EE

Ba

b

a

ARR2A

KERESMA

1

iOiTtsbacsgutoipidb

0d

Journal of Biotechnology 140 (2009) 194–202

Contents lists available at ScienceDirect

Journal of Biotechnology

journa l homepage: www.e lsev ier .com/ locate / jb io tec

xtracellular production and affinity purification of recombinant proteins withscherichia coli using the versatility of the maltose binding protein

enjamin Sommera, Karl Friehsa,∗, Erwin Flaschela, Michael Reckb, Frank Stahlb, Thomas Scheperb

Department of Fermentation Engineering, Faculty of Technology, Bielefeld University, POB 100 131, D-33501 Bielefeld, GermanyInstitute of Technical Chemistry, University of Hannover, Callinstr. 3, D-30167 Hannover, Germany

r t i c l e i n f o

rticle history:eceived 4 September 2008eceived in revised form2 December 2008ccepted 6 January 2009

eywords:

a b s t r a c t

Recombinant proteins are essential products of today’s industrial biotechnology. In this study we addresstwo crucial factors in recombinant protein production: (i) product accessibility and (ii) product recovery.Escherichia coli, one of the most frequently used hosts for recombinant protein expression, does not inher-ently secrete proteins into the extracellular environment. The major drawback of this expression systemis, therefore, to be found in the intracellular protein accumulation and hampered product accessibility.We have constructed a set of expression vectors in order to facilitate extracellular protein production

scherichia coliecombinant proteinxtracellular productionecretory expressionaltose binding protein

ffinity purification

and purification. The maltose binding protein from E. coli is used as fusion partner for several proteinsof interest allowing an export to the bacteria’s periplasm via both the Sec and the Tat pathway. Uponcoexpression of a modified Cloacin DF13 bacteriocin release protein, the hybrid proteins are released intothe culture medium. This essentially applies to a distinguished reporter molecule, the green fluorescentprotein, for which an extracellular production was not reported so far. The sequestered proteins can be

omootein

purified to approximate hof the maltose binding pr

. Introduction

Recombinant proteins are continuously gaining importancen the biotechnology industry as well as in academic research.f those, active pharmaceutical ingredients (APIs/Biologics) and

ndustrial enzymes are distinguished product classes among others.heir production is accomplished by a variety of expression sys-ems, such as bacteria, fungi, yeasts and mammalian cells. Althoughuffering from the lack of certain posttranslational modification,acteria are favoured expression systems for recombinant proteins,s they allow simple, rapid and cost-effective high cell densityultivation combined with high product titers. Due to the inten-ive genetic and metabolic characterization as well as the simpleenetic engineering Escherichia coli is one of the most frequentlysed hosts for recombinant protein expression and also applied inhis work. An outstanding disadvantage of non-pathogenic strainsf this Gram-negative bacterium is its inability to secrete proteinsnto the extracellular environment, i.e. the culture medium. Protein

roduction is often accompanied by interfering side-effects such as

nclusion body formation or protease degradation and requires cellisruption prior to protein purification. Hence, the development of aroad-range applicable procedure for secretory protein production

∗ Corresponding author. Fax: +49 521 106 6475.E-mail address: kfr@fermtech.techfak.uni-bielefeld.de (K. Friehs).

168-1656/$ – see front matter © 2009 Elsevier B.V. All rights reserved.oi:10.1016/j.jbiotec.2009.01.010

geneity by a simple, rapid and cheap procedure which utilizes the affinityto �-1,4-glucans.

