Fat mass and obesity associated (FTO)gene

Involvement in food intake regulation

Caroline Ingman

Degree project in biology, Master of science (2 years), 2010Examensarbete i biologi 30 hp till masterexamen, 2010Biology Education Centre and Dept of Neuroscience, functional pharmacology, Uppsala UniversitySupervisors: Pawel Olszewski and Helgi Schiöth

Table of Contents Table of Contents ....................................................................................................................... 2 Summary .................................................................................................................................... 3 Introduction ................................................................................................................................ 4 

Fat mass and obesity associated gene..................................................................................... 4 Regulation of energy level-instigated feeding ....................................................................... 5 Real-time PCR ........................................................................................................................ 6 Aim of the study ..................................................................................................................... 7 

Results ........................................................................................................................................ 8 Neuroanatomical expression of fat mass and obesity associated ........................................... 8 mRNA expression in the amygdala ........................................................................................ 9 

Discussion ................................................................................................................................ 11 Neuroanatomical expression of the fat mass and obesity associated gene........................... 11 FTO expression in the amygdala .......................................................................................... 12 

Materials and methods ............................................................................................................. 13 Animals ................................................................................................................................ 13 Perfusion and sectioning of brains ....................................................................................... 13 Immunohistochemical staining of free-floating sections ..................................................... 13 RNA extraction .................................................................................................................... 13 cDNA synthesis .................................................................................................................... 14 Real time PCR ...................................................................................................................... 15 

Acknowledgements .................................................................................................................. 17 References ................................................................................................................................ 18 

2

Summary Mutations in the FTO (fat mass and obesity associated) gene have been implicated earlier in obesity in humans. Thus far, few papers have examined the relationship between energy homeostasis and FTO in animal models. In the current project, molecular and histochemical approaches were used to better characterize the involvement of FTO in the brain in the regulation of feeding.

To examine whether the FTO protein is present at brain sites that govern energy intake, coronal hypothalamic sections from male mice and rats were immunohistochemically stained for FTO. Positive staining was located in the vicinity of the third ventricle and FTO distribution patterns were relatively parallel between the two species. However, rats had a higher FTO immunoreactivity in the suprachiasmatic nucleus than in the paraventricular and arcuate nucleus, whereas in the mice it was similar in these three regions. Rats also exhibited strong immunoreactivity in the supraoptic nucleus while mice did not. Overall, FTO was mainly located at sites involved in food intake regulation in the rodents.

To determine whether food deprivation affects FTO mRNA levels in the amygdala, mRNA was collected from mice that either had free access to food or were deprived for 12 h or 24 h, and analyzed by real time PCR. FTO mRNA levels were upregulated during acute starvation, but only moderately during prolonged food deprivation. Increased expression of several feeding stimulating genes as well as feeding inhibiting oxytocin suggests that FTO responds to changes in energy balance and is involved in the regulation of energy homeostasis. These findings support FTO’s proposed role as a demethylase and that its upregulation during acute food deprivation is not only limited to the hypothalamus (Olszewski et al. 2009) but also occurs in amygdala. These data further sustain the notion that FTO is involved in the regulation of energy homeostasis and this role is facilitated by widespread central circuitry.

3

4

Introduction

Fatmassandobesityassociatedgene

Overweight and obesity in humans traditionally have been thought to stem fromlifestylesandenvironmentalfactors;however,ithasbecomeevidentthatgeneticfactorsaffectweightgainaswell.

In 2007, two separate genome-wide associations showed that genetic variants in a gene dubbed FTO (fat mass and obesity associated) were strongly associated with obesity (Frayling et al. 2007; Scuteri et al. 2007). Scuteri et al. searched for genes coupled to obesity and its related traits using the genetically isolated population of Sardinia and found FTO alleles to be coupled to elevated body mass index (BMI; weight in kg/height squared in m2) and comorbidities (Scuteri et al. 2007).

Several subsequent population studies [Slavic (Hubacek et al. 2008), Mexican (Villalobos-Comparán et al. 2008), Spanish (González-Sánchez et al. 2009), Danish (Kring et al. 2008) Australian (Cornes et al. 2009), Korean (Cha et al. 2008), German (Sorbs) (Tönjes et al. 2009), French (Legry et al. 2009; Dina et al. 2007), non-Hispanic Caucasian American (Price et al. 2008), American (Hunt et al. 2008), Hispanic American (Wing et al. 2009) and African American (Wing et al. 2009) cohorts] confirmed that FTO variants are associated with increased body fat mass. In these studies, different single nucleotide polymorphisms (SNPs) in FTO were linked with increased BMI; however, one of the most prevalent SNPs found to be correlated with obesity was rs9939609 (NM_001080432.2) (Legry et al. 2009; Wing et al. 2009; Villalobos-Comparán et al. 2008; González-Sánchez et al. 2009; Cornes et al. 2009; Price et al. 2008; Hunt et al. 2008) located on chromosome 16q12.2 (Dina et al. 2007). Subjects homozygous for the risk allele rs9939609 had an increased weight of ~3 kg and 1.67-fold higher prevalence of obesity compared to homozygotes for the low-risk allele in a study consisting of 40 623 individuals (Frayling et al. 2007).

Attempts to link FTO directly to other co-morbidities of obesity generally have failed to show any association. Most notably, Frayling et al. discovered a correlation between FTO and type 2 diabetes which was nonetheless abolished when BMI was taken into account (Frayling et al. 2007).

Several studies have been performed to investigate the nature of FTO’s involvement in body weight control, namely, whether FTO influences food intake regulation, energy expenditure and/or reward. The general consensus is that FTO affects energy intake (Wardle et al. 2008; Timpson et al. 2008; Cecil et al. 2008; Wardle et al. 2009; Olszewski et al. 2009) but the approaches differ: some speculate that FTO is involved in satiety (Wardle et al. 2008; Wardle et al. 2009; Olszewski et al. 2009), while others suggest a link to consumption of (preference for) energy-rich food (Cecil et al. 2008; Timpson et al. 2008).

The magnitude of the obesogenic influence exerted by FTO variants can be modified by differences in lifestyles; e.g. eating low-fat diets (Sonestedt et al. 2009) as well as exercise (Andreasen et al. 2008; Rampersaud et al. 2008) can attenuate the effect of high-risk variants of FTO. A population study performed on Africans (Gambians) showed no correlation between FTO variants and obesity, which may be due to limited food availability (Hennig et al. 2009). Overall, these examples do not negate the importance of FTO as a factor underlying obesity, but rather illustrate the cross-talk between the genetic and environmental factors in the development of obese phenotypes. Even though the exact cellular function of FTO is unknown, two bioinformatics analyses (Gerken et al. 2007; Sanchez-Pulido & Andrade-Navarro 2007) concluded that FTO shares common motifs with Fe(II)- and 2-oxoglutarate-dependent oxygenases. Gerken et al. also

determined that FTO encodes murine 2-oxoglutarate-dependent nucleic acid demethylase that catalyzes demethylation of 3-methylthymine in single-stranded DNA (Gerken et al. 2007).

This discovery suggests that FTO affects BMI not by directly affecting body weight mechanisms (including fat stores) but by influencing the transcription of genes (through demethylation of the target DNA) involved in food intake control in the central nervous system (CNS), hence, influencing consummatory behavior. Previous reports that FTO is abundantly expressed in hypothalamic feeding-related sites (Fredriksson et al. 2008; Gerken et al. 2007) in the brain support this hypothesis.

Regulation of energy level-instigated feeding Body weight and food intake are governed by multiple genes that control various aspects of energy homeostasis, such as eating for energy, energy expenditure and feeding reward. Many genes regulating these mechanisms are expressed in several subdivisions of the CNS including the hypothalamus, which affects mainly consumption for energy and neuroendocrine brain activity related to energy metabolism, and the amygdala where “emotional” processing of food consumption, ranging from stress- to reward-driven feeding activity, occurs.

Functioning of the feeding-related brain circuitry is extremely complex as it involves reciprocal communication between the CNS and the periphery as well as within the brain. Peripheral signaling – e.g. ghrelin for a decreased energy status and leptin and insulin for an elevated one – regarding energy homeostasis reaches neurons in the arcuate nucleus (ARC), which in response to energy depletion produces neuropeptide Y (NPY), which is released in the paraventricular nucleus (PVN) where it binds to NPY receptor Y1 and elicits a consummatory response (Kalra et al. 2004; Gao & Horvath, 2008; Valassi et al. 2008; Kageyama et al. 2010). NPY also activates orexigenic (i.e. food-intake stimulating) melanin-concentrating hormone and orexin-containing neurons in the lateral hypothalamic area (Fig. 1) (Valassi et al. 2008).

When leptin/insulin instead signals the ARC, pro-opiomelanocortin (POMC) is produced whose cleaved product, α-melanocyte stimulated hormone (α-MSH) has an inhibitory effect on feeding via the PVN (Meister 2007; Gao & Horvath, 2008); it elicits production of

Fig. 1 Main food intake regulating pathways in the hypothalamus Peripheral signal regarding energy level reaches the arcuate nucleus (ARC) from where the signal is forwarded to the paraventricular nucleus (PVN) and the lateral hypothalamic area (LHA) by neuropeptide Y (NPY) and pro-opiomelanocortin (POMC). Anorexigenic peptides: thyrotropin-releasing hormone (TRH), oxytocin (OXY), corticotropin releasing hormone (CRH) and POMC. Orexigenic peptides: orexin (ORX), melanin-concentrating hormone and NPY. Green (+) lines activates while red (-) inhibits the target cells.

5

corticotropin-releasing hormone – an anorexigenic (i.e. consumption termination) signal – which inhibits NPY-induced feeding (Kalra et al. 1999) as well as induces production of oxytocin (OXY), an anorexigenic hormone (Fig. 1). POMC activity also can be influenced by the ventromedial nucleus since its neurons can influence ARC to increase POMC cell activity during fasting, and it contains receptors for both NPY and α-MSH allowing it to be influenced by ARC in return. (Gao & Horvath, 2008).

Another center involved in energy balance is the dorsomedial hypothalamic nucleus which also contains NPY neurons. In contrast to ARC NPY neurons, which are associated with leptin, DMH NPY neurons do not respond to leptin, but they still influence energy balance and feeding through interactions with other neuropeptides. While both NPYs are upregulated during food deprivation, DMH NPY expression is only elevated during constant fasting while ARC NPY is upregulated both during short- and long-term scarcity of food (Sheng 2007).

Not only energy regulation has an effect on food intake. The circadian clock located at the suprachiasmatic nucleus is also involved in regulation of metabolism and feeding, mainly by setting the body’s clock for feeding time (anticipating when to feed) and by periodic activation of metabolic enzymes (Bechtold, 2008).

Real-time PCR Real time PCR can be used to determine tissue specific gene expression by quantifying mRNA. mRNA extracted from the tissue is reverse transcribed to complementary DNA (cDNA), which is then amplified with qPCR using regular PCR reactants and a fluorescent dye that binds to double-stranded DNA e.g. SYBR green (see materials and methods). The qPCR amplify DNA like a normal PCR except, at each cycle the fluorescence is measured and thus indirectly the amount of DNA. The amplification of DNA follows a three-phase pattern, first is the lag phase during which the fluorescence has not risen above the background levels. The second phase is the exponential during which the DNA amplification can be detected. Last is the plateau phase during which no amplification occurs due to exhaustion of reactants (Karlen et al. 2007).

A cycle threshold (Ct) is set automatically at the exponential phase. The amount of fluorescence measured at this point is used for further analysis. The assumption of qPCR amplification is that the amount of DNA is doubled every cycle and thus the fluorescence value at the Ct reflects the templates original concentration (Karlen et al. 2007). This is, however, not exact since primers have different efficiencies, consequently that has to be taken into account when using the Ct value (Ramakers et al. 2003).

In this experiment only relative quantification of mRNA concentrations was used and it was performed by comparing when the reactions have reached exponential phase (Ct-value). Relative quantification was then performed via the following formula:

)( min txt CCeffx PC −=

Cx is the sample concentration relative the sample reaching the Ct first and it is the primer efficiency (Peff) to the power of Ctmin (when the fastest sample reaction has reached the Ct) minus Ctx (when the sample reaction has reached the Ct). This formula yields the concentration 1 for the sample reaching exponential phase at the earliest time point and all other sample concentrations are expressed as relative to this.

Differences in tissue size and RNA preparation protocol can also generate false differences in sample Cx values; therefore the sample Cx is normalized against the geometric mean of three housekeeping gene Cx for each tissue (Vandesompele et al. 2002) since they are stably expressed in the tissue.

6

Aim of the study The main emphasis in studies of FTO conducted thus far has been to examine FTO gene expression changes in the energy homeostasis-related hypothalamus, while other areas that govern feeding for different reasons (e.g. stress) generally have been neglected. In addition, the knowledge of the central topography of FTO neurons is limited to in situ detection of FTO mRNA. No analysis of FTO protein has been provided. Therefore, while the overarching goal of the studies presented herein was to further elucidate whether central FTO is involved in the regulation of food intake, two specific projects were undertaken: (1) To use immunohistochemistry to examine whether FTO protein is present in forebrain sites that govern energy intake and metabolism, and (2) to determine whether food deprivation affects FTO mRNA levels in the amygdala in a similar fashion as that reported in the hypothalamus.

7

Results Neuroanatomical expression of the fat mass and obesity associated gene To examine whether fat mass and obesity associated (FTO) protein is present at forebrain sites that govern energy intake and metabolism immunohistochemical staining of coronal sections of the hypothalamus was conducted. Presence of FTO was detected mainly in the vicinity of the third ventricle in the areas of paraventricular nucleus (PVN), arcuate nucleus ARC), suprachiasmatic nucleus (SCN), supraoptic nucleus (SON), dorsomedial nucleus, and ventromedial nucleus in both mice and rats (Fig. 2).

Fig. 2 FTO immunoreactivity in the rat hypothalamus Coronal sections of hypothalamus in rat brains were immunohistochemically stained for FTO protein and the staining occurred in the vicinity of the third ventricle7. The pictures illustrate the staining; A) paraventricular nucleus1 B) suprachiasmatic nucleus2 and supraoptic nucleus3 C) dorsomedial hypothalamic nucleus, compact part4, ventromedial nucleus5 and arcuate nucleus6.

8

Staining intensity was manually detected and rated on a scale from 0 (no staining) to 3 (maximal staining) and average staining intensity was calculated for each species (Table 1). The expression patterns were relatively similar between the two species except for the SCN where rats had almost twice as high FTO immunoreactivity (IR) when compared to the PVN and ARC, whereas in mice, it was similar in those three regions. Rats also had strong expression in the SON while the mice did not. Overall, mice had a higher FTO IR in PVN and ARC when compared to the rats. Table 1. Occurrence of the FTO protein in different parts of hypothalamus in mice and rats

Average immunoreactivity1

Animals

PVN2

ARC3

SCN4

SON5

DMD6

DMV7

Rats

1

1.1

1.9

2

0.9

0.5

Mice

1.5

1.8

1.7

0

0.7

0.5

1Average intensity of immunohistochemical staining of FTO in 4 rats (4 sections) and 3 mice (7 sections) judged visually on a scale from 0 (no staining) to 3 (maximal staining).

2paraventricular nucleus, 3arcuate nucleus, 4suprachiasmatic nucleus, 5supraoptic nucleus, 6dorsomedial nucleus, dorsal part and 7dorsomedial nucleus, ventral part.

Other feeding-related areas – dorsal lateral septum, bed nucleus of the stria terminalis and

nucleus accumbens – were also examined for the presence of staining. However, due to erroneous staining the results were too inconclusive to be included.

mRNA expression in the amygdala To detect whether food deprivation affects expression of FTO in amygdala; mRNA extracted from the amygdala in mice (three groups; free access to food, 12 h or 24 h food deprivation) was analyzed with qPCR.

Fig. 3. Relative expression of feeding-related genes in ad libitum-fed vs. food-deprived mice mRNA levels of eight genes: fat mass and obesity associated (FTO), opioid receptor, mu 1 (MOR), opioid receptor-like 1 (ORL1), neuropeptide Y (NPY), corticotropin releasing hormone (CRH), orexin (ORX), oxytocin (OXY) and melanin concentrating hormone (MCH, when manually corrected for outliers) in the differently treated groups of mice (free access to food (ad lib), 12 h or 24 h starvation). The groups were compared to the control group (ad lib) in each gene to acquire relative expression (ad lib = 1). Bars indicate standard error of mean (SEM). The brackets show between what groups significance was found. *** = p < 0.001, ** = p < 0.01, * = p < 0.05.

9

Eight genes found to be significantly different between freely feeding mice (ad lib) and

mice subjected to 12 h food deprivation (Fig. 3) were fat mass and obesity associated, neuropeptide Y, opioid receptor-like 1, orexin, melanin concentrating hormone (when manually corrected for outliers) and oxytocin. Genes encoding corticotropin releasing hormone, fat mass and obesity associated protein, opioid receptor, mu 1, neuropeptide Y, orexin, concentrating hormone (when manually corrected for outliers) and oxytocin also demonstrated significant differences between 12 h and 24 h starvation (Fig. 3).

Seven other genes known for their involvement in food intake regulation – en-coding opiomelanocortin-α, enkephalin, corticotropin releasing hormone receptor 1, neuro- peptide Y, proreceptor Y1, vasopressin, opioid receptor, kappa 1 and melanin concen- trating hormone receptor 1 – all exhibited no significant differences between the differently treated groups.

10

Discussion The gene dubbed fat mass and obesity associated (FTO) has been previously implicated in the development of obesity in humans (Loos & Bouchard 2008), but the exact mechanisms are unknown. Data obtained in animal studies have confirmed the relationship between FTO and energy homeostasis. However, these data also suggested that this gene affects the regulation of food intake; it is thought to be associated mainly with the energy (i.e. calorie) consumption rather than the reward system (Olszewski et al. 2009). Calorie intake is regulated by, among many others, groups of neurons localized in the vicinity of the third ventricle and is a complicated process controlled by several genes, some of which are responsible anorexigenic responses whereas others orexigenic.

Neuroanatomical expression of the fat mass and obesity associated gene Two approaches were used to elucidate whether central (in brain) FTO is involved in the regulation of food intake. Immunohistochemistry was used to determine the distribution of FTO protein in mouse brains. It was shown that FTO was mainly located at sites governing energy intake in the vicinity of the third ventricle, i.e. the paraventricular, dorsomedial hypothalamic, ventromedial and arcuate nuclei. FTO’s occurrence in mainly nuclei controlling food intake due to energy balance is in conformity with prior findings that FTO mRNA was expressed at these same sites (Fredriksson et al. 2008; Olszewski et al. 2009) which strongly implicates that FTO is involved in energy intake and not feeding reward. FTO protein was present also in the suprachiasmatic nucleus which serves as the circadian clock that also regulates feeding, but more based on daily rhythms than on energy homeostasis (Bechtold, 2008). This was also in accordance with previous results where it was shown that FTO mRNA is expressed in the suprachiasmatic nucleus (Fredriksson et al. 2008). The immunohistochemical staining showed no localization of FTO protein outside food intake sites in the forebrain, but its possible localization to other areas cannot be disregarded since it was not possible to discern staining at other sites due to erroneous staining.

FTO immunohistochemistry showed a much more widespread distribution of the FTO protein than what had been found previously using in situ hybridization for FTO mRNA (Fredriksson et al. 2008). The reason for this outcome can only be speculated: perhaps differences in sensitivities of each method are the culprit or slow degradation of the protein may play the role. Another possibility is that the high level of FTO protein, which presumably acts in demethylation mechanisms (Gerken et al. 2007) and hence its basal turnover is almost continuous, are associated with a constant low-level mRNA presence that is hard to distinguish with in situ methodology. Nonetheless, this wide occurrence of FTO protein throughout feeding-related central sites can serve as evidence supporting the notion that FTO’s function in cell physiology is basic and crucial. This also supports FTO’s proposed role in demethylation in cells controlling food intake; by influencing transcription of other feeding-related it controls the output of these neurons (i.e. release of peptides or expression of receptors) in response to modifications in the energy status of the organism.

Rat brains also exhibited staining in the same food intake regulating areas as the mouse brains, which suggests that FTO has the same function in these two species. This is a strong indication that FTO has been preserved and thus has a vital role for the survival of the organism, which is in agreement with its proposed role as a demethylase regulating energy homeostasis.

However, the preservation of FTO in rodents could also indicate that FTO has an even more important role in the CNS than being involved in regulation of energy homeostasis. This would be in concert with its proposed function in demethylation, which is crucial for the

11

proper functioning of many genes. It has been shown that homozygous fused toe (Ft) mice that have a 1.6 Mb deletion in FTO (Peters et al. 2002) have malformed brains and do not survive gestation, while heterozygotes exhibit enlarged thymus and malformed limbs (van der Hoeven et al. 1994). In a unique family where some members carry a mutation in FTO that renders the enzyme nonfunctional these members exhibit early lethality, malfunctioning brains and growth retardation (Boissel et al. 2009). Both these findings support the notion that FTO has other more important functions in the CNS in addition to regulating energy intake.

FTO expression in the amygdala Although FTO is strongly implied in the regulation of energy homeostasis (Olszewski et al. 2009), a role for FTO in other aspects of food regulation cannot be excluded. It was therefore of interest to explore whether FTO affects feeding via other mechanisms. An experiment was hence conducted to see how food deprivation affects FTO mRNA levels in the amygdala since this structure is involved in food consumption at an “emotional” level ranging from stress- to reward-driven feeding activity.

It was observed that the FTO mRNA levels in the amygdala were significantly different between mice that had been feeding freely and those that had been starved. Acute starvation (12 h) considerably increased the expression of FTO mRNA – which corresponds to previous findings in the hypothalamus (Olszewski et al. 2009) – while prolonged starvation only slightly elevated the expression. This might be explained by that an acute starvation triggers a severe emotional response, e.g. stress due to hunger – in which FTO is involved – which encourages the animal to search for food. During prolonged deprivation of food (24 h) this signal weakens since the animal cannot uphold the stress level for an extended period of time. When compared to the expression levels of orexigenic genes (orexin, neuropeptide Y and melanin concentrating hormone) it was observed that the same patterns could be observed in genes that induces food intake. However, these signals act upon low energy levels in the body and thus again implicates that FTO is involved in energy balance and not emotional responses.

In contrast, mRNA for oxytocin – an anorexigenic peptide (as evidenced in relation to the hypothalamic pool of oxytocin) that is released by distension of the stomach and increase in plasma salt concentration – was also drastically up regulated during acute food deprivation, but only slightly elevated during prolonged starvation. This might be explained if the mice tried to avoid feeling hunger by drinking excess of water and thus distending the stomach creating a false signal of satiety, while the actual energy levels signaled energy deprivation and thus upregulated the orexigenic signals above.

On the other hand, the anorexigenic function of oxytocin has only been connected to the hypothalamus. In the amygdala it might have a completely different function not associated with feeding regulation or might not even be interacting with FTO in the amygdala to control feeding but is instead coupled to emotional responses only.

12

Materials and methods Animals Male mice (C57BL/6J (Scanbur, Sweden)) and male rats (Sprague dawley (Scanbur, Sweden)) were used. The procedures had been approved by the Uppsala Animal welfare Committee.

The animals (rats and mice) were housed in the animal facility at Biomedical centre (Uppsala) under standard conditions: Macrolon III (mice) and Macrolon IV (rat) cages, light/dark cycle 12:12 h (lights on after 0600), temperature of 20 ± 2 °C, relative humidity of 30-60 % and air change approximately 15 times/hour. The cages were cleaned twice a week and aspen chips were used as bedding material. Chow (Lactamin, Sweden) and tap water were available ad libitum unless otherwise stated below.

Perfusion and sectioning of brains 3 mice and 4 rats were deeply anaesthetized with intraperitoneal pentobarbital (100 mg/kg) injection before perfusion with 5 ml 0.9 % NaCl followed by 50 ml 4 % paraformaldehyde (Sigma-Aldrich) in 0.1 M sodium phosphate buffer. The brains were excised and stored in the same fixative at 4 °C overnight (ON) before being coronally (from the front to the back of the brain) cut into 60 µm thick sections using a Vibratome (Leica). The sections were stored in 12-well plates containing TBS (0.606 % Trizma HCl (Sigma), 0.139 % Trizma Base (Sigma) and 0.876 % NaCl in dH2O) at 4 °C until immunohistochemical staining.

Immunohistochemical staining of free-floating sections The wells contained 3 sections per well and in all steps 1 ml of each solution was added per well. The sections were rinsed with TBS 4 × 10 min before and after the protocol as well as between all steps except the MQ H2O and HCl steps. They were incubated in 10 % MeOH (Sigma-Aldrich) and 3 % H2O2 (Scharlau) in TBS for 10 min at room temperature (RT) and washed with MQ H2O 3 × 10 min before incubation with 2 M HCl for 3 h at RT. Subsequent treatment with primary antibody (rabbit-anti-FTO (Inovagen)) diluted in Supermix (0.25 % gelatin and 0.5 % Triton X-100 in TBS) ON at 4 °C was followed by secondary antibody (biotinylated goat anti-rabbit IgG (Novastain) (1 µl/400 µl Supermix) at RT for 1 h. Next, the sections were incubated with avidine-biotin complex solution (1 μl (Novastain kit)/800 µl Supermix) for 1 h at RT before development with 3,3´-diaminbenzidine tetrahydrochloride (DAB (Sigma)) (1 tablet DAB in 10-15 ml TBS + 15 µl H2O2 + 500 µl 12 % NiCl). Sections were observed in a light microscope during development to determine proper time for development termination (2-12 min).

The sections were transferred to gelatinized glass slides and left to dry at RT ON before dehydration, during which the slides were placed sequentially in 70 % EtOH for 5 min, 95 % EtOH for 5 min, 100% EtOH for 10 min and Xylene (Sigma-Aldrich) for 20 min before being mounted with DPX (Fluka).

The staining of the different regions was identified visually and an estimate of the intensity of the staining was manually determined (scale between 0 (none) and 3 (maximum)) using light microscopy (Leica). An average of staining was calculated for each region in each animal, which were then used to calculate an average for each species.

RNA extraction 30 male mice (Scanbur, Sweden) starved for 12 h, 24 h or those that had free access to chow (ad lib (Lactamin, Sweden)) (10 individuals in each group) were decapitated directly after

13

food deprivation and amygdala was collected and incubated in 500 μl RNA later (Ambion) for 2 h at RT before being frozen at – 80 °C.

The amygdalas were thawed and transferred to new eppendorf tubes containing 200 μl of TRIzol (Invitrogen) before homogenization of the tissue using an Ultra sonificator. To avoid over-heating, the samples were sonified only a couple of seconds at a time and kept on ice in between the bursts. An additional 300 μl of TRIzol were added to the samples prior to incubation at RT for 5 min after which 100 μl of chloroform were added. The tubes were turned for 15 s, incubated 2 – 3 min at RT and then centrifuged at 13 000 × g for 20 min at 4 °C. The water phases (RNA containing) were transferred to new tubes, 500 μl of isopropanol (2-propanol (Merck)) were added and the tubes were shaken before being stored ON at – 20 °C. The tubes were centrifuged (13 000 × g for 20 min at 4 °C), the supernatant removed and the pellet washed with 500 μl room temperature 75 % EtOH before another centrifugation (13 000 × g for 10 min at 4 ºC). The supernatants were once again removed; the pellet washed with 500 μl ice cold 80 % EtOH before one more centrifugation (13 000 × g for 10 min at 4 ºC). After removal of the supernatant the pellets were allowed to dry until opaque (maximum 30 min) before being dissolved in 24 μl 1 x DNAse I buffer (Roche). The samples were stored at – 80 °C until further use.

The DNAse treatment protocols differed due to optimization; 6 samples were treated with 20 U DNAse I (Roche) for 1.5 h at 37 °C followed by enzyme termination at 75 °C for 15 min. Presence of residual DNA was estimated as described below so additional 20 U DNAse I (Roche) was added for 3 h at 37 °C followed by 75 °C for 15 min. The remaining samples were treated with 20 U DNAse I (Roche) at 17 °C for 16 h before inactivation of the enzyme at 75 °C for 15 min.

To confirm complete removal of DNA, each sample (0.5 μl), a positive control (genomic mouse DNA 5 ng/μl (0.5 μl)) and a negative control (only master mix) were analyzed using first PCR amplification (1 x buffer (Biotools B & M labs), 1,5 mM MgCl2 (Biotools B & M labs), Tween 20, 0.2 mM dNTP, 10 pmol of each primer (Beta-tubulin (Table 2)) (Invitrogen) and 0.5 U Taq Polymerase enzyme (Biotools B & M labs) ( program; 95 °C 3 min (1 time) 95 °C 30 s, 58 °C 30 s, 72 °C 45 s (35 times) and 72 °C 5 min (1 time)) and then gelelectrophoresis on a 2 % agarose gel (Agarose D1 medium EEO (Conda) dissolved in 1 x TAE (0.484 % Tris base (Sigma), 0.114 % glacial acetic acid (100 %, Merck) and 0.037 % ethylene diaminetetraacetic acid (Prolabol) in dH2O) containing EtBr (0.5 mg/ 100ml (Sigma)) for 10-20 min at 130 V. To verify presence of DNA a ladder of 100bp (Fermentas) was used since any DNA present will have a size of 513 bp.

cDNA synthesis After successful removal of all DNA the RNA concentration and purity (by measuring the quotient of 260/280 nm and 260/230 nm; since RNA has its peak at 260 nm a value lower than 2 will indicate presence of contaminants (DNA, proteins or salts)) in the samples was determined using a Nanodrop spectrophotometer (ND-1000, Thermo scientific). Using the acquired concentrations it was calculated how much template was needed to contain a total of 5 μg RNA/sample.

The RNA templates (5 μg RNA) were first incubated with 0.77 mM dNTP and 0.5 μl random hexamers (diluted to 1/6.25) for 5 min at 65 °C before being cooled on ice for at least 1 min. A second master mix; 1 x First strand (FS) buffer (Invitrogen), 10 mM dithiothreitol (DTT (Invitrogen)) and 200 U Reverse transcriptase (Invitrogen)) per sample; was added to the RNA solution and incubated first for 10 min at 25 °C, then 1 h at 37 °C before reaction termination at 95 °C for 15 min. The samples were tested for presence of cDNA via the same PCR and gelelectrophoresis protocol used for confirming removal of all genomic DNA in the DNAse step.

14

15

Real time PCR The finished cDNA products were diluted to 5 ng/μl with MQ H2O and analyzed with Real time PCR (qPCR) (Bio-Rad IQ cycler and IQ5 (optical system software v. 2.0)) using the following reaction mix per sample: 25 ng template, 1 x buffer (Biotools B & M labs), 0.2 mM dNTP (Fermentas), 4 mM MgCl2 (Biotools B & M labs), 5 pmol of each primer ( Table 3 (Invitrogen)), DMSO, SYBR® Green I nucleic acid gel stain (1:50000) (Invitrogen)and 0.4 U Taq DNA polymerase (Biotools B & M labs).To verify the results each sample was run as duplicates as well as 4 negative controls (MQ H2O) and 2 positive controls (5 ng/μl genomic mouse DNA).

The mRNA levels of 5 common housekeeping genes; glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein L19 (RPL19), histocompatibility 3b, beta-actin (Actb) and cyclophilin were first measured, of which three (GAPDH, RPL19 and Actb) were utilized to calculate a normalization factor applicable for the analyzed genes. mRNA from 15 feeding-related genes of interest, encoding fat mass and obesity associated protein, cortico- tropin-releasing hormone, enkephalin, pro-opiomelanocortin-alpha, opioid receptor, kappa 1, opioid receptor, mu 1, opioid receptor-like 1, Oxytocin, neuropeptide Y, Orexin, arginine corticotropin releasing hormone receptor 1, neuropeptide Y receptor Y1, melanin-vasopressin, concentrating hormone, melanin-concentrating hormone receptor 1, were then analyzed via qPCR.

For each qPCR analysis LinRegPCR (v. 7.5) (Ramakers et al. 2003) was utilized to calculate the primer efficiency for each duplicate, negative controls and positive controls. The efficiencies were checked for outliers using Grubb’s test (Graphpad) and a mean value for the efficiency was calculated which was applied to calculate the corrected CT (threshold value) for each sample (mean value of the duplicates). The corrected CT values from the chosen housekeeping genes were used to calculate a normalization factor for each sample via geNorm (v. 3.4) (Vandesompele et al. 2002) which were then used to calculate a normalized CT value for each sample in the gene of interest analyzes. The normalized CT values were checked for outliers using Grubb’s method (Graphpad) before statistical analysis using One-way Anova (Bonferroni post-test) in GraphPad Prism4 to check for significant differences in the expressions between the differently treated groups. To be deemed significant the P-value had to be lower than 0.05.

Table 3. Primers

Name Abbreviation Forward Reverse Ta4

Beta-tubulin1 tub b5 513bp gctcaccacgccaacctac gccgtaaactgctcagagatgc Glyceraldehyde-3-phosphate dehydrogenase2 GAPDH gccttccgtgttcctacc gcctgcttcaccaccttc 55°C Ribosomal protein L192 RPL19 aatcgccaatgccaactc ggaatggacagtcacagg 55°C Histocompatibility 3b2 H3b ccttgtgggtctgtttga cagttggatgtccttggg 55°C Cyclophilin2 Cyclo tttgggaaggtgaaagaagg acagaaggaatggtttgatgg 55°C Actin, beta2 Actb ccttcttgggtatggaatcctgtg cagcactgtgttggcatagagg 55°C Fat mass and obesity associated3 FTO gatgtcagagcgtcagagag aaggtcatggagtgagtgc 60.1°C Corticotropin releasing hormone3 CRH taccaagggaggagaagagag ggacgacagagccaccag 60.1°C Enkephalin3 ENK gaggtatggcggcttcat tcgtcattgttggtgctctc 60.1°C Pro-opiomelanocortin-alpha3 POMC gaacgccatcatcaagaac ctaagaggctagaggtcatc 58.2°C Opioid receptor, kappa 13 KOR caccttgctgatcccaaac ttcccaagtcaccgtcag 60.1°C Opioid receptor, mu 13 MOR cctgccgctcttctctgg cggactcggtaggctgtaac 60.1°C Opioid receptor-like 13 ORL1 tccgtgcccttgatgttc atcctccacttgtgctgag 58.2°C Oxytocin3 OXY acgctgcttcggaccaag gcgaaggcaggtagttctcc 60.1°C Neuropeptide Y3 NPY cccttccatgtggtgatg gacaggcagactggtggc 60.1°C Orexin3 ORX cccatcttctatccttgtcctg gaatcgtctttattgccatttacc 58.2°C Arginine vasopressin3 AVP gctcaacactacgctctc cttgggcagttctggaag 58.2°C Corticotropin releasing hormone receptor 13 CRHR agtgttagcgatgccttgg tgacttgtagggaggtggag 58.2°C Neuropeptide Y receptor Y13 NPY1R gcggcgttcaaggacaag gcagcaccaggaggagag 55.7°C Melanin-concentrating hormone3 MCH ccgcaacatccttacagaag gcacaagttatagcaacatcaag 62°C Melanin-concentrating hormone receptor 13 MCHR1 gaccctcacattcgtctacc ttcaccgacagcaccaag 61.3°C

1Used in the verification steps (DNAse and cDNA). 2 Housekeeping genes used by qPCR. 3Feeding-related genes of interest 4Annealing temperature

16

Acknowledgements I would like to thank Helgi for giving me the opportunity to work in his group. I would also like to thank the great people in Helgilab for their wonderful companionship. You guys know who you are. Thank you, Johan and Mathias for answering my never-ending questions, Pawel for your expertise on how get the most out my writing, Anna for always being there to answer my questions too irrelevant to bother a teacher with, Maria for your cheerful mood and Helena for listening to my ramblings. And last but definitely not least Fredrik for his never ending patience and faith in my abilities.

17

References Andreasen, C. H., Stender-Petersen, K. L., Mogensen, M. S., Torekov, S. S., Wegner, L., Andersen, G., Nielsen,

A: L., Albrechtsen, A., Borch-Johnsen, K., Rasmussen, S. S., Clausen, J. O., Sandbæk, A., Lauritzen, T. Hansen, L., Jørgensen, T., Pedersen, O. & Hansen, T. 2008. Low Physical Activity Accentuates the Effect of the FTO rs9939609 Polymorphism on Body Fat Accumulation. Diabetes 57:95–101

Bechtold, B. A. 2008. Energy-responsive timekeeping. J. Genet 87: 447 – 458 Boissel, S., Reish, O., Proulx, K., Kawagoe-Takaki, H., Sedgwick, B., Yeo, G. S. H., Meyre, D., Golzio, C.,

Molinari, F., Kadhom, N., Etchevers, H. C., Saudek, V., Farooqi, I. S., Froguel, P., Lindahl, T., O’Rahilly, S., Munnich, A. & Colleaux, L. 2009. Loss-of-Function Mutation in the Dioxygenase-

Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations. Am J Hum Gen 85: 106 – 111

Cecil, J. E., Tavendale, R., Watt, P., Hetherington, M. M. & Palmer, C. N. A. 2008. An obesity-associated FTO gene variant and increased energy intake in children. N Engl J Med 359: 2558 – 2566

Cha, S. W., Choi, S. M., Kim, K. S., Park, B. L., Kim, J. R., Kim : Y. & Shin H. D. 2008. Replication of Genetic Effects of FTO Polymorphisms on BMI in a Korean Population. Obes 16: 2187 – 2189

Cornes, B. K., Lind, P. A., Medland, S. E., Montgomery, G. W., Nyholt, D. R. & Martin, N. G. 2009. Replication of the association of common rs9939609 variant of FTO with increased BMI in an Australian adult twin population but no evidence for gene by environment (G × E) interaction. Int J Obes 33: 75 – 79

Dina, C., Meyre, D., Gallina, S., Durand, E., Körner, A., Jacobson, P., Carlsson, L. M. S., Kiess, W., Vatin, V., Lecoeur, C., Delplanque, J., Vaillant, E., Pattou, F., Ruiz, J., Weill, J., Levy-Marchal, C., Horber, F., Potoczna, N., Hercberg, S., Le Stunff, C., Bougnères, P., Kovacs, P., Marre, M., Balkau, B., Cauchi, S., Chèvre, J-C. & Froguel, P. 2007. Variation in the FTO contributes to childhood obesity and severe adult obesity. Nature Genet 39: 724 - 726

Frayling, T. M., Timpson, N.J., Weedon, M. N., Zeggini, E., Freathy, R. M., Lindgren, C. M., Perry, J. R. B., Elliott, K. S., Lango, H., Rayner, N. W., Shields, B., Harries, L. W., Barrett, J. C., Ellard, S., Groves, C. J., Knight, B., Patch, A-M., Ness, A. R., Ebrahim, S., Lawlor, D. A., Ring, S. M., Ben-Shlomo, Y., Jarvelin, M-J., Sovio, U., Bennett, A. J., Melzer, D., Ferrucci, L., Loos, R. J. F., Barroso, I., Wareham, N. J., Karpe, F., Owen, K. R., Cardon, L. R., Walker, M., Hitman, G. A., Palmer, C. N. A., Doney, A. S. F., Morris, A. D. & Smith, G. D. 2007. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316:889 – 893

Fredriksson, R., Hägglund, M., Olszewski, P.K., Stephansson, O., Jacobsson, J.A., Olszewska, A.M., Levine, A.S., Lindblom, J. & Schiöth, H.B. 2008. The obesity gene, FTO, is of ancient origin, up-regulated during food deprivation and expressed in neurons of feeding-related nuclei of the brain. Endocrin 149: 2062 – 2071

Gao, Q. & Horvath, T. L. 2008. Neuronal control of energy homeostasis. FEBS Letters 582:132–141 Gerken, T., Girard, C. A., Tung, Y-C. L., Webby, C. J., Saudek, V., Hewitson, K. S., Yeo, G. S. H.,

McDonough1, M. A., Cunliffe, S., McNeill, L. A., Galvanovskis, J., Rorsman, P., Robins, P., Prieur, X., Coll, A. P., Ma, M., Jovanovic, Z., Farooqi, I. S., Sedgwick, B., Barroso, I., Lindahl, T., Ponting, C. P., Ashcroft, F. M., O'Rahilly, S. & Schofield, C. J. 2007. The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 318: 1469 – 1472

González-Sánchez, J. L., Zabena, C.,Martínez-Larrad, M. T., Martínez-Calatrava, M. J., Pérez-Barba, M. & Serrano-Ríos, M. 2009. Variant rs9939609 in the FTO gene is associated with obesity in an adult population from Spain. Clin Endocrin 70: 390 – 393

Hennig, B. J., Fulford, A. J., Sirugo, G., Rayco-Solon, P., Hattersley, A. T., Frayling, T. M. & Prentice A. M. 2009. FTO gene variation and measures of body mass in an African population. BMC Med Genet 10:21 doi:10.1186/1471-2350-10-21

Hubacek, J. A., Bohuslavova, R., Kuthanova, L., Kubinova, R., Peasey, A., Pikhart, H., Marmot, M. G. & Bobak, M. 2008. The FTO Gene and Obesity in a Large Eastern European Population Sample: The HAPIEE Study. Obes 16: 2764 – 2766

Hunt, S., Stone, S., Xin, Y., Scherer, C. A., Magness, C.L., Iadanato, S.P., Hopkins, P.N. & Adams, T.D. 2008. Association of the FTO gene with BMI. Obes 16:902 – 904

Kageyama, H., Takenoya, F., Shiba, K. & Shioda, S. 2010. Neuronal circuits involving ghrelin in the hypothalamus-mediated regulation of feeding. Neuropeptides 44: 133 – 138

Kalra, S. P., Dube, M. G., Pu, S., Xu, B., Horvath, T. L. & Kalra, P. S. 1999. Interacting Appetite-Regulating Pathways in the Hypothalamic Regulation of Body Weight. Endocrin Rev 20: 68 – 100

Kalra, S. P. & Kalra, P. S. 2004. NPY and cohorts in regulating appetite, obesity and metabolic syndrome: beneficial effects of gene therapy. Neuropeptides 38:201–211

18

Karlen, Y., McNair, A., Perseguers, S., Mazza, C. & Mermod, N. 2007. Statistical significance of quantitative PCR. BMC Bioinform doi:10.1186/1471-2105-8-131

Kring, S. I., Holst, C., Zimmermann, E., Jess, T., Berentzen, T., Toubro, S., Hansen, T., Astrup, A., Pedersen, O. & Sørensen, T. I. A. 2008. FTO Gene Associated Fatness in Relation to Body Fat Distribution and Metabolic Traits throughout a Broad Range of Fatness. PLoS ONE doi:10.1371/journal.pone.0002958

Legry, V., Cottela, D., Ferrièresb, J., Arveilerc, D., Andrieuxa, N., Binghamd, A., Wagnerc, A., Ruidavetsb, J-B., Ducimetièred, P., Amouyela, P. & Meirhaeghea, A. 2009. Effect of an FTO polymorphism on fat mass, obesity, and type 2 diabetes mellitus in the French MONICA Study. Metab Clin Exp 58: 971 – 975

Loos, R. J. F & Bouchard, C. 2008. FTO: the first gene contributing to common forms of human obesity. Obes rev 9: 246 – 250

Meister, B. 2007. Neurotransmitters in key neurons of the hypothalamus that regulate feeding behavior and body weight. Physiol & Behav 92: 263–271

Olszewski, P.K., Fredriksson, R., Olszewska, A. M., Stephansson, O., Alsiö, J., Radomsla, K. J., Levine, A. S. & Schiöth, H. B. 2009. Hypothalamic FTO is associated with the regulation of energy intake not feeding reward. BMC Neuroscience doi:10.1186/14 1-2202-10-129 7

Peters, T., Ausmeier, K., Dildrop, R. & Rüther, U. 2002. The mouse Fused toes (Ft) mutation is the result of a 1.6-Mb deletion including the entire Iroquois B gene cluster. Mammal Genome 13: 186–188

Price, R. A., Li, W-D. &Zhao, H. 2008. FTO gene SNPs associated with extreme obesity in cases, controls and extremely discordant sister pairs. BMC Medic Genet doi:10.1186/1471-2350-9-4

Ramakers, C., Ruijter, J. M., Lekanne Deprez, R. H. & Moorman, A. F. M. 2003. Assumption-free analysis of quantitative real-time polymerase reaction (PCR) data. Neurosci Lett 339: 62 – 66

Rampersaud, E., Mitchell, B. D., Pollin, T. I., Fu, M., Shen, H., O’Connell, J. R., Ducharme, J. L., Hines, S., Sack, P., Naglieri, R., Shuldiner, A. R. & Snitker, S. 2008. Physical activity and the association of common FTO gene variants with body mass index and obesity. Arch Intern Med. 168:1791 – 1797

Sanchez-Pulido, L. & Andrade-Navarro, M. A. 2007. The FTO (fat mass and obesity associated) gene codes for a novel member of the non-heme dioxygenase superfamily. BMC Biochem doi:10.1186/1471-2091-8-23

Scuteri, A., Sanna, S., Chen, W-M., Uda, M., Albai, G., Strait, J., Najjar, S., Nagaraja, R., Orru´, M., Usala, G., Dei, M., Lai, S., Maschio, A., Busonero, F., Mulas, A., Ehret, G. B., Fink, A. A., Weder, A. B., Cooper, R. S., Galan, P., Chakravarti, A., Schlessinger, D., Cao, A., Lakatta, E. & Abecasis G. R. 2007. Genome-Wide Association Scan Shows Genetic Variants in the FTO Gene Are Associated with Obesity-Related Traits. PLoS Genet doi:10.1371/journal.pgen.0030115

Sheng, B. 2007. Role of dorsomedial hypothalamic neuropeptide Y in energy homeostasis. Peptides 28: 352 – 356

Sonestedt, E., Roos, C., Gullberg, B., Ericson, U., Wirfält, E. & Orho-Melander, M. 2009. Fat and carbohydrate intake modify the association between genetic variation in the FTO genotype and obesity. Am J Clin Nutr doi: 10.3945/ajcn.2009.27958

Timpson, N. J., Emmett, P. M., Frayling, T. M., Rogers, I., Hattersley, A. T., McCarthy, M. I. & Smith, G. D. 2008. The fat mass- and obesity-associated locus and dietary intake in children. Am J Clin Nutr 88: 971 – 978

Tönjes, A., Zeggini, E., Kovacs, P., Böttcher, Y., Schleinitz, D., Dietrich, K., Morris, A. P., Enigk, B., Rayner, N. W., Koriath, M., Eszlinger, M., Kemppinen, A., Prokopenko, I., Hoffmann, K., Teupser, D., Thiery, J., Krohn, K., McCarthy, M. I. & Stumvoll, M. 2009. Association of FTO variants with BMI and fat mass in the self-contained population of Sorbs in Germany. Eur J Hum Genet doi:10.1038/ejhg.2009.107

Valassi, E., Scacchi, M. & Cavagnini, F. 2008. Neuroendocrine control of food intake. Nutr, Metab & Cardiovasc Diseas 18: 158 – 168

van der Hoeven, F., Shimmang, T., Volkmann, A., Mattei, M-G., Kyewski, B. & Rüther, U. 1994. Programmed cell death is affected in the novel mouse mutant Fused toes (Ft). Development 120: 2601 – 2607

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. & Speleman, F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genom Biol doi:10.1186/gb-2002-3-7-research0034

Villalobos-Comparán, M., Flores-Dorantes, M. T., Villarreal-Molina, M. T., Rodríguez-Cruz, M., García-Ulloa, A. C., Robles, L., Huertas-Vázquez, A., Saucedo-Villarreal, N., López-Alarcón, M., Sánchez-Muñoz, F., Domínguez-López, A., Gutiérrez-Aguilar, R., Menjivar, M., Coral-Vázquez, R., Hernández-Stengele, G., Vital-Reyes, V. S., Acuña-Alonzo, V., Romero-Hidalgo, S., Ruiz-Gómez, D. G., Riaño-Barros, D., Herrera, M. F., Gómez-Pérez, F. J., Froguel, P., García-García, E., Tusié-Luna, M. T., Aguilar-Salinas, C. A. & Canizales-Quinteros, S. 2008. The FTO Gene Is Associated With Adulthood Obesity in the Mexican Population. Obes 16: 2296 – 2301

Wardle, J., Carnell, S., Haworth, C. M. A., Farooqi, I. S., O´Rahilly, S. & Plomin, R. 2008. Obesity associated genetic variation is associated with diminished satiety. J Clin Endocrin Metab 93: 3640 – 3643

19

20

Wardle, J., Llewellyn, C., Sanderson, S. & Plomin, R. 2009. The FTO gene and measured food intake in children. Intern J Obes 33: 42 – 45

Wing, M. R., Ziegler, J., Langefeld, C. D., Ng, M. C. Y., HaVner, S. M., Norris, J. M., Goodarzi , M. O. & Bowden, D. W. 2009. Analysis of FTO gene variants with measures of obesity and glucose homeostasis in the IRAS Family Study. Hum Genet 125:615 – 626