template withwhich to synthesize cDNA, using Sensiscript RT kits (Qia-gen, Germany) according to the manufacturer’s instruc-tions. The resulting DNA and cDNA were used as PCRtemplates.

For EHV-1 and EHV-4 real-time PCR, real-time PCRtargeting of the glycoprotein B gene was used as describedpreviously [31].

For EHV-5 nested PCR, nested PCR targeting of theglycoprotein B gene was used as described previously [20].

For EIV RT-real time PCR, an EIV RT-real time PCR tar-geting of matrix gene was used as described previously[32].

For EAV RT-real time PCR, an EAV RT-real time PCR tar-geting of the ORF7 gene was used as described previously[33].

Table 1Nucleotide sequence of primers and expected product size used in the first and second rounds of nested PCR and probes of real-time PCR

Virus Name of primer or probe Nucleotide sequence (50-30) Size of amplicon Reference

EIV M-Flu1 CTTCTAACCGAGGTCGAAACGTA 138 32M-Flu2 GGATTGGTCTTGTCTTTAGCCAM-Fluprob FAM-CTCGGCTTTGAGGGGGCCTGA-MGB 74

EHV-1 EHV1 MGB F1 CATGTCAACGCACTCCCA 63 26EHV1 MGB R1 GGGTCGGGCGTTTCTGTEHV1 MGB probe FAM-CCCTACGCTGCTCC-MGB-NFQ

EHV-4 EHV-4 MGB F1 GGGCTATTGGAT TACAGCGAGAT 86 26EHV-4 MGB R1 TAGAATCGGAGG GCGTGAAGEHV-4 MGB probe VIC-CAGCGCCGTAACCAG-MGB-NFQ

EHV-5 EHV5L1 CCAACACAGAAGACAAGGAG 1,339 20EHV5R1 CACGGTGATACAGTCAGAGAEHV5L2 CCAACACAGAAGACAAGGAG 408EHV5R2 AGTTGACCGTCGTTCTAGTG

EAV EAV7.53F GGCGACGACCTACAAGCTGCA 204 33EAV7.53R CGGCATCTGCAGTGAGTGAEAV7.53 probe a-TTGCGGACCCGCATCTGACCA-Ab

ERBV ERBV OF TTTTGATGCTTCACATTCTCC 782 34ERBV OR CGCTGTACCCTCGGTCCTACTCERBV IF CTTACTAYGAATGTGARGGGGC 623ERBV IR GCCTCGGCGAGTGAAGAG

ERAV ERAV OF ATTGATGTGGCAAAACA 551 1ERAV OR GTCAAATTTGAAAGCTCERAV IF GTAGCYAGTTTGTCA 208ERAV IR ACCTGCTTGTCGGGCA

EAV, equinearteritis virus; EHV, equine herpesvirus; EIV, equine influenzavirus; ERAV, equine rhinitis A virus; ERBV, equine rhinitis B virus; F, forward; IF,internal forward; IR, internal reverse; OF, outer forward; OR, outer reverse; R, reverse.

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636630

For ERAV and ERBV RT-nested PCR, RT-nested PCR tar-geting of the 3D polyprotein gene was used as describedpreviously [34].

All nested PCR reactions were carried out using HiPi PCRpremix (Elpis-Biotech, Taejeon, ROK) in a PCR thermalcycler (MJ Research, MA). PCR products were separated on1.5% agarose gels and were identified by ethidium bromidestaining. Thermocycling conditions of EHV-5 for both first-and second-round reactions consisted of 1 cycle at 94�Cfor 5 minute, followed by 35 cycles of denaturing at 94�Cfor 1 minute, annealing at 60�C for 1 minute, 1-minuteextension at 72�C, and a final extension at 72�C for7 minutes. Nested PCR conditions for ERAV and ERBV werethe same as above, except for the annealing temperature,which was 52�C. Real-time PCR reactions were performedusing an ABI Prism 7000 sequence detection system(Applied Biosystems, CA), using standard thermal cyclerprofiles provided by the manufacturer. Conditions wereamplification with 50 cycles at 95�C for 15 seconds and60�C for 1 min. All positive amplicons were sequencedand compared with the other virus sequences available inthe GenBank database.

2.4. Nucleotide Sequencing and Phylogenetic Analysis

To confirm positive PCR results, we purified the PCRproducts with QIAquick PCR purification kit (Qiagen) andsequenced them using both sense and antisense PCRprimers, by a dideoxy termination with an automaticsequencer (ABI Prism 3700 DNA analyzer; Applied Bio-systems). Sequence data were collected using ABI Prismdata collection software (version 2.1), and analyzed by ABIPrism sequence analysis software (version 2.1.1) andChromas software (version 1.51, Technelysium, Austrailia).Sequence homology searches of the National Center for

Biotechnology Information (NCBI) were conducted usingBLAST network service. Comparative analyses of the posi-tive sequences and representative nucleotide sequenceswere completed using available sequences in the GenBankdatabase. Phylogenetic analysis was completed usingClustal X software (version 1.60) multiple alignmentmethod with the MEGA 4.0 program. The phylogenetic treewas constructed using the neighbor-joining method after1,000 bootstrap replicates.