© 2009 Elsevier B.V. All rights reserved.

would be a considerable asset. In this study we have investigatedthe potential of E. coli periplasmic maltose binding protein (MBP)in the guidance of different proteins to the periplasmic space andto the culture medium upon coexpression of a bacteriocin releaseprotein (BRP). The 40.7 kDa MBP is naturally directed to the bacte-rial periplasm via the General secretory (Sec) pathway (Kellermannand Szmelcmann, 1974). Upon replacement of the original by anappropriate signal peptide MBP is alternatively exported to thiscellular compartment through the Twin arginine translocation (Tat)system (Blaudeck et al., 2003) which is a special feature of thisprotein. The most prominent difference between the Sec and Tatexport pathways is found in the state of protein folding. WhereasSec substrates are transported in an unfolded state and assembledin the periplasm, the Tat pathway is able to export fully folded,even heteromultimeric proteins. Concomitant with the membranetransport, the precursor’s signal peptides are cleaved-off by spe-cific signal peptidases (SPase) generating mature forms of both Secand Tat translocated proteins. For reviews of both export routes seeEconomou (1999) and Berks et al. (2005).

Subsequent to Sec translocation of fusion proteins encompassingMBP and proteins of interest these hybrid proteins can be purified

from the periplasm using the affinity of MBP to �-1,4-glucans suchas amylose (Ferenci and Klotz, 1978). Although not shown so farfor the Tat route, MBP might act as a general carrier for recom-binant proteins, regardless of the space (cytoplasm or periplasm)where protein assembly takes place. Bacterial expression and affin-

B. Sommer et al. / Journal of Biotechnology 140 (2009) 194–202 195

Table 1List of vectors used.

Plasmid Relevant characteristics/genotype Source

pBAD18-Kan Cloning vector for PBAD regulated protein expression Guzman et al. (1995)pJL17lpp Cloacin DF13 BRP with the original signal peptide replaced by the lpp

signal peptide (lppbrp)van der Wal et al. (1998)

pBAD18-KanLppBRP pBAD18-Kan derivative; lppbrp from pJL17lpp inserted downstream of PBAD

promoterThis work

pUC19 cloning vector, ApR Yanisch-Perron et al. (1985)pUC13HI constitutive Pbgl promoter of B. amyloliquefaciens �-glucanase Borriss et al. (1989)p55 pUC19 derivative; Pbgl from PU13H inserted to the MCS G. Miksch (personal communication)p286 p55 derivative; torA signal sequence inserted downstream of Pbgl G. Miksch (personal communication)pUK21 cloning vector, KmR Vieira and Messing (1991)pBS15 pUK21 derivative; ApR backbone of p55 exchanged by KmR backbone of

pUK21This work

pBS17 pUK21 derivative; ApR backbone of p286 exchanged by KmR backbone ofpUK21

This work

pBS25 pBS15 derivative; full length malE gene inserted downstream of Pbgl This workpBS27 pBS17 derivative; shortened malE gene (without signal peptide) fused to

torA signal peptideThis work

pBAD-LppBRPmalE pBAD18-KanLppBRP derivative; Pbgl-malE fragment from pBS25 inserted This workpBAD-LppBRPtorAmalE pBAD18-KanLppBRP derivative; Pbgl-torA::malE fragment from pBS27

insertedThis work

pMT1002 Barnase (bar) gene and Barnase inhibitor Barstar (barstar) Hartley et al. (1996)pBAD-LppBRPmalEbar pBAD-LppBRPmalE derivative; fused Pbgl-malE::bar/barstar fragment from

pBS25 and pMT1002 insertedThis work

pBAD-LppBRPtorAmalEbar pBAD-LppBRPmalE derivative; fused Pbgl-torA::malE::bar/barstar fragmentfrom pBS27 and pMT1002 inserted

This work

pCH40 Alkaline phosphatase (phoA) Hoffman and Wright (1985)pBAD-LppBRPmalEphoA pBAD-LppBRPmalE derivative; fused Pbgl-malE::phoA fragment from pBS25

and pCH40 insertedThis work

pBAD-GFP Crameri et al. (1996)pBAD-LppBRPtorAmalEgfp pBAD-LppBRPmalE derivative; fused Pbgl-torA::malE::gfp fragment from This work

p gmenp bgl-tor

icr

metaftkfciafepuBAat

f(pittraa

pBS27 and pBAD-GFP insertedBAD-LppBRPphoA pBAD18-KanLppBRP derivative; phoA fraBAD-LppBRPtorAgfp pBAD-18-KanLppBRP derivative; fused P

and pBAD-GFP inserted

ty purification systems for Sec-related MBP hybrid proteins areommercially available but suffer from the prerequisite of cell dis-uption or a selective opening of the periplasm, respectively.

BRP coexpression is a common tool for the release of periplas-ic proteins to the culture medium after Sec-translocation (Miksch

t al., 1997b; Shokri et al., 2003; Choi and Lee, 2004). Upon activa-ion of an integral phospholipase, BRP provoke a partial degradationnd permeabilization of the outer membrane accounting for a dif-usive release of a subfraction of periplasmic proteins. However,he BRP-mediated release of Tat-routed periplasmic proteins, to ournowledge, has not been shown so far. Data are neither availableor BRP-mediated secretion of MBP nor MBP hybrid proteins. BRPoexpression is critical for cell viability as the outer membrane dis-ntegration rapidly causes a stop in cell division (van der Wal etl., 1995). Stationary phase dependent BRP expression was, there-ore, found to be an appropriate strategy for extracellular proteinxpression with E. coli (Miksch et al., 1997a). In this work the PBADromoter of the E. coli araBAD operon (Englesberg et al., 1969) wassed for arabinose adjustable expression of a modified Cloacin DF13RP, termed LppBRP (Luirink et al., 1991; van der Wal et al., 1998).ccordingly, the secretory protein production comprised two steps,Sec- or Tat-dependent transport to the periplasm and a consecu-

ive release to the culture medium by the aid of BRP.Using three different model proteins, a bacterial ribonuclease

rom Bacillus amyloliquefaciens (Barnase), the alkaline phosphataseAP) from E. coli and an improved version of the green fluorescentrotein (GFP) form Aequorea victoria, all of which fused to the MBP

ndividually, we have examined the BRP-mediated secretion and

he subsequent affinity purification of MBP hybrid proteins fromhe culture medium. These proteins were chosen for the followingeasons. On the one hand, model proteins compatible with the Secnd the Tat export routes were required. The Sec system is suit-ble for AP and Barnase (Hoffman and Wright, 1985; Voss et al.,

t from pCH40 inserted This workA:gfp fragment from pBS17 This work

2006), whereas the Tat pathway is able to export GFP (Thomas et al.,2001). On the other hand, GFP is one of the most frequently appliedmarker proteins in molecular cell biology and RNases, as well asphosphatases, are important enzymes used in molecular biology.Hence, these proteins are valuable biotechnological products.

2. Materials and methods

If not indicated otherwise, all chemicals were at least of analyt-ical grade.

2.1. Bacterial strains

E. coli Top10 [F− mcrA �(mrr-hsdRMS-mcrBC) �80lacZ�M15�lacX74 recA1 araD139 �(ara-leu)7697 galU galK rpsL (StrR) endA1nupG] (Invitrogen, Paisley, UK) was used for molecular cloning pro-cedures. Since E. coli Top10 was poorly suitable for protein secretion,E. coli Ara1655 [�araBA (CmR)], a derivative of E. coli K12 MG1655(Blattner et al., 1997), was constructed as a host for protein expres-sion. In Ara1655 the araA and araB genes were replaced by thechloramphenicol resistance (CmR) mediating cat gene via homol-ogous recombination according to the method of Hamilton et al.(1989).

2.2. Vector construction

Molecular cloning procedures were performed using standardlaboratory techniques (Sambrook and Russell, 2001). The vectors

used and constructed in this work are listed in Table 1. All finalexpression vectors were derivatives of pBAD18-Kan (Guzman et al.,1995).

For construction of the BRP expression unit, the LppBRP genefrom pJL17lpp (van der Wal et al., 1998) was amplified by PCR using

196 B. Sommer et al. / Journal of Biotech

Table 2List of PCR primers used for vector construction.

No. Restriction site Sequence (5′ → 3′)a +/−b

1 EcoRI AAAGAATTCGGATGAGTTGