Page 1/21

Adipose-derived Mesenchymal Stem Cells canAlleviate Hypertrophic Scars and Affect theBiological Activity and Oxidative Stress-relatedFactors of Hypertrophic Scar FibroblastsShiyi Li 

The Fourth Medical Center of PLA General Hospital https://orcid.org/0000-0002-6635-8529Jinxiu Yang 

The Fourth Medical Center of PLA General HospitalMinliang Chen  ( 100756696@qq.com )

The Fourth Medical Center of PLA General Hospital

Research

Keywords: Adipose-derived mesenchymal stem cells, �broblasts, oxidative stress, hypertrophic scar

Posted Date: August 30th, 2021

DOI: https://doi.org/10.21203/rs.3.rs-810247/v1

License: This work is licensed under a Creative Commons Attribution 4.0 International License.  Read Full License

Page 2/21

AbstractBackground As a �brotic disease with a high incidence, the pathogenesis of hypertrophic scarring is stillnot fully understood, and its treatment is also very di�cult. In recent years, human adipose-derivedmesenchymal stem cells (ADSCs) have been considered an effective treatment for �brotic diseases, suchas keloids. This study mainly explores the therapeutic effect and possible mechanism of ADSCs onhypertrophic scars.

Methods After coculture, western blotting and quantitative real-time polymerase chain reaction (qRT–PCR) were used to detect gene and protein expression in hypertrophic scar �broblasts (HSFs). Flowcytometry was used to detect reactive oxygen species (ROS), and apoptosis, cell proliferation andmigration were also detected. A nude mouse animal model was established, the effects of ADSCs onhypertrophic scars were observed, and H&E staining, Masson staining and nuclear factor erythroid 2-related factor 2 (Nrf2) protein content detection were performed.

Results Our experimental results show that ADSCs can inhibit HSF proliferation and migration andpromote apoptosis. Our experimental results show that ADSCs can inhibit the proliferation and migrationof HSFs and promote apoptosis. ADSCs also increase the ROS of HSFs, reduce superoxide dismutase(SOD), NAD(P)H:quinone oxidoreductase 1 (NQO1), and heme oxygenase-1 (HO-1), and reduce theexpression of Nrf2 and BCL2. In in vivo experiments, we found that ADSCs can reduce the weight ofhypertrophic scars, rearrange collagen �bres, and signi�cantly reduce the Nrf2 content in tissues.

Conclusion ADSCs can alleviate hypertrophic scars, promote the rearrangement of collagen �bres, andaffect the biological activity of hypertrophic scar �broblasts and oxidative stress-related factors.

IntroductionHypertrophic scarring is a prevalent �broproliferative disease in plastic surgery, and the incidence can beas high as 70% in burn patients[1]. However, the mechanism of hypertrophic scar formation is not yetclear, and its prevention and treatment are relatively di�cult. It is characterized by excessive proliferationof dermal �broblasts, resulting in superabundant deposition of extracellular matrix (ECM) componentssuch as collagen[2]. Current research shows that the pathogenesis of hypertrophic scarring is related tomany signalling pathways or cytokines, such as the TGF-β/Smad pathway[3, 4], PI3K/AKT pathway[5],matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), and decorin. Manyrecent studies have con�rmed that some oxidative stress-related proteins in hypertrophic scars differfrom those in normal skin, indicating that oxidative stress may be related to hypertrophic scar formation.

Oxidative stress was proposed by Helmut in 1985. It refers to the pathological status in which the body’sexcessive production of reactive oxygen species (ROS) and/or reduced antioxidant capacity leads to alarge accumulation of ROS and related products, bringing about many toxic effects on certain cells ormolecules[6]. Intracellular ROS are derived from the mitochondrial oxidative respiratory chain for the mostpart, mainly including superoxide anion (02-), hydrogen peroxide (H202), hydroxyl (OH-), etc., which have a

Page 3/21

certain destructive effect on lipids, proteins and nucleic acids[7]. Nuclear factor erythroid 2-related factor2 (Nrf2) is the core antioxidant signal protein that can regulate the expression of a variety of antioxidantenzymes and apoptosis-related proteins, such as superoxide dismutase (SOD), NAD(P)H:quinoneoxidoreductase 1 (NQO1), heme oxygenase-1 (HO-1), and B-cell lymphoma-2 protein (Bcl2). Under normalcircumstances, Nrf2 binds to Kelch ECH associating protein 1 (KEAP1) and exists in the cytoplasm. Whenthe ROS content in the cell increases, Nrf2 quickly dissociates from KEAP1 and translocates into thenucleus, regulating the expression of related factors[8]. Oxidative stress has been con�rmed to beinvolved in the occurrence of many diseases, such as diabetes, coronary artery sclerosis, and hepatic�brosis[9-11]. Over the past few years, researchers have found that the levels of several oxidative stress-related proteins in hypertrophic scar �broblasts (HSFs) are different from those in normal skin �broblasts.In addition, although �broblasts isolated from hypertrophic scar tissue have the same spindle-shapedmorphology as normal skin �broblasts, they proliferate faster, produce more ECM and are more invasivethan normal skin �broblasts[12]. According to previous literature, many oxidative stress-related cytokineshave a certain impact on these biological activities[13]. Our previous experiments have proven thatcompared with normal skin-derived �broblasts, hypertrophic scar �broblasts have higher ROS contentand proliferate faster; moreover, the content of Nrf2 protein and some antioxidant enzymes are alsodifferent, proving that oxidative stress is closely related to the pathogenesis of hypertrophic scarring.

Adipose-derived mesenchymal stem cells (ADSCs) show prominence in the �eld of regenerative medicinebecause they can be easier to obtain and have a wide variety of sources. ADSCs are currently consideredpotential therapeutic strategies for a number of diseases, including hypertrophic scars. An increasingnumber of studies have shown that ADSCs have a signi�cant therapeutic effect on hypertrophic scars[14,15]; however, the speci�c mechanism is not clear. It has been con�rmed that this kind of effect may berelated to the TGF-β/Smad pathway, p38/MAPK pathway, etc[16, 17]. Based on this research background,this article mainly discusses whether the therapeutic effect of ADSCs on hypertrophic scars is related tooxidative stress.

Methods

ADSCs isolation and cultivationHuman adipose tissue was obtained from patients who had undergone lipoplasty, and all enrolledpatients signed the informed consent form. The liposuction sites were bilateral thighs and buttocks. Theadipose tissue was rinsed three times with phosphate-buffered saline (PBS, Solarbio, Beijing,China), and then 0.1% type I collagenase (Sigma–Aldrich, St. Louis, MO, USA) was used to digest theadipose tissue for 50 minutes. Centrifuge and �lter the mixture after terminating the digestion to obtainADSCs. ADSCs were cultured in Dulbecco's modi�ed Eagle’s medium:F-12 (DMEM/F-12, GibcoBRL, NY, USA) containing 10% foetal bovine serum (FBS, Gibco BRL, NY, USA) and 1%penicillin/streptomycin (Solarbio, Beijing, China) at 37 °C in 5% carbon dioxide (CO2). The medium was

Page 4/21

changed every 2 days. Subculture was performed when the cell fusion rate reached 80%-90%. Cells atpassage 4 were used in this experiment.

Flow Cytometry to identify cell surface markersADSCs were collected and washed three times in PBS and then resuspended in PBS containing 1% bovineserum albumin (BSA, Invitrogen, CA, USA). The cell suspension was incubated with �uoresceinisothiocyanate (FITC)-conjugated antibodies against CD90, phycoerythrin (PE)-conjugated antibodiesagainst CD105, CD34, CD31, CD45, and Brilliant Violet421 (BV421)-conjugated antibodies against CD73at 4 °C for 30 min in the dark, washed twice, resuspended in 2% BSA and detected by �ow cytometry (BDBiosciences, CA, USA).

Adipogenic and osteogenic differentiationADSCs were inoculated in 6-well plates (Corning, NY, USA) (cell concentration of 2×105/well) until thecon�uence of cells reached 80%-90%. Adipogenic differentiation was proceeded using basic medium Acontaining 10% FBS, 1% penicillin-streptomycin, 1% glutamine, 0.2% insulin, 0.1% 3-isobutyl-1-methylxanthine (IBMX), 0.1% rosiglitazone, and 0.1% dexamethasone for 3 days and basic medium B containing10% FBS, 1% penicillin-streptomycin, 1% glutamine, and 0.2% insulin for 1 day, and they alternated 4times (Cyagen Bioscience, Inc., China, HUXMD-90031). Osteogenic differentiation was proceeded usingbasic medium containing 10% FBS, 1% penicillin-streptomycin, 1% glutamine, 0.2% ascorbate, 1% β-glycerophosphate, and 0.01% dexamethasone for 3 weeks (Cyagen Bioscience, Inc., China, HUXMD-90021).

At the end of induction, 4% paraformaldehyde (Solarbio, Beijing, China) was used to immobilize the cellsfor 30 min, and Oil Red O and Alizarin Red S dye solutions were used to assess adipogenic andosteogenic differentiation, respectively. The cells were observed under a microscope (Olympus, Tokyo,Japan) after staining.

Chondrogenic differentiationADSCs were harvested and resuspended in a centrifuge tube in basic medium containing 0.3% ascorbate,0.01% dexamethasone, 1% insulin ferro-selenium transporter (ITS) supplement, 0.1% sodium pyruvate,0.1% proline and 1% transforming growth factor-β3 (TGF-β3) (4×105/tube). The cells were cultured at 37°C in 5% CO2 for 21 days (Cyagen Bioscience, Inc., China, HUXMD-90041).

After induction, 4% paraformaldehyde was used to immobilize the cartilage balls for 30 min, and Alcianblue staining was used to assess chondrogenic differentiation. The sections were examined undermicroscope.

Page 5/21

HSFs isolation and cultivationHypertrophic scar samples were obtained from patients who had undergone plastic surgery (Departmentof Burn and Plastic Surgery, the Fourth Medical Center, Chinese PLA (People’s Liberation Army) GeneralHospital. Finally, a total of 8 samples were collected, including 5 males and 3 females with an averageage of 35.0±11.7 years. Dermal tissues were washed 3 times with PBS and then minced into pieces (~1mm). Pieces were explanted in Dulbecco's modi�ed Eagle’s medium (DMEM, Gibco BRL, NY, USA)containing 10% FBS and 1% penicillin/streptomycin at 37 °C in 5% CO2. Subculture was performed whenthe cell fusion rate reached 80%-90%. Cells at passage 4 were used in this experiment.

Establish indirect co-cultivation systemHSFs were resuspended in DMEM/F-12 and inoculated into the lower chamberof a Transwell coculture plate (Corning, NY, USA, 3422/3450). ADSCs were resuspended in DMEM/F-12and inoculated into the upper chamber of the plate. Only the same amount of medium was added to theupper chamber in the blank group. In general, the ratios of ADSCs and HSFs in coculture were 0:1, 0.5:1,1:1 and 2:1.

Cell proliferation and migrationHSFs were collected after culture with ADSCs for 24 h, 48 h and 72 h. Subsequent steps were performedaccording to the instructions supplied with the Cell Counting Kit-8 (Beyotime Biotechnology, Shanghai,China), and the absorbance at 450 nm was measured with an enzyme immunoassay analyser (BioRad680, Hercules, USA).

The migration property was evaluated by scratch assay. HSFs were cultured in a six-well plate, and when90% con�uence was reached, the cells were scratched with a

pipet tip through the well bottom centre. Additionally, ADSCs were added to the upper chamber of theplate as previously described. Images were taken using a microscope (Olympus, Tokyo, Japan) every 24h. ImageJ software was used to measure the area and length of the scratches to calculate the averagewidth of the scratches. The migration rate of the scratch was calculated as follows: migration rate (%)= (W0 − Wt)/W0 × 100%, where W0 is the original width and Wt is the remaining width at the measuredtime point.

Cell apoptosisCell apoptosis was detected by an Annexin V FITC PI Apoptosis Kit (BD Biosciences, CA, USA). After 48h of coculture, the HSFs were collected and resuspended in a �ow tube with 1× Annexin V binding buffer,

Page 6/21

and Annexin V FITC and PI were added according to the instructions. After incubation for 15 min, cellswere detected by �ow cytometry.

ROS evaluationAfter 48 h of coculture, HSFs were washed with PBS and incubated with 2,7-dichlorodihydro�uoresceindiacetate (DCFH-DA) in a cell incubator (37 °C in 5% CO2, 30 min) according to the instructions providedby the Reactive Oxygen Species Assay Kit (Beyotime Biotechnology, Shanghai, China). The cells wereincubated with Rosup as a positive control, and the probe was omitted as a negative control. ROS weredetected by �ow cytometry.

Total- superoxide dismutase(T-SOD) activityA T-SOD assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) was used to detect the T-SOD activity of HSFs after 48 h of coculture based on the autooxidation of hydroxylamine. Allprocedures were carried out according to the instructions, and the developed colour was measured at 550nm using an enzyme immunoassay analyser.

Quantitative real-time polymerase chain reaction (qRT–PCR)Brie�y, total RNA was extracted from HSFs after 48 h of coculture with ADSCs using TRIzol (Invitrogen,Carlsbad, CA, USA), and RNA purity was evaluated by calculating the A260/A280 ratio between values of1.8 and 2.0. The isolated RNA was reverse transcribed into complementary DNA using the Prime Script RTReagent kit (TaKaRa, Tokyo, Japan). Primers were obtained from Takara Biotechnology. Quantitative PCRwas performed using the CFX96TM real-time system (Bio–Rad, Hercules, CA, USA) using SYBR Premix ExTaq II (Takara, China) in a 12 μl PCR solution. The primer pairs used for gene ampli�cation were asfollows: Nrf2: forward GTATGCAACAGGACATTGAGCAAG, reverse TGGAACCATGGTAGTCTCAACCAG,Keap1: forward CATCGGCATCGCCAACTTC, reverse ACCAGTTGGCAGTGGGACAG, NQO1: forwardGGATTGGACCGAGCTGGAA, reverse GAAACACCCAGCCGTCAGCTA, GAPDH: forwardGCACCGTCAAGGCTGAGAAC, reverse TGGTGAAGACGCCAGTGGA. The results were normalized againstthe mean Ct values for GAPDH using the ΔCt method as follows: ΔCt = Ct gene of interest - mean Ct(GAPDH). The fold increase was calculated as 2-ΔΔCt.

Western BlotTotal protein was extracted using RIPA buffer with a total protease phosphatase inhibitor mix (Solarbio,Beijing, China). Samples (60 μg protein) were separated on 10% SDS–PAGE gels and transferred to a

Page 7/21

polyvinylidene �uoride membrane, blocked with 5% nonfat dried milk in TBST (10 mmol/L Tris, pH7.5; 150 mmol/L NaCl, 0.05% Tween-20), incubated with primary antibodies including anti-Nrf2 (mouse,1:2000, Santa Cruz Biotechnology, CA, USA), anti-HO-1 (rabbit, 1:1000), anti-Bcl2 (rabbit, 1:1000), anti-BAX (rabbit, 1:1000), and anti-β-tubulin (rabbit, 1:1000) (Proteintech, Wuhan, China) at 4 °C overnight.After washing with TBST, the membranes were incubated with horseradish peroxidase-conjugatedgoat anti-rabbit or anti-mouse secondary antibodies (EpiZyme Biotech, Shanghai, China). Theimmunoreactive bands were developed using an ECL kit (Thermo Fisher Scienti�c, Waltham, MA,USA), and exposure was conducted with the Bio–Rad Molecular Imager Gel Doc TM XR+ (Bio–Rad,Hercules, CA, USA). ImageJ software was used to process and analyse the images.

Immuno�uorescence stainingThe cells were inoculated onto a sliver that was placed in the lower chamber of theTranswell coculture plate. After 48 h of coculture, the plates were depara�nized in xylene and rehydratedin graded ethanol. After incubation in a 70 °C water bath with citrate repair solution (pH = 6.0), the plateswere incubated with 5% goat serum for 2 h and then with primary anti-Nrf2 (1:50, Santa CruzBiotechnology, CA, USA) overnight at 4 °C. After that, the plates were washed three times with PBS andthen incubated with goat anti-mouse IgG-Cy3 (1:100, Bioss, Beijing, China) for 2 h at room temperature.Nuclei were stained with DAPI (Thermo Fisher Scienti�c, Waltham, MA, USA). The sliver wasremoved from the plate and placed on the slide, and the sliver was sealed with gum. Fluorescence imageswere visualized with confocal microscopy (Leica, Germany).

Animal experimentSix female BALB/c nude mice (6–8 weeks old) were used in this study. Animals were obtained from SPFBiotechnology (Beijing, China) and maintained in the animal facility of the Fourth Medical Center, ChinesePLA General Hospital. Hypertrophic scar tissue sources are described above. All experimental procedureswere performed

following the regulations of the Institutional Animal Care and Use Committee. Scar tissues were washedin PBS and divided into multiple small specimens weighing 0.2 g, with all the skin layers retained. Afterroutine disinfection and anaesthesia, four 1 cm incisions were made in the back skin of each mouse withscissors. The scar tissue fragments were implanted subcutaneously after pockets were created by bluntdissection. The wound was sutured with 5–0 nylon thread and left exposed. The sutures will be removedafter a week. Two weeks after transplantation, four hypertrophic scar tissue patches on the back of eachmouse were treated in four different ways: A group, blank control, no treatment; B group, negative control,0.2 ml DMEM/F-12; C group, ADSCs group,0.2 ml ADSCs (resuspended in DMEM/F-12, cell concentrationis 1×107/ml); D group, positive control, 0.2 ml triamcinolone acetonide (triamcinolone suspendedinjection, 40 mg/mL, per vial; Ji Da Chemical & Pharmaceutical Co, Kunming, China). Two weeks later, the

Page 8/21

injection was repeated, and four weeks later, all the tissue pieces were collected and weighed. In the end,six pieces of hypertrophic scar tissue were collected from each group.

Histological AnalysisSamples from each group were bisected and immediately �xed in 10% formalin. Subsequently, thesamples were embedded in para�n sections and routinely stained with haematoxylin-eosin (H&E) andMasson trichrome reagent. Sections were observed and photographed under a microscope(Olympus, Tokyo, Japan).

Nrf2 protein contentAfter cutting the sample into small pieces with scissors, the remaining steps were the same as describedabove.

Statistical analysisAll the results were expressed as the mean ± SEM. Comparisons between the two groups were madeusing unpaired Student’s t test. For more than two groups, one-way ANOVA with S-N-K post hoc test wasused. P < 0.05 was considered statistically signi�cant. Statistical analyses were performed usingGraphPad Prism 8.0 software. (*P<0.05, **P<0.01, ***P<0.001)

Results

Characterization of ADSCsUnder the microscope, the cells were spindle-shaped. We detected the expression of cell surface markersin the extracted ADSCs, and it was found that the surface marker CD105(99.85%), CD90(99.68%),CD73(98.73%) of the mesenchymal stem cells was highly positive, while the haematopoietic stem cellsurface markers CD34(4.77%), CD31(0.45%), CD45(0.47%)were negatively expressed (Fig. 1a). Themultipotential differentiation capacity of ADSCs was examined using adipogenic, osteogenic andchondrogenic assays. After 21 days of culture, the oil red O stain showed distinct red lipid droplets, andthe alizarin red stain showed obvious orange calcium deposits and calci�ed nodules. Endoacidmucopolysaccharides were stained blue in cartilage globules, as shown by Alcian blue staining (Fig. 1b).All these features were consistent with the �ndings of previous studies, which suggests that wesuccessfully isolated ADSCs.

ADSCs inhibit HSFs proliferation and migration

Page 9/21

After coculture, HSF proliferation was signi�cantly inhibited, with only a small amount of proliferationduring 0–772 h, while cells in the control group proliferated signi�cantly during 0–448 h. Even though theproliferation rate was reduced during 48–772 h, the proliferation rate was still higher than that in thecoculture group. There was a statistically signi�cant difference in the number of cells between the fourgroups at 48 h and 72 h (48 h: F = 15.093, P < 0.01, 72: F = 27.375, P < 0.001), but there was nostatistically signi�cant difference between the three coculture groups (Fig. 2a).

The migration ability of the cells was signi�cantly inhibited after culture with ADSCs compared with thecontrol group. The migration rate of the four groups was different at 24 h and 48 h, which wasstatistically signi�cant(24 h: F = 28.447,P < 0.001, 48 h: F = 103.740,P < 0.001).Among co-cultured groups,the migration rate of 0.5:1 group was slightly higher than that of the other two groups, and the differencebetween the three groups was statistically signi�cant(F = 11.151,P < 0.05) (Fig. 2b,c).

ADSCs promote HSFs apoptosisThe apoptosis rate of HSFs was signi�cantly elevated after culture with ADSCs for 48 h compared withthe control group [0.5:1: (4.58%±0.42%), 1:1: (4.48%±0.35%), 2:1: (5.04%±0.67%) versus control (2.45%±0.45%), F = 31.693, P < 0.001]; however, there was no statistically signi�cant difference among the threecoculture groups (Fig. 3ab).

ADSCs increase the accumulation of ROS of HSFsIntracellular ROS generation is a marker of oxidative stress, which can lead to apoptosis. Theaccumulation of ROS in HSFs after culture with ADSCs for 48 h was increased compared with that in thecontrol group [0.5:1: (41.88%±4.97%), 1:1: (56.98%±5.17%), 2:1: (61.42%±4.04%) versus control (26.02%±3.69%), F = 13.921, P < 0.01]. Among the three coculture groups, the ROS content in the 0.5:1 group waslower than that in the other two groups (F = 13.921, P < 0.01), and there was no statistical signi�cancebetween the 1:1 group and the 2:1 group (Fig. 3c).

ADSCs reduces the activity of T-SOD in HSFsSOD is an important antioxidant enzyme that can remove many kinds of ROS. As expected, the activity ofT-SOD in HSFs after culture with ADSCs was decreased [0.5:1: (32.44 ± 0.95) u/ml, 1:1: (18.40 ± 2.39)u/ml, 2:1: (17.02 ± 1.12) u/ml versus control (38.11 ± 0.55) u/ml, F = 212.977, P < 0.001]. Among them, thedecrease was more obvious in groups 1:1 and 2:1 than in group 0.5:1, but there was no signi�cantdifference between groups 1:1 and 2:1 (Fig. 3d).

ADSCs reduce oxidative stress-related gene expression inHSFsKEAP1/Nrf2 has been proven to regulate the gene expression of many antioxidant enzymes and affectthe expression of some apoptosis-related genes. As shown in Fig. 4a, KEAP1, Nrf2 and NQO1 geneexpression was evaluated. The expression of the KEAP1 gene decreased after coculture, but there was

Page 10/21

only a statistically signi�cant difference between the 1:1 group and the control group (P < 0.01).Compared with the control group, Nrf2 and NQO1 gene expression was signi�cantly decreased.

ADSCs reduce oxidative stress-related protein expression inHSFsNrf2, Bcl2, BAX and HO-1 protein levels were examined by Western blot. As shown in Fig. 4b,c, there weresigni�cant differences between the control

group and different concentrations of ADSCs coculture group for Nrf2, Bcl2, BAX and HO-1 proteinexpression. Furthermore, there was no concentration-dependent change in the corresponding proteins inHSFs cultured with ADSCs.

ADSCs reduce Nrf2 protein content in nucleusThe expression and distribution of Nrf2 in cells were detected by immuno�uorescence staining. Nrf2 isdyed red and the nucleus is dyed blue. Obviously, it was observed that the content of Nrf2 in the nucleusof the control group was the most abundant, while the content of the other three groups was relativelylow (Fig. 4d).

Hypertrophic scar tissues weightFour weeks after transplantation and treatment, the tissue mass was weighed and calculated as apercentage of the original weight. Natural degradation of the hypertrophic scar was observed in group A,and the weight of each group was reduced to A (72.00%±2.45%), B (70.34%±2.25%), C (63.75%±3.50%),and D (60.86%±4.81%). There was no signi�cant difference between group A and group B. There was asigni�cant difference between group A and group C (P < 0.01), and there was also a signi�cant differencebetween group A and group D (P < 0.001). However, no signi�cant difference was observed betweengroup C and group D (Fig. 5b).

Histological changesThe dermis of the four groups was thick, and the dermis was rich in collagen �bres. In group A and groupB, the collagen �bres were arranged disorderly, mostly in swirled, and nodular structures. In addition, alarge amount of in�ammatory cell in�ltration was observed in group B, which also existed in group C. Thecollagen �bres in group C were arranged in an orderly manner, with a regular direction and a cable shape,and gaps between the collagen �bres were observed. In group D, the collagen �bres were loosely arrangedand uniformly cable-like, and the gaps between the collagen �bres were more obvious (Fig. 5c).

Nrf2 protein content decreased after ADSCs injectionWestern blot analysis showed that the Nrf2 protein content decreased after ADSC injection, and thedifference was statistically signi�cant compared with that in group A (*P < 0.05). (Fig. 5d,e).

Discussion

Page 11/21

The incidence of hypertrophic scars is particularly high, especially after burns and trauma. For patients,scar contracture, deformity, dysfunction and accompanying itching are the biggest obstacles that hindertheir return to society and build up con�dence in life. Although researchers have explored thepathogenesis of hypertrophic scars for decades, it remains unclear. It has been con�rmed that manyfactors in the process of wound healing may be involved, such as the PI3K/AKT pathway, vascularendothelial growth factor (VEGF), matrix metalloproteinases (MMPs) and tissue inhibitors ofmetalloproteinases (TIMPs). The most important factor is the TGF-β/Smad pathway, which regulates theprocess of �brosis [4, 18].

Oxidative stress may affect the process of �brosis. Our previous study found that ROS in hypertrophicscar �broblasts was higher than that in normal skin �broblasts, while Nrf2 and Bcl2 proteins were lower,which is similar to the results of Lee et al.'s study in keloids[19], who also demonstrated that Nrf2 canaffect Bcl2 expression. Studies have shown that ROS, such as hydrogen peroxide, can activate the TGF-β/Smad pathway[20], which may be one of the pathogeneses of hypertrophic scars. In addition, previousresearchers have examined the expression of 25 antioxidant enzymes during the process of hypertrophicscar formation in pigs, including catalase and glutathione s-transferase, and found that from the time ofwound healing to the formation of hypertrophic scars, the expression levels of 25 enzymes were all lowerthan those of the control group[21].

Existing treatments include surgical resection, lasers, cryotherapy, etc., with different therapeutic effectsand side effects to be solved. In recent years, with the deepening of the research on mesenchymal stemcells, some researchers have applied adipose stem cells to the treatment of hypertrophic scars and foundthat adipose stem cells can make scars thin and light and promote the remodelling and rearrangement ofcollagen[22]. The mechanism may be that ADSCs affect some signalling pathways related to �brosis,such as the TGF-β/Smad pathway and p38/MAPK pathway, and the concrete mechanism still needs tobe explored.

We successfully extracted and cultured human ADSCs. According to previous studies[23], ADSCs shouldcoexpress several mesenchymal markers. After identi�cation, it was found that the surface markers ofmesenchymal stem cells, such as CD105, CD90, and CD73, were highly expressed, while other cellmarkers, such as CD45, CD31, and CD34, were negative. In addition, ADSCs also have adipogenic,osteogenic and chondrogenic differentiation abilities, which is consistent with previous studies.

HSFs are characterized by rapid proliferation and strong migration capacity. In our study, after cocultureat different concentrations, ADSCs signi�cantly inhibited the proliferation and migration of HSFs, asshown in Fig. 2, and at the same time, cell apoptosis was increased. The effect of ADSCs on biologicalactivity may be related to the effect of ADSCs on the JNK signalling pathway[24]. It is well known thatincreased accumulation of ROS can lead to apoptosis[25]. Flow cytometry was used to detect the ROScontent in the cells after coculture. Unsurprisingly, the ROS content in the coculture groups wassigni�cantly higher than that in the control group. We also tested the levels of various antioxidant

Page 12/21

enzymes using different methods, including T-SOD, HO-1 and NQO1, and found that T-SOD activity andthe contents of HO-1 and NQO1 decreased.

In fact, studies have shown that ADSCs promote the biological activity of �broblasts derived from normalskin tissue[26], which was in contrast to our results. Similar results were found in keloid studies[24]. Wethink that the reasons for this phenomenon may be related to the distinct expression of proliferation-,migration- and apoptosis-related genes in different organizational sources of �broblasts. Abnormal geneexpression levels may have different responses to ADSCs, leading to changes in the expression of othersignalling pathways and ultimately affecting biological activity. In addition, the medium and additivesrequired for cell culture, the concentration of cells cocultured, and the source of specimens may alsoaffect the results.

As mentioned above, the expression of antioxidant enzymes and some apoptosis-related proteins, suchas Bcl2, are regulated by Nrf2[27]. qRT–PCR and Western blotting were used to detect the expression ofNrf2, and it was found that the expression of Nrf2 in the coculture groups was signi�cantly decreased,and the difference was statistically signi�cant. The content of Bcl2 was also detected by Western blot,and the results showed that the content of Bcl2 decreased while the content of Bax increased, which wasconsistent with the results of apoptosis detection.

Nrf2 binds to KEAP1 in the cytoplasm under normal conditions. During intracellular ROS accumulation,Nrf2 dissociates from KEAP1 and is transferred to the nucleus to regulate the expression of antioxidantenzymes or apoptosis-related proteins. Therefore, immuno�uorescence was used to detect the content ofNrf2 protein in the nucleus, and as shown in Fig. 4, the expression of Nrf2 protein in the nucleus wassigni�cantly decreased after coculture. We speculated that this might be related to the reduction in thetotal Nrf2 content. From what has been discussed above, we believe that ADSCs can reduce Nrf2expression in HSFs in a certain way, thus affecting the expression of many antioxidant enzymes and Bcl2and leading to ROS accumulation and activation of apoptosis. This method may be achieved throughexosomes, but it still needs to be proven by a large number of experiments.

In recent years, many researchers have found that ADSCs have therapeutic effects on hypertrophic scars.Our team also conducted experiments to verify this. Compared with other animal models, transplantinghuman hypertrophic scars into the subcutaneous skin of nude mice can better re�ect changes in humantissue. After 4 weeks of treatment, we were not surprised to �nd that the weight of hypertrophic scartissue after ADSC injection was reduced and that histopathological staining showed a looserarrangement of collagen �bres, which was consistent with the literature. Additionally, we extracted thetotal protein of the tissue to detect the content of Nrf2 and found that the content of Nrf2 was alsodecreased compared with the control group, which means that the therapeutic effect of ADSCs may berelated to Nrf2.

In conclusion, in vitro studies have shown that ADSCs are indeed effective in hypertrophic scars byreducing scar weight and promoting collagen �bre remodelling and rearrangement. In vivo experimentsshowed that ADSCs inhibited the biological activity of HSFs and promoted apoptosis. In addition, ADSCs

Page 13/21

also reduced the protein expression of Nrf2 and a variety of antioxidant enzymes in HSFs, resulting inROS accumulation.

ConclusionOur experiments revealed the therapeutic effects of ADSCs on hypertrophic scars and found that ADSCscan downregulate the expression of Nrf2 in HSFs and reduce its entry into the nucleus, resulting in areduction in the expression of antioxidant enzymes and Bcl2 and ultimately leading to intracellular ROSaccumulation and activation of the apoptosis program. Moreover, ADSCs inhibit the biological activity ofHSFs, which may be one of the mechanisms of ADSCs in the treatment of hypertrophic scars.

Declarations

Ethics approval and consent to participateEthical approval was given by the Medical Ethics Committee of the Fourth Medical Center of Chinese PLAGeneral (2019KY013-HS001). We also received informed

consent from the patients.

Consent for publicationNot applicable.

Availability of data and materialsSupporting data can be obtained from the corresponding author.

Competing intereststThe authors declare that they have no competing interests.

FundingThis study was funded by the National Natural Science Foundation of China (Grant No. 81772085 andNo. 82072176) and the Military Medicine Innovation Program of Chinese PLA General Hospital (Grant No.CX19012). The funders had no role in the study design, data collection and analysis, decision to publish,or preparation of the manuscript.

Page 14/21

Authors’ contributionsSL and JY performed all experiments and analyzed data. SL and MC wrote the paper. JY and MCsupervised the study. All authors read and approved the �nal manuscript.

Acknowledgements We thank the staff who provided us with the samples of human adipose and hypertrophic scar tissue.

References1. Bombaro KM, et al. What is the prevalence of hypertrophic scarring following burns? Burns.

2003;29(4):299–302.

2. Lee HJ, Jang YJ. Recent Understandings of Biology, Prophylaxis and Treatment Strategies forHypertrophic Scars and Keloids. Int J Mol Sci, 2018. 19(3).

3. Yang JH, et al. Expression of in�ammatory and �brogenetic markers in acne hypertrophic scarformation: focusing on role of TGF-β and IGF-1R. Arch Dermatol Res. 2018;310(8):665–73.

4. Nong X, et al. Effect of artesunate and relation with TGF-β1 and SMAD3 signaling on experimentalhypertrophic scar model in rabbit ear. Arch Dermatol Res. 2019;311(10):761–72.

5. An G, et al. Upregulation of microRNA-205 suppresses vascular endothelial growth factor expression-mediated PI3K/Akt signaling transduction in human keloid �broblasts. Exp Biol Med (Maywood).2017;242(3):275–85.

�. Sies H. Oxidative stress: a concept in redox biology and medicine. Redox Biol. 2015;4:180–3.

7. Larosa V, Remacle C. Insights into the respiratory chain and oxidative stress. Biosci Rep, 2018. 38(5).

�. Kensler TW, Wakabayashi N, Biswal S. Cell survival responses to environmental stresses via theKeap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 2007;47:89–116.

9. Tu W, et al. The Anti-In�ammatory and Anti-Oxidant Mechanisms of the Keap1/Nrf2/ARE SignalingPathway in Chronic Diseases. Aging Dis. 2019;10(3):637–51.

10. Rehman K, Akash MSH. Mechanism of Generation of Oxidative Stress and Pathophysiology of Type2 Diabetes Mellitus: How Are They Interlinked? J Cell Biochem. 2017;118(11):3577–85.

11. Wojcik KM, et al. NFE2L2 is associated with NQO1 expression and low stage of hepatic �brosis inpatients with chronic hepatitis C. Adv Clin Exp Med; 2019.

12. Ogawa R. Keloid and Hypertrophic Scars Are the Result of Chronic In�ammation in the ReticularDermis. Int J Mol Sci, 2017. 18(3).

13. Huang K, Gao X, Wei W. The crosstalk between Sirt1 and Keap1/Nrf2/ARE anti-oxidative pathwayforms a positive feedback loop to inhibit FN and TGF-β1 expressions in rat glomerular mesangialcells. Exp Cell Res. 2017;361(1):63–72.

Page 15/21

14. Zhang C, et al. Combination of lyophilized adipose-derived stem cell concentrated conditionedmedium and polysaccharide hydrogel in the inhibition of hypertrophic scarring. Stem Cell Res Ther.2021;12(1):23.

15. Li Y, et al., Exosomes derived from human adipose mesenchymal stem cells attenuate hypertrophicscar �brosis by miR-192-5p/IL-17RA/Smad axis. Stem Cell Res Ther, 2021. 12(1): p. 221.

1�. Zhang Q, et al. Intralesional injection of adipose-derived stem cells reduces hypertrophic scarring in arabbit ear model. Stem Cell Res Ther. 2015;6(1):145.

17. Chai CY, et al. Adipose tissue-derived stem cells inhibit hypertrophic scar (HS) �brosis via p38/MAPKpathway. J Cell Biochem. 2019;120(3):4057–64.

1�. Le AD, et al. Elevated vascular endothelial growth factor in keloids: relevance to tissue �brosis. CellsTissues Organs. 2004;176(1–3):87–94.

19. Lee YJ, et al. Oxidative Damage and Nuclear Factor Erythroid 2-Related Factor 2 Protein Expressionin Normal Skin and Keloid Tissue. Ann Dermatol. 2015;27(5):507–16.

20. Cruz I-DL. M.C., et al., Hydrogen peroxide increases extracellular matrix mRNA through TGF-beta inhuman mesangial cells. Kidney Int. 2001;59(1):87–95.

21. Carney BC, et al. Reactive Oxygen Species Scavenging Potential Contributes to Hypertrophic ScarFormation. J Surg Res. 2019;244:312–23.

22. Chen J, et al. The Effect of Chyle Fat Injection on Human Hypertrophic Scars in an Animal Model: ANew Strategy for the Treatment of Hypertrophic Scars. Ann Plast Surg. 2019;82(6):622–7.

23. Chen J, et al. Chyle Fat-Derived Stem Cells Conditioned Medium Inhibits Hypertrophic Scar FibroblastActivity. Ann Plast Surg. 2019;83(3):271–7.

24. Wang X, et al. Human adipose-derived stem cells inhibit bioactivity of keloid �broblasts. Stem CellRes Ther. 2018;9(1):40.

25. Simon HU, Haj-Yehia A, Levi-Schaffer F. Role of reactive oxygen species (ROS) in apoptosisinduction. Apoptosis. 2000;5(5):415–8.

2�. Lee SH, et al. Paracrine effects of adipose-derived stem cells on keratinocytes and dermal�broblasts. Ann Dermatol. 2012;24(2):136–43.

27. Niture SK, Jaiswal AK. Nrf2 protein up-regulates antiapoptotic protein Bcl-2 and prevents cellularapoptosis. J Biol Chem. 2012;287(13):9873–86.

Figures

Page 16/21

Figure 1

Characterization of human adipose-derived mesenchymal stem cells (ADSCs). a. Flow cytometriccharacterization of ADSCs. CD105, CD90 and CD73 were positive, while CD34, CD31 and CD45 werenegatively expressed. b. The cells are capable of adipogenic (left), osteogenic (middle), and chondrogenic(right) differentiation, scale bar = 50 μm, 100 μm, respectively.

Page 17/21

Figure 2

a. ADSCs inhibit HSFs proliferation. Cell proliferation was detected by CCK-8 assay for 72 hours. n=3,**P<0.01, ***P<0.001.b. ADSCs inhibited HSF migration, scale bar =200 μm c. The migration rate of thefour groups. n=3, ***P<0.001.

Page 18/21

Figure 3

a. Apoptosis was detected by �ow cytometry after coculture for 48 h. b. ADSCs promoted HSF apoptosis,n = 3. c. After 48 h of coculture, the ROS content increased signi�cantly. n = 3. d. ADSCs reduced theactivity of T-SOD in HSFs, *P<0.05, **P<0.01, ***P<0.001, versus control.

Page 19/21

Figure 4

a. qRT–PCR analysis of oxidative stress factors in HSFs cocultured with ADSCs. The graph represents theexpression of Keap1, Nrf2, and NQO1 relative to that of GAPDH, n = 3, *P<0.05, **P<0.01, versus control.b,c. Western blot analysis of Nrf2, Bcl2, HO-1 and BAX in HSFs stimulated with ADSCs. Graphs show therelative band density of β-tubulin. The data are shown as the mean ± SEM, n = 3, *P<0.05, **P<0.01,

Page 20/21

versus control. d. Nrf2 proteins in HSFs were examined by immuno�uorescence staining; scale bar = 50 μm.

Figure 5

a. The picture represents the process of animal model building. b. The bar chart shows the weight aftertreatment as a percentage of the original weight, n = 6, **P<0.01, ***P<0.001, versus A. c. Representativeimages showing the histopathological change and collagen deposition determined by H&E and Masson’s

Page 21/21

trichrome, scale bar = 100 μm and 50 μm, respectively. d,e. Western blot analysis of Nrf2. Graphs show theband density relative to β-tubulin. The data are shown as the mean ± SEM, n = 3, *P<0.05, **P<0.01,versus control.