GenBank accession numbers of sequences used in ourstudy were AY607002 (ERBV3 strain 9051-7/89); AY607005(ERBV2 strain 1576/99); AY606999 (ERBV1 strain 293/74);AY607008 (ERBV strain 1654/00); AY607007 (ERBV strain1630/00); AY607004 (ERBV strain 1525/99); AY607001(ERBV1 strain 57-14/89); AY607003 (ERBV strain 1506/99);EF204768 (ERAV strain NM-11/67); DQ272127 (ERAV strainPlowright); DQ272577 (ERAV strain T10); DQ268580(ERAV strain T3); DQ272128 (ERAV strain U188); EF204769(ERAV strain D1305-03); DQ272578 (ERAV strain PERV-1);EF204767 (ERAV strain PERV/UK/62); DQ989322 (foot-and-mouth disease virus strain IND 139-02); AF050671 (EHV-5strain EHV5.2-141); GU065283 (EHV-5 strain EHV5-TR-L2);GQ325593 (EHV-5 strain #281); GU065285 (EHV-5 strainEHV5-TR-NS31); GU065284 (EHV-5 strain EHV5-TR-NS26);GQ325592 (EHV-5 strain BB5-5); and NC001650 (EHV-2strain 86/67).

2.5. Virus Neutralization Test

To evaluate the serology of EHV-1and EHV-4 in 73serum samples, a virus neutralization test (VNT) was per-formed using EHV-1-specific antibody, carrying cross-reactivity with EHV-4 antibody [35,36]. Two-fold serialdilutions from 1:4 to 1:512 of sera (50 mL) weremade in 96-well cell culture plates using Eagle’s MEM (Lonza, US).

Fig. 1. Representative application plots of TaqMan probe assay for EHV-1 (A) and EHV-4 (B), and photos of agarose gel electrophoresis patterns for glycoprotein Bgene of EHV-5 (C), 3D polyprotein gene of ERAV (D) and 3D polyprotein gene of ERBV (E). PC, positive control; PS1e2, positive samples; NS, negative samples; M,100-bp DNA size marker (Intron Bio).

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636 631

Immediately, 100 tissue culture infective dose 50 (50 mL) ofEHV-1 was added to each well. Plates were incubated at37�C in a 5% CO2 atmosphere for 1 hour, after which 50 mLof RK-13 indicator cell suspension was added to each well.Plates were incubated at 37�C in a 5% CO2 atmosphereand were read microscopically over 5 days, duringwhich time 50% neutralization endpoints were recorded.Neutralizing antibody titers were calculated using theKarber formula [37].

Table 2Prevalence of equine respiratory viruses verified by PCR from 89 nasalswab samples collected from race horses with clinical respiratorysymptoms

Classifiedinfection

Virus(es) No. detected Infectionrate (%)

Single-positivea EIV 0 0EAV 0 0EHV-1 5 5.6EHV-4 7 7.9EHV-5 35 39.0ERAV 2 2.2ERBV 6 6.7

Double-positive EHV-1, EHV-4 1 1.1EHV-4, EHV-5 1 1.1EHV-5, ERAV 1 1.1EHV-5, ERBV 1 1.1

Triple-positive EHV-1, EHV-4, EHV-5 1 1.1EHV-1, EHV-5, ERAV 1 1.1EHV-1, EHV-5, ERBV 1 1.1

Abbreviations are as in Table 1.aNumber of single positives includes each number of double and triple

positives.

3. Results

3.1. Virus Detection by PCR

In investigating the molecular prevalence of equinerespiratory infectious viruses, we detected five species ofequine respiratory viruses; the overall detection rate was50.6% (Fig. 1). The most prevalent pathogen was EHV-5,which was detected in 35 (39.0%) horses. The molecularprevalence rates of EHV-1, EHV-4, ERAV, and ERBV were5.6%, 7.9%, 2.2%, and 6.7%, respectively (Tables 2 and 3).All 89 tested nasal swab samples tested negative for EIVand EAV. Respiratory EHV (EHV-1, EHV-4, and EHV-5)was detected in 41 horses (46.1%), and among those 41horses, 7 (7.9%) were co-infected. Co-infections were asfollows: four horses were double-positive with one eachhaving EHV-1 and EHV-4, EHV-4 and EHV-5, EHV-5 andERAV, and EHV-5 and ERBV; while three horses weretriple-positive with one each having EHV-1, EHV-4, andEHV-5; EHV-1, EHV-5, and ERAV; and EHV-1, EHV-5, andERBV.

3.2. Sequence Analysis and Phylogenetic Tree

To confirm genetic identifications and to evaluate thegenetic relationship of detected viruses, the 3D polyprotein(ERAVandERBV)andglycoproteinB (EHV-5) genenucleotidesequences that we obtained were compared with othersequences available in the GenBank database (Table 4), andphylogenetic trees were constructed based on current ERAV,ERBV, and EHV-5 sequences (Figs. 2 and 3).

Table 3Summary of PCR and virus neutralization test results from 45 horses withrespiratory clinical signs

No. Age Real-time PCR Nested PCR VNT

EHV-1, EHV-4, EAV, EIV EHV-5, ERAV, ERBV EHV-1

1 4 e ERBV NA2 4 e EHV-5 83 4 e EHV-5 85 4 EHV-1 EHV-5, ERBV <47 U e EHV-5 89 4 e EHV-5 410 4 e EHV-5 811 5 e EHV-5 6413 6 e EHV-5 1616 4 e EHV-5 1617 4 e EHV-5 1618 4 e ERBV 819 4 e EHV-5 422 4 e ERBV 1623 6 e EHV-5 NA24 5 e EHV-5 NA25 4 EHV-4 e NA26 4 e EHV-5, ERAV NA27 4 EHV-1 EHV-5, ERAV 828 6 e EHV-5 6437 4 EHV-4 e 3245 4 e EHV-5 <446 4 e ERBV 447 5 EHV-1, EHV-4 EHV-5 448 4 e EHV-5 <449 5 EHV-1, EHV-4 e 3250 4 e EHV-5 6451 4 EHV-4 EHV-5 <452 U e EHV-5 853 4 e EHV-5 854 4 e EHV-5 <455 5 e EHV-5 457 6 e EHV-5 1658 5 e EHV-5, ERBV 12859 U EHVe4 e 461 5 e EHV-5 3262 5 e EHV-5 <463 8 e EHV-5 6465 4 EHV-4 e 869 4 e EHV-5 471 5 EHV-1 e 1682 4 e EHV-5 NA87 4 e EHV-5 <488 5 e EHV-5 1689 5 e EHV-5 32

NA, not available; U, unknown. Additional abbreviations are as in Table 1.

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636632

ERAV-positive nucleotide sequences (KRHERAV1 andKRHERAV2) exhibited95.5% (KRHERAV1/PERV-1) and96.2%(KRHERAV2/D1305-03) identity to the closest relative ERAVstrains (Table 4) and 61.9%-63.0% sequence homology to

Table 4Homology of nucleotide sequences among identified genotypes and reference st

Virus Genotype No. of PCR products S

ERAV KRHERAV1 1 PKRHERAV2 1 P

ERBV ERBV GT-1 3 5ERBV GT-2 2 5ERBV GT-3 1 5

EHV-5 EHV-5 GT-A 19 #EHV-5 GT-B 12 #EHV-5 GT-C 4 #

foot-and-mouse disease virus (strain IND 139-02), whichis the only virus with ERAV in the genus Aphthovirus.

Six of the ERBV 3D polyprotein gene sequences wereassigned to three genotypes (-1, -2, and -3), and these threegenotypes were clustered with ERBV1 in the phylogenetictree (Fig. 2B). Three types of ERBV genotypes showed95.0%-96.0% similarity to representative sequences ofERBV1, strain 57-14 (Table 4).

Phylogenetic analysis revealed that 35 of EHV-5 positivesequences were further classified into three genotypesdesignated -A, -B, and -C for the glycoprotein B gene. TheEHV-5 strains in the three genetic groups showed sequencesimilarities of 99.0%-99.2% with respect to EHV-5 stain#281 (the closest relative) and had clustered to EHV-5sequences acquired from the GenBank database (Table 4and Fig. 3). To confirm the identification of these geno-types as EHV-5, the EHV-2 strain 86/67 glycoprotein B genewas rooted in phylogenetic analysis (Fig. 3) and three of theEHV-5 genotypes were identified at the rate of 76.6%-77.1%with EHV-2 strain 86/67.

Sequences identified in this study were depositedin the GenBank database under accession numbersHM234082 (ERAV strain KRHERAV1), HM234083 (ERAVstrain KRHERAV2), HM234084 (ERBV strain KRERBV20),HM234085 (ERBV strain KRERBV24), HM234086 (ERBVstrain KRERBV48), HM234087 (EHV-5 strain KREHV5/5),HM234088 (EHV-5 strain KREHV5/30), and HM234090(EHV-5 strain KREHV5/71).

3.3. Virus Neutralization Test

To examine the incidence of exposure to EHV-1 andEHV-4, VNTs of 73 horse sera were performed, and EHV-1-and EHV-4-specific antibodies were detected in 59 horses(80.8%) that underwent sera testing. Details of VNT resultsare shown in Tables 3 and 5.

