Plant Molecular Biology 28: 569-574, 1995. © 1995 Kluwer Academic Publishers. Printed in Belgium. 569

Short communication

Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia

Ulrich Klahre, Maja Hemmings-Mieszczak and Witold Filipowicz *

Friedrich Miescher-Institut, P.O. Box 2543, 4002 Basel Switzerland (*author for correspondence)

Received 30 January 1995; accepted in revised form 22 March 1995

Key words: chloroplasts, introns, mRNA processing, plant genes, polyadenylation, RNA-binding proteins

A b s t r a c t

We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP- RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP- RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping ofN. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plum- baginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event ocurring in this intron.

The mechanism of 3'-end cleavage and polyade- nylation of mammalian pre-mRNAs is relatively well established, and several protein components involved in this process have been characterised in great detail (reviewed in [26, 31 ]). In contrast, much less is known about these reactions in plant cells (reviewed in [14, 31]). Sequences related to the conserved hexamer motif AAUAAA, known to be required for the 3'-end processing in mam- malian cells, are important also in some cases in plants [28, 32]. However, in plants the AAU-

AAA-like motifs are usually less conserved or absent [6, 14, 15, 27] and it might be due to this low conservation of the AAUAAA element that polyadenylation frequently occurs at multiple sites [2, 5, 6, 14, 20, 25, 29]. Sequences which help, in addition to AAUAAA motifs, to define polyade- nylation sites also differ between mammals and plants. While in mammals these accessory sig- nals, GU- or U-rich, are usually positioned downstream of the cleavage site [26, 31], in plants they are frequently located upstream; their se-

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X65118 (CP-RBP30) and X65117 (CP-RBP31).

570

quences are not well defined [ 14, 22, 23, 27, 28, 321.

We have previously characterized cDNA clones in Nicotiana plumbaginifolia encoding two RNA-binding proteins, CP-RBP30 and CP- RBP31, that are targeted to chloroplasts [21]. Each of the CP-RBP proteins contains two ca. 90 amino acid long RNA-binding domains, known as RNP-CS, RRM or RNP80 motifs, that are found in many different proteins which interact with RNA [3, 16]. The CP-RBP proteins are members of a growing group of plant nuclear- encoded RNA binding proteins targeted to chlo-

roplasts including examples from N. tabacum, N. sylvestris, Arabidopsis, spinach and maize ([4, 21, 33], and references therein). The N. plum- baginifolia proteins CP-RBP30 and CP-RBP31 [21] are probably the counterparts of the N. sylvestris proteins cp29A and cp29B [33].

We have analysed the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 cDNA clones. The CP-RBP30 clones terminate at 14 different 3' positions scattered over a stretch of 95 nt; 4 clones terminating at position, 1184 and 4 at 1212 were identified, while remaining termini are represented by only 1 or 2 cDNA

A AGGTTGTGGATGCCAAAGTAGTCTATGATAGGGATAG~GGTAGATCAAGGGGCTTCGGATTCGTAACATACAGTTC~GCTGAGGAGGTCAACAATGCAAT 800

TGAAAGCCTTGACGGAGTTGACCTTAATGGAAGGGCCATCCGTGTAAGCCCTGCTGAAGCTCGGCCACCCAGGCGTCAATTCTGAAGGTTGTAACCAACA 900 • • intron . . . . . -- • •

'~'T~2T`~A'~x2GAG.~-CGCT'I'G~AGGAGA'.~ACGATAG'I~GC.~C~.TGATGAG'I~AGTA~'~'I~C~.C'~CTACCCC/~C~GCGCGGA 1000

CAAATTTCTCTCTGCTTCTGGACTAA•TAGAGTTCTCAAGTAAATTAGCTTTCGTAATGTATGTTCTGAAATTGCCTTGGGAAAAATTCTTGATGTAATA ii00

B TAcAGa~cGc~GAGGTc~cGA~¢~a-rGATAG~TTG~¢GGcAT~Ac¢a~r~A;rcG¢AGGrcG~̀TAcG~T~G¢G~c~rG1~j~GAG~GAc¢̀~̀ 900

GC, CGTCAATTTT,.C,,.~ATGTGTTAAATACATCT'IWTTGGC C GAG GAAAAG CT'I"G AGI3GC TTCGTAAC GACGAAAATTGCAGCAAA GT TCATGAATTTTTTG 1000

CACCTTCAACACTCGCTACTTTTACACCAAAGTTGGTACAAAATTTTGAATCTGCATCTAGACTAATAAGAACTCACAAGTATATTACCTTTTACAGTGT ii00

C

ATGTTCTA~. TTGCCTTG~GGAAAGATTCTGATCTGTATATATATCCATTAGTTGATAATGGATTAGACAATTGACGATGT~GATCACTCTTTGGTAT 1200

~ TC TTGG TG TGAATCTTT TTCT TGTG~ 1228 GTAAACAACTCGCACGTTCTGGTTTCAAAACTCTGAATGGTCTTTTCAAATGCAGAGCTGAGAACACATCAATATCTATTGGTATACTCTAAAGATCAGT 100

AACCTTTGAAGATTAGTAACCTTTGAAGCTCAATCTAC•ATATGCAGTACTTGGTTACAGTGGCAAAGCGAGTAATTTTCTTCGAAGGGTGTTCAAAGTT 200

GAAATAAGTAAAAAAAAGTCGGGTCTTCAATATATGTTATGTACCTCTAAAACCTATAATATTTTACCTATATACCCAATTAATTTCTCGACAAAGATGG 300

TCAATTGACCA~CCCGAGCAAAGTGTCGCCCGCCCTTGCAAGGTTATTTTAAGTTTT4~ACACTCTCGCCGAAGGTGATTTTGCTCTAACGAATGTATATT 400

CTACATGGCAG 411

Fig. 1. Sequences of the 3'-terminal portions of the cDNA clones encoding CP-RBP30 (A) and CP-RBP31 (B) proteins. Num- bering is as described in [21]. C. Nucleotide sequence of the CP-RBP31 intron located in Y-UTR. The intron sequence was PCR-amplified using N. plumbaginifolia genomic DNA and primers specific for the sequences indicated in (B). Black arrows in A and B mark the polyadenylation sites as identified by cDNA cloning; multiple arrows represent the number of independent clones terminating at the same site. Triplets terminating the coding regions are double underlined. Positions of introns located in Y-UTRs are indicated. The position of intron insertion in CP-RBP31 (panel B) corresponds to the site of sequence divergence between the

clone CP-RBP3 lx and other CP-RBP31 clones (see text).

clones (Fig. 1A). The CP-RBP31 clones termi- nate at 4 different sites (Fig. 1B), one of which is located in a non-excised intron sequence (Fig. 1C, and see below). The 3' termini of all clones analy- sed were followed by the stretches of A residues (data not shown), arguing against the possibility that the observed multiple 3' termini represent cloning artefacts.

Fig. 2. RNase A/T1 mapping of the polyadenylation sites in the CP-RBP30 mRNA. Schematic representation of the probe used for mapping is shown at the bottom. Single or multiple black triangles point to the positions at which the RNA frag- ments protected by different mRNAs (as deduced from the cDNA sequences; see Fig. 1) are expected to migrate. RNase A/T1 mapping and preparation of the complementary RNA probes by in vitro transcription using appropriately linearised plasmids, T7 RNA polymerase and [ct-32p]CTP as a label, were done as described [9]. Lanes 3 and 4 contained 5 and 15 #g of RNA isolated from N. plumbaginifolia seedlings [21 ], respectively. Lane 1, an aliquot of indigested probe; lane 2, control mapping without added seedlings RNA. Lane M, size markers (Hpa 1-digested pBR322).

571

RNase A/T1 mapping analysis of N. plum- baginifolia RNA was performed to confirm that the 3' termini identified by cDNA cloning are indeed present in the populations of CP-RBP30 and CP-RBP31 mRNAs isolated from plants. The CP-RBP30-specific probe was complemen- tary to 376 3'-terminal untranslated nucleotides of the longest CP-RBP30 clone (see diagram in Fig. 2). The results of RNase mapping are con- sistent with the pattern of poly(A) addition in- ferred from sequencing of the cDNA clones. The most intensive protected fragments represent poly(A) sites used most frequently during pre- mRNA 3'-end processing. In most instances, the length of the fragments matches the length of the 3'-UTRs deduced from sequencing of individual cDNA clones. Mapping with the CR-RBP31- specific probe yielded similar results (data not shown).

Multiple cleavage/polyadenylation sites have previously been observed in transcripts originat- ing from several different plant genes [2, 5, 6, 20, 25, 29]. The 14 distinct 3' processing sites iden- tified in CP-RBP30 make this gene the most ex- treme example of this heterogeneity described to date. As in the case of many other plant tran- scription units, the sequences upstream of the polyadenylation sites in the CP-RBP30 and CP- RBP31 genes contain no AAUAAA-like motifs with a better than 4 out of 6 bases match, with the exception of one 5 out of 6 match at 1189-1194 in the clone CP-RBP30 (Fig. 1). Multiple poly- adenylation sites have also been identified in the genes of yeast Saccharomyces cerevisiae. Similarly to plants, polyadenylation in S. cerevisiae does not require the conserved hexanucleotide se- quence AAUAAA but, instead, it may depend on number of other sequences positioned either up- stream or downstream of the polyadenylation site [12, 26, 31].

The sequence of the 3 ' -UTR of one of the CP- RBP31 cDNA clones (clone CP-RBP31x) di- verges from the sequence of other clones starting as position 955, 43 nucleotides downstream of the coding region (see Fig. 1B). Since the site of di- vergence, AG/GUAAA, has an almost perfect match to the 5' splice site consensus for plant

572

Fig. 3. PCR analysis of genomic and cDNA preparations demonstrating the presence of the intron in the 3'-non-coding regions of the CP-RBP31 gene of iV. plumbaginifolia (A) and of the cp29B gene of N. sylvestris (B and C). Genomic and cDNAs from N. plumbaginifolia and N. sylvestris leaves were prepared as described [21, 30]. Primers used for PCR amplification of CP-RBP31 gene were as indicated in Fig. lB. Primers used for amplification of cp29B gene correspond to 2775-2792 and 3376-3391 on the genomic sequence [ 33 ]. 30 cycles of PCR were performed (30 s at 94 ° C, 30 s at 62 ° C, 1 min at 72 ° C). Identity of PCR products was confirmed by hybridisation using the oligonucleotide specific for the internal portion (2796-2813) of amplified DNA fragments.

introns [ 10], we have investigated whether clone CP-RBP31x may represent a polyadenylation even which took place within an unexcised intron. Using the polymerase chain reaction (PCR) and oligonucleotides specific for the sequences that flank the site of divergence (see Fig. 1B) we have amplified a fragment from N. plumbaginifolia genomic DNA corresponding to this region; N. plumbaginifolia cDNA was also amplified as a control using the same primers. Amplification of cDNA yielded a fragment of 250 nt, as expected, but in genomic DNA, the major amplified frag- ment was about 0.6kb (Fig. 3A). Sequence analysis of the 0.6 kb fragment revealed an intron of411 nt (Fig. 1C) flanked on both sides by exon sequences identical to those found in the seven CP-RBP31 cDNA clones represented in Fig. lB. These results establish that the CP-RBP31 gene ofN. plumbaginifolia contains an intron located in its 3'-UTR. Only a few examples of plant genes containing introns in the 3 '-UTR have been re- ported to date (e.g. see [7, 8, 13]). Since splicing of introns positioned in this region may be in- efficient [8, 11] and unspliced RNAs often accu- mulate in plant cells (reviewed in [24]), it is not entirely surprising that unspliced RNA may un-

dergo polyadenylation in the intron. Both intron sequences and 3'-UTRs in plants are usually AU-rich [9, 10, 19], and this property may be of importance for the 3'-end processing reaction [ 19]. Moreover, the AAUAAA-Iike motif and the upstream signals essential for plant mRNA 3'- end processing, being AU- or U-rich [20, 22, 23, 27, 28], can be fortuitously present in introns.

The N. plumbaginifolia proteins CP-RBP30 and CP-RBP31 are, most likely, counterparts of the N. sylvestris proteins cp29A and cp29B [33 ]. The CP-RBP30 and cp29A proteins are 98~o identi- cal, and the CP-RBP31 and cp29B proteins are 96~o identical. The gene encoding the cp29B pro- tein in N. sylvestris has been cloned and reported to contain three introns, all located in the coding region of the gene. We reasoned that it is rather unlikely that equivalent genes in so closely related plants as N. plumbaginifolia and N. sylvestris would differ in their intron/exon organisation. Inspec- tion of the 3 ' -UTR of the N. sylvestris gene cp29B has indeed revealed a 482 nt long sequence (2873-3354 [33] and EMBL database entry X61114) having structural features of a plant in- tron [ 10] and located at a position equivalent to the intron position in the 3 '-UTR of the N. plum-

baginifolia gene CP-RBP31 (Fig. 1). PCR analy- sis, similar to that described above for the CP- RBP31 gene, has demonstrated that this sequence is indeed excised during pre-mRNA processing in N. sylvestris. Amplification ofN. sylvestris genomic DNA yielded a fragment of 0.62 kb. However, when cDNA was used as a template, a fragment of 0.135 kb was amplified, consistent with the re- moval of a 482 nt long intron (Figs. 3B and C).

Since N. plumbaginifolia CP-RBP30 and CP- RBP31 proteins are closely related [21], we in- vestigated whether the CP-RBP30 gene also con- tains an intron in its 3 ' -UTR. PCR analysis indicated that an intron is indeed present in this region of the CP-RBP30 gene (data not shown). Sequence analysis has revealed that the intron, 125 nt in length, is located between positions 927 and 928 of the sequence shown in Fig. 1A. Hence, at least some members of the gene family encod- ing different chloroplast RNA-binding proteins in Nicotiana and possibly other plants contain, in addition to the three introns interrupting the cod- ing region [4, 18, 33], an intron localized in the 3 ' -UTR of the gene. Li et al. [ 18] have noted that the position of the first intron in the N. sylvestris genes cp29B and cp31 is precisely the same as the position of the intron in the human gene encod- ing hnRNP protein A1, which supports common evolutionary origin of these genes. Notably, like the N. plumbaginifolia and N. sylvestris CP-RBP genes, the human hnRNP A1 gene also contains an intron in the 3 ' -UTR [1 ].

References

1. Biamonti G, Buvoli M, Bassi MT, Morandi C, Cobianchi F, Riva S: Isolation of an active gene encoding human hnRNP protein A1. J Mol Biol 207:491-503 (1989).

2. Boutry M, Chua N-H: A nuclear gene encoding the beta subunit of the mitochondrial ATP synthase in Nicotiana plumbaginifolia. EMBO J 4:2159-2165 (1985).

3. Burd CG, Dreyfuss G: Conserved structures and diver- sity of functions of RNA-binding proteins. Science 265: 615-621 (1994).

4. Cheng S-H, Cline K, DeLisle A: An Arabidopsis chlo- roplast RNA-binding protein gene encodes multiple mRNAs with different 5' ends. Plant Physiol 106: 303- 311 (1994).

573

5. Czarnecka E, Gurley WB, Nagao RT, Mosquera LA, Key JL: DNA sequence and transcript mapping of a soybean gene encoding a small heat shock protein. Proc Natl Acad Sci USA 82:3726-3730 (1985).

6. Dean C, Tamaki S, Dunsmuir P, Favreau M, Katayama C, Dooner H, Bedbrook J: mRNA transcripts of several plant genes are polyadenylated at multiple site in vivo. Nucl Acids Res 14:2229-2240 (1986).

7. De Loose M, Gheysen G, Tir6 C, Gielen J, Villarroel R, Genetello C, Van Montagu M, Depicker A, Inz6 D: The extensin signal peptide allows secretion of a heterologous protein from protoplasts. Gene 99:95-100 (1991).

8. Dietrich MA, Prenger JP, Guilfoyle TJ: Analysis of the genes encoding the largest subunit of RNA polymerase II in Arabidopsis and soybean. Plant Mol Biol 15:207-223 (1990).

9. Goodall GJ, Filipowcz W: The AU-rich sequences present in the introns of plant nuclear pre-MRNAs are required for splicing. Cell 58:473-483 (1989).

10. Goodall GJ, Kiss T, Filipowicz W: Nuclear RNA splic- ing and small nuclear RNAs and their genes in higher plants. Oxf Surv Plant Mol Cell Biol 7:255-296 (1991).

11. Greenspan DS, Weissman SM: Synthesis of predomi- nantly unspliced cytoplasmic RNAs by chimeric herpes simplex virus Type 1 thymidine kinase-human/3-Globin genes. Mol Cell Biol 5:1894-1900 (1985).

12. Heidmann S, Obermaier B, Vogel K, Domdey H: Iden- tification of pre-mRNA polyadenylation sites in Saccha- romyces cerevisiae. Mol Cell Biol 12:4215-4229 (1992).

13. Hershey HP, Barker RF, Idler KB, Murray MG, Quail PH: Nucleotide sequence and characterization of a gene encoding the phytochrome polypeptide from Avena. Gene 16:339-348 (1987).

14. Hunt AG: Messenger RNA 3' end formation in plants. Annu Rev Plant Physiol Plant Mol Bio145:47-60 (1994).

15. Joshi CP: Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucl Acids Res 15:9627-9640 (1987).

16. Kenan DJ, Query CC, Keene JD: RNA recognition: to- wards identifying determinants of specificity. Trends Bio- chem Sci 16:214-220 (1991).

17. Li Y, Sugiura M: Three distinct ribonucleoproteins from tobacco chloroplasts: each contains a unique amino ter- minal acidic domain and two ribonucleoprotein consen- sus motifs. EMBO J 9:3059-3066 (1990).

18. Li Y, Ye L, Sugita M, Sugiura M: Tobacco nuclear gene for the 31 kd chloroplast ribonucleoprotein: genomic or- ganization, sequence analysis and expression. Nucl Acids Res 19:2987-2991 (1991).

19. Luehrsen KR, Walbot V: Intron creation and polyade- nylation in maize are directed by AU-rich RNA. Genes Devel 8:1117-1130 (1994).

20. MacDonald MH, Mogen BD, Hunt AG: Characteriza- tion of the polyadenylation signal from the T-DNA- encoded octopine synthase gene. Nucl Acids Res 19: 5575-5581 (1991).

574

21. Mieszczak M, Klahre U, Levy JH, Goodall GJ, Filipowicz W: Multiple plant RNA binding proteins iden- tified by PCR: expression of cDNAs encoding RNA binding proteins targeted to chloroplasts in Nicotiana plumbaginifolia. Mol Gen Genet 234:390-400 (1992).

22. Mogen BD, MacDonald MH, Graybosch R, Hunt AG: Upstream sequences other than AAUAAA are required for efficient messenger RNA 3'-end formation in plants. Plant Cell 2:1261-1272 (1990).

23. Mogen BD, MacDonald MH, Leggewie G, Hunt AG: Several distinct types of sequence dements are required for efficient mRNA 3' end formation in pea rbcS gene. Mol Cell Biol 12:5406-5414 (1992).

24. Nash J, Walbot V: Bronze-2 gene expression and intron splicing patterns in cells and tissues of Zea mays L. Plant Physiol 100:464-471 (1992).

25. Pichersky E, Brock TG, Nguyen D, Hoffman NE, Piechulla B, Tanksley SD, Green BR: A new member of the CAB gene family: structure, expression and chromo- somal location of Cab-8, the tomato gene encoding the Type III chlorophyll a/b-binding polypeptide of photo- system I. Plant Mol Biol 12:257-270 (1989).

26. Proudfoot N: Poly(A) signals. Cell 64:671-674 (1991). 27. Rothnie HM, Reid J, Hohn T: The contribution of

AAUAAA and the upstream element UUUGUA to the

efficiency of mRNA 3'-end formation in plants. EMBO J 13:2200-2210 (1994).

28. Sanfa~on H, Brodmann P, Hohn T: A dissection of the cauliflower mosaic virus polyadenylation signal. Genes Devel 5:141-149 (1991).

29. Sullivan TD, Christensen AH, Quail PH: Isolation and characterization of a maize chlorophyll a/b binding pro- tein gene that produces high levels of mRNA in the dark. Mol Gen Genet 215:431-440 (1989).

30. Vankan P, Filipowicz W: Structure of U2 snRNA genes ofArabidopsis thaliana and their expression in electropo- rated plant protoplasts. EMBO 7:791-799 (1988).

31. Wahle E, Keller W: The biochemistry of 3' -end cleavage and polyadenylation of messenger RNA precursors. Annu Rev Biochem 61:419-440 (1992).

32. Wu L, Ueda T, Messing J: Sequence and spacial require- ments for the tissue- and species-independent 3'-end pro- cessing mechanism of plant mRNA. Moll Cel Biol 14: 6829-6838 (1994).

33. Ye L, Li Y, Fukami-Kobayashi K, Go M, Konishi T, Watanabe A, Sugiura M: Diversity of a ribonucleoprotein family in tobacco chloroplasts: two new chloroplast ri- bonucleproteins and a phylogenetic tree often chloroplast RNA-binding domains. Nucl Acids Res 19:6485-6490 (1991).