4. Discussion

Epidemiological studies have reported that respiratoryviral infection is prevalent among horses [1,2,29,38] andsuggests that Korean race horses are at risk of contractingsuch viral infections. The SRP reported a yearly estimatedincidence rates of 8%-32% of infectious respiratory diseases,depending on the season throughout 2003 and 2004 [30].This rate was significantly higher than the 1.5% equineinfectious respiratory disease incidence per quarter re-ported for the horse populations in the United States [2]and the 8.9% inflammatory airway disease incidence per

rains

equence homology (strain/%)

ERV-1/95.5 D1305-03/93.2 KRHERAV2/91.8ERV-1/89.4 D1305-03/96.2 KRHERAV1/91.87-14/95.0 ERBV GT-2/95.7 ERBV GT-3/95.27-14/96.0 ERBV GT-1/95.7 ERBV GT-3/94.17-14/95.2 ERBV GT-1/95.2 ERBV GT-2/94.1281/99.2 EHV-5 GT-B/99.2 EHV-5 GT-C/99.5281/99.0 EHV-5 GT-A/99.2 EHV-5 GT-C/98.7281/99.0 EHV-5 GT-A/99.5 EHV-5 GT-B/98.7

Fig. 2. Phylogenetic trees inferred using the neighbor-joining method implemented in Clustal X (version 1.60, Ireland) algorithmwith Mega 4.0 software (Japan).Trees illustrating the genetic relationship of equine rhinitis A virus (A) and equine rhinitis B virus (B) 3D polyprotein gene sequences obtained from race horses inSeoul Race Park were compared to previous strains. ERBV2 and ERBV3 are shaded. Bold letters represent sequences identified in this study.

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636 633

month in UK training yards [38]. Even though abundantreports have demonstrated correlations between virusinfection and respiratory diseases and high prevalence ofrespiratory infection of race horses in ROK, there has beenno report validating the prevalence of equine respiratoryviruses associated with equine respiratory infection.

Molecular detection of herpesvirus, known as the maincause of equine respiratory viral infection among horses,has been investigated worldwide, and various rates werefound [39-43]. In the present study, the incidence of EHV-5detected by nested PCR (glycoprotein B gene) was muchhigher than that detected by real-time PCR for EHV-1 andEHV-4, targeting the same gene (Table 2). This diversity ofprevalence was likely due to the sensitivity of diagnosticmethods and/or the period of detections: Pusterla et al. [44]reported that the EHV-1 glycoprotein B gene was detectedup to 75 days postinfection (PI) in experimentally infectedponies and EHV-4 up to 4 weeks PI. The SRP had an EHVoutbreak in 1979, but no additional viral respiratoryoutbreaks have been detected since that time [30]. In this

study, EHV-1 and/or EHV-4 was detected in 10 of 89 (11.2%)horses by using real-time PCR. The alphaherpesvirus isknown to be transmitted mainly by nasal secretions andto latently infect trigeminal ganglion [1,11,20,45]. It is sus-pected that the activated virus can be triggered by stress orcompetition, and virus shedding through nasal secretion iscorrelated with the individual status of horses. To over-come the limitations of antigen detection and to examinethe exposure of EHV-1 and EHV-4 through various infec-tion routes, VNTs were conducted using the EHV-1 anti-body. VNT of EHV-1 and EHV-4 has suggested that thepercentage of race horses that have been exposed to EHV-1and EHV-4 is approaching 80%. Seroprevalence for EHV-1and EHV-4 ranged from 23%-85.2% and approximatelyover 90%, respectively [46-49]. Our data suggest that EHV-1and EHV-4 are endemic in SRP.

EHV-5 and EHV-2 belong to the Gammaherpesvirinaesubfamily and have been associated with various diseasessuch as upper respiratory diseases, pneumonia, pharyn-gitis, immunosuppression, enlarged lymph nodes,

Fig. 3. Phylogenetic tree for glycoprotein B gene showing the position of EHV-5 strains identified at Seoul Race Park (bold letters). The phylogenetic tree inferredusing the neighbor-joining method implemented in Clustal X (version 1.60 software, Ireland) algorithm with Mega 4.0 (Japan).

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636634

ulcerative lesions in the oral mucosa, and keratoconjunc-tivitis [50-52]. EHV-5 is known to be spread primarilythrough nasal secretions [20,53] and horses shedding theviruses play amajor epidemiological role in the distributionof EHV-5 infections. EHV-2 and EHV-5 were geneticallysimilar, and PCR is a rapid and useful tool for the laboratorydiagnosis of viral infections [20,54,55]. Numerous studieshave described both EHV-2 and EHV-5 as showing a highprevalence in horse populations [20,26,56-58]. In ourstudy, EHV-5 was the virus most frequently detectedin nasal swab samples (35/89). However, EHV-2 was notdetected in any of the 89 nasal swab samples (data notshown), using nested PCR primers [20], although this resultcould not be clearly interpreted as a negative result for theEHV-2 as we screened EHV-2 without a positive control.Additionally, three different EHV-5 genotypes were verifiedby sequencing analysis, and these genotypes were clus-tered with the prototype strains isolated in Iceland, Turkey,and Australia.

ERAV and ERBV have been known to be transmittedmainly by nasal secretions and urine of horses that areshedding the virus, and equine rhinitisvirus (ERV) infectionhas been verified as the cause of mild to severe upperrespiratory tract disease [1,29,34,59]. Moreover, Quinlivanet al. [59] reported that ERAV and ERBV infections couldinduce secondary bacterial infections, which delay recoveryperiods and have a significant effect on the performances ofrace horses.

A number of investigations have indicated that ERAVand ERBV are widely distributed, with high seroprevalencein race horse populations in many countries such as theUnited Stages [60], Canada [61], UK [59], United ArabEimirates [62], and Australia [1]. However, ERAV (2.2%) and

Table 5Results of virus neutralization test for EHV-1 and EHV-4 from 73 horses with re

Dilution ratio

<4 4 8 16

No. of horses (%) 14 (19.2) 12 (16.4) 18 (24.7) 10 (13

ERBV (6.7%) were detected at lower incidence rates thanthose in other countries. Co-infectionwith ERAV, ERBV, andEHV has been reported previously [1,28], and was alsoidentified in this study. This first detection of ERAV andERBV in ROK suggests the need for further investigation ofthe clinical significance and epidemiology of these ubiq-uitous viruses.

Previous reports have demonstrated three types of erbo-viruses, and these types were associated with acid stabilityand pathogenic phenotypes: acid-liable/stable ERBV1, acid-liable ERBV2, and acid stable ERBV3 [28,63]. Result ofphylogenetic analysisof3of theERBVgenotypes showedthatthree ERBV genotypes (ERBV GT-1, -2, and -3) formed closerbrancheswith ERBV1 than those of ERBV2 or ERBV3 (Fig. 2B).However, the number of available ERBV2 and ERBV3 3Dpolyprotein sequences in the GenBank database was fewer(one sequence for ERBV1 and ERBV2 each) than for ERBV1. Inaddition, the sequence homology of Korean ERBV genotypesto ERBV1 and ERBV2 reference strains was similar (94.7%-95.5% and 94.5%-95.1%, respectively). Therefore, ERBV GT-1,-2 and -3 could not be clearly assigned as ERBV1, andfurther work, including virus isolation following geneticcharacterization, is required to definitively characterize thisstrain as ERBV1.

The SRP had an influenza epidemic in 1973, and anequine herpesvirus outbreak in 1979, although EAV has notoccurred since the start of horseracing in ROK [30]. TheNational Veterinary Research and Quarantine Service hascontinually screened for EAV antibodies in race horses. Nohorses have tested positive except for an imported stallion(vaccinated). EIV and EAV were not detected in any of thenasal swab samples within this study. The EAV vaccine isnot allowed in ROK and, based on its nonoccurrence, we

spiratory clinical symptoms

32 64 128 256 512

.7) 6 (8.2) 9 (12.3) 4 (5.5) 1 (1.4) 0 (0)

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636 635

assumed that ROK is an EAV-free country. It is worthwhilenoting that we also collected 10 samples from healthy racehorses, and no viral nucleic acid was detected in thosehorses.

5. Conclusions

In ROK, viral infection has so far not been considered asone of the main causes of respiratory disease. Our resultsshow that respiratory viruses are prevalent in the Koreanrace horse population, indicating that equine viral respi-ratory infections should be considered when diagnosingand treating equine respiratory diseases within ROK. Morethan 1,500 race horses are being raised and trained in SRP.Under such circumstances, there is a high risk of spreadingviral infections. Results of phylogenetic analysis suggestthat the use of sequence analyses may provide a usefulepidemiological approach to gain more knowledge aboutthe biology of the viruses. This is the first report of equinerespiratory viral infection within ROK. Our study suggeststhat effective strategies for control and prevention ofequine respiratory viral infection should be established bythe Korean Racing Authority and facilitated by Koreanveterinary schools and professionals.

Acknowledgment

This work was supported by a National Research Foun-dation of Korea grant funded by the Korean govern-ment (KRF-2007-511-E00042). The authors would like tothank Dr. Nicola Pusterla, University of California-Davis, forproviding cDNAs of vaccine strains.

References

[1] Dynon K, Black WD, Ficorilli NP, Hartley CA, Studdert MJ. Detectionof viruses in nasal swab samples from horses with acute, febrile,respiratory disease using virus isolation, polymerase chain reactionand serology. Aust Vet J 2007;85:46-50.

[2] Gross DK, Morley PS, Traub-Dargatz J, Wagner BA, Garber LP. Anational estimate of acute infectious upper respiratory disease(IURD) and risk factors associated with infection for horses in theUnited States during 1998-1999. Proc Am Assoc Equine Pract2000;46:274-6.

[3] Wood JL, Smith KC, Daly JM, Newton R. Viral infections of the equinerespiratory tract. In: McGorum BC, Dixon PM, Robinson NE,Schumacher J, editors. Equine respiratory medicine and surgery.Philadelphia: Saunders Elsevier; 2007:287-326.

[4] van Maanen C, Cullinane A. Equine influenza virus infections: anupdate. Vet Q 2002;24:79-94.

[5] Yamanaka T, Tsujimura K, Kondo T, Hobo S, Matsumura T. Efficacy ofoseltamivir phosphate to horses inoculated with equine influenza Avirus. J Vet Med Sci 2006;68:923-8.

[6] Guthrie AJ, Howell PG, Hedges JF, Bosman AM, Balasuriya UB,McCollum WH, et al. Lateral transmission of equine arteritisvirus among Lipizzaner stallions in South Africa. Equine Vet J2003;35:596-600.

[7] Huntington PJ, Forman AJ, Ellis PM. The occurrence of equinearteritis virus in Australia. Aust Vet J 1990;67:432-5.

[8] Paweska JT, Aitchison H, Chirnside ED, Barnard BJ. Transmission ofthe South African asinine strain of equine arteritis virus (EAV)among horses and between donkeys and horses. OnderstepoortJ Vet Res 1996;63:189-96.

[9] Paweska JT, Binns MM, Woods PS, Chirside ED. A survey for anti-bodies to equine arteritis virus in donkeys, mules and zebra usingvirus neutralization (VN) and enzyme linked immunosorbent assay(ELISA). Equine Vet J 1997;29:40-3.

[10] Holyoak GR, Balasuriya UBR, Broaddus CC, Timoney PJ. Equine viralarteritis: current status and prevention. Theriogenol 2008;70:403-14.

[11] Roizman B, Desrosiers RC, Fleckenstein B, Lopez C, Minson AC,Studdert MJ. The family Herpesviridae: an update. Arch Virol 1992;123:425-49.

[12] Thompson GR, Mumford JA, Smith IM. Experimental immunizationagainst respiratory disease due to equid herpesvirus 1 infection(Rhinopneumonitis) using formalin-inactivated virus with variousadjuvants. Vet Microbiol 1979;4:209-22.

[13] Gibson JS, Slater JD, Awan AR, Field HJ. Pathogenesis of equineherpesvirus-1 in specific pathogen-free foals: primary and secondaryinfection and reactivation. Arch Virol 1992;123:351-66.

[14] Fu ZF, Robinson AJ, Horner GW, Dickinson LG, Grimmett JB,Marshall RB. Respiratory disease in foals and the epizootiology ofequine herpesvirus type 2 infection. N Z Vet J 1986;34:152-5.

[15] Allen GP, Bryans JT. Molecular epizootiology, pathogenesis, andprophylaxis of equine herpesvirus-1 infections. Prog Vet MicrobiolImmunol 1986;2:78-144.

[16] Campbell TM, Studdert MJ, Blackney MH. Immunogenicity of equineherpesvirus type 1 (EHV1) and equine rhinovirus type 1 (ERhV1)following inactivation by betapropiolactone (BPL) and ultraviolet(UV) light. Vet Microbiol 1982;7:535-44.

[17] Slater JD, Lunn DP, Horohov DW, Antczak DF, Babiuk L, Breathnach C,et al. Report of the equine herpesvirus-1 Havermeyer workshop, SanGimignano, Tuscany, June 2004. Vet Immunol Immunopathol 2006;111:3-13.

[18] Lunn DP, Davis-Poynter N, Flaminio MJ, Horohov DW, Osterrieder K,Pusterla N, et al. Equine herpesvirus-1 consensus statement. J VetIntern Med 2009;23:450-61.

[19] Slater JD, Borchers K, Field HJ. Equine herpesvirus-1: a neurotropicalphaherpesvirus. Vet Rec 1994;135:239-40.

[20] Wang L, Raidal SL, Pizzirani A, Wilcox GE. Detection of respiratoryherpesviruses in foals and adult horses determined by nestedmultiplex PCR. Vet Microbiol 2007;121:18-28.

[21] Bak CH, Lim BH, Kang SY, Lee A. Pathological survey on equineviral rhinopneumonitis occurred in Korea. Kor J Vet Res1981;21:11-23.

[22] Agius CT, Nagesha HS, Studdert MJ. Equine herpesvirus 5: compar-isons with EHV2 (equine cytomegalovirus), cloning, and mappingof a new equine herpesvirus with a novel genome structure. Virol1992;191:176-86.

[23] Murray MJ, Eichorn ES, Dubovi EJ, Ley WB, Cavey DM. Equineherpesvirus type 2: prevalence and seroepidemiology in foals.Equine Vet J 1996;28:432-6.

[24] Studdert MJ. Comparative aspects of equine herpesvirus. Cornell Vet1974;64:94-122.

[25] Craig MI, Barrandeguy ME, Fernández FM. Equine herpesvirus 2(EHV-2) infection in thoroughbred horses in Argentina. BMC Vet Res2005;9:1-9.

[26] Diallo IS, Hewitson GR, de Jong A, Kelly MA, Wright DJ, Corney BG,et al. Equine herpesvirus infections in yearlings in South-EastQueensland. Arch Virol 2008;153:1643-9.

[27] Mori A, De Benedictis P, Marciano S, Zecchin B, Zuin A, Zecchin B,et al. Development of a real-time duplex TaqMan-PCR for thedetection of equine rhinitis A and B viruses in clinical specimens.J Virol Methods 2009;155:175-81.

[28] Horsington JJ, Gilkerson JR, Hartley CA. Identification of mixedequine rhinitis B virus infections leading to further insight on therelationship between genotype, serotype and acid stability pheno-type. Virus Res 2011;155:506-13.

[29] Kriegshauser G, Deutz A, Kuechler E, Skern T, Lussy H, Nowotny N.Prevalence of neutralizing antibodies to equine rhinitis A and B virusin horses and man. Vet Microbiol 2005;106:293-6.

[30] Ryu SH, Koo HC, Park YK, Kim JM, Jung WK, Davis WC, et al. Etiologicand immunologic characteristics of thoroughbred horses withbacterial infectious upper respiratory disease at the Seoul Race Park.J Microbiol Biotechnol 2009;19:1041-50.

[31] Diallo IS, Hewitson G, Wright LL, Kelly MA, Rodwell BJ, Corney BG.Multiplex real-time PCR for the detection and differentiation ofequid herpesvirus 1 (EHV-1) and equid herpesvirus 4 (EHV-4). VetMicrobiol 2007;123:93-103.

[32] Di Trani L, Bedini B, Donatelli I, Campitelli L, Chiappini B, DeMarco MA, et al. Sensitive one-step real-time PCR for detection ofavian influenza viruses using a MGB probe and an internal positivecontrol. BMC Infect Dis 2006;6:87-94.

[33] Balasuriya UB, Leutenegger CM, Topol JB, McCollum WH,Timoney PJ, MacLachlan NJ. Detection of equine arteritis virus byreal-time TaqMan reverse transcription-PCR assay. J Virol Methods2002;101:21-8.

[34] Black WD, Hartley CA, Ficorilli NP, Studdert MJ. Reversetranscriptase-polymerase chain reaction for the detection of equinerhinitis B viruses and cell culture isolation of the virus. Arch Virol2007;152:137-49.

S. Ko et al. / Journal of Equine Veterinary Science 33 (2013) 628-636636

[35] Crabb BS, Studdert MJ. Equine herpesviruses 4 (equine rhinopneu-monitis virus) and 1 (equine abortion virus). Adv Virus Res 1995;45:153-90.

[36] Whitwell KE, Gower SM, Smith KC. An immunoperoxidase methodapplied to the diagnosis of equine herpesvirus abortion, usingconventional and rapid microwave techniques. Equine Vet J1992;24:10-2.

[37] Karber G. 50% endpoint calculation. Arch Exp Pharmak 1931;162:480-3.

[38] Wood JL, Newton JR, Chanter N, Mumford JA. Inflammatory airwaydisease, nasal discharge and respiratory infections in young Britishracehorses. Equine Vet J 2005;37:236-42.

[39] Ballagi-Pordany A, Klingeborn B, Flensburg J, Belak S. Equineherpesvirus type 1: detection of viral DNA sequences in abortedfetuses with the polymerase chain reaction. Vet Microbiol1990;22:373-81.

[40] Osterrieder N, Hubert PH, Brandmuller C, Kaaden OR. A touchdownPCR for the differentiation of equine herpesvirus type 1 (EHV-1)field strains from the modified live vaccine strain RacH. J VirolMethods 1994;50:129-36.

[41] Sharma PC, Cullinane AA, Onions DE, Nicolson L. Diagnosis of equidherpesvirus-1 and -4 by polymerase chain reaction. Equine Vet J1992;24:24-5.

[42] Varrasso A, Dynon K, Ficorilli N, Hartley CA, Studdert MJ,Drummer HE. Identification of equine herpesviruses 1 and 4 bypolymerase chain reaction. Aust Vet J 2001;79:563-9.

[43] Welch HM, Bridges CG, Lyon AM, Griffiths L, Edington N. Latentequid herpesviruses 1 and 4: detection and distinction using thepolymerase chain reaction and co-cultivation from lymphoidtissues. J Gen Virol 1992;73:261-8.

[44] Pusterla N, Chaney KP, Maes R, Wise AG, Holland R, Schott HC.Investigation of the molecular detection of vaccine-derived equineherpesvirus type 1 in blood and nasal secretions from horsesfollowing intramuscular vaccination. J Vet Diagn Invest 2007;19:290-3.

[45] Borchers K, Wolfinger U, Lawrenz B, Schellenbach A, Ludwig H.Equine herpesvirus 4 DNA in trigeminal ganglia of naturally infectedhorses detected by direct in situ PCR. J Gen Virol 1997;78:1109-14.

[46] Gilkerson JR, Whalley JM, Drummer HE, Studdert MJ, Love DN.Epidemiological studies of equine herpesvirus 1 (EHV-1) in thor-oughbred foals: a review of studies conducted in the Hunter Valleyof New South Wales between 1995 and 1997. Vet Microbiol 1999;16:15-25.

[47] Keane DP, Little PB, Wilkie BN, Artsob H, Thorsen J. Agents of equineviral encephalomyelitis: correlation of serum and cerebrospinalfluid antibodies. Can J Vet Res 1988;52:229-35.

[48] Nordengrahn A, Merza M, Svedlund G, Roneus M, Berndtsson T,Lindholm A, et al. A field study of the application of a type-specifictest distinguishing antibodies to equine herpesvirus-4 and -1.Equine Infectious Diseases: Proceedings of the Eighth InternationalConference. 1999;125-8.

[49] Singh BK, Yadav MP, Uppal PK, Rattan B. National assessment ofequine herpesvirus-1 infection among equidae in India. EquineInfectious Diseases: Proceedings of the Eighth InternationalConference. 1999;578-9.

[50] Kershaw O, von Oppen T, Glitz F, Deegen E, Ludwig H, Borchers K.Detection of equine herpesvirus type 2 (EHV-2) in horses withkeratoconjunctivitis. Virus Res 2001;28:93-9.

[51] Vengust M, Baird JD, van Dreumel T, Ackerley C, Bienzle D. Equidherpesvirus 2-associated oral and esophageal ulceration in a foal. JVet Diagn Invest 2008;20:811-5.

[52] Williams KJ, Maes R, Del Piero F, Lim A, Wise A, Bolin DC, et al.Equine multinodular pulmonary fibrosis: a newly recognizedherpesvirus-associated fibrotic lung disease. Vet Pathol 2007;44:849-62.

[53] Dunowska M, Wilks CR, Studdert MJ, Meers J. Equine respiratoryviruses in foals in New Zealand. N Z Vet J 2002;50:140-7.

[54] Ataseven VS, Bilge-Da�galp S, Güzel M, Basaran Z, Tan MT,Geraghty B. Prevalence of equine herpesvirus-1 and equineherpesvirus-4 infections in equidae species in Turkey as determinedby ELISA and multiplex nested PCR. Res Vet Sci 2009;86:339-44.

[55] Nordengrahn A, Mezra M, Ros C, Linholm A, Palfi V, Hannant D,et al. Prevalence of equine herpesvirus types 2 and 5 in horsepopulations by using type-specific PCR assays. Vet Res2002;33:251-9.

[56] Bell SA, Balasuriya UBR, Gardner IA, Barry PA,WilsonWD, Ferraro GL,et al. Temporal detection of equine herpesvirus infections of a cohortof mares and their foals. Vet Microbiol 2006;116:249-57.

[57] Borchers K, Wolfinger U, Goltz M, Broll H, Ludwig H. Distributionand relevance of equine herpesvirus type 2 (EHV-2) infections. ArchVirol 1997;142:917-28.

[58] Torfason EG, Thorsteinsdottir L, Thorsteinsdottir S, Svansson V.Study of equid herpesviruses 2 and 5 in Iceland with a type-specificpolymerase chain reaction. Res Vet Sci 2008;85:605-11.

[59] Quinlivan M, Maxwell G, Lyons P, Arkins S, Cullinane A. Real-timeRT-PCR for the detection and quantitative analysis of equine rhinitisviruses. Equine Vet J 2010;42:98-104.

[60] McCollum WH, Timoney PJ. Studies on the seroprevalence andfrequency of equine rhinovirus 1 and 2 infection in normal horseurine. Paper presented at the 6th International Conference onEquine Diseases; July 7–11, 1991; Cambridge, UK. p. 83-7.

[61] Carman S, Rosendal S, Huber L, Gyles C, McKee S, Willoughby RA,et al. Infectious agents in acute respiratory disease in horses inOntario. J Vet Diagn Invest 1997;9:17-23.

[62] Wernery R, Wernery R, Zachariah J, Hayden-Evans. Serologicalsurvey of some equine infectious diseases in the United ArabEmirates. Equine Infectious Diseases: Proceedings of the 8th Inter-national Conference. 1998;367-70.

[63] Black WD, Hartley CA, Ficorilli NP, Studdert MJ. Sequence variationdivides equine rhinitis B virus into three distinct phylogeneticgroups that correlate with serotype and acid stability. J Gen Virol2005;86:2323-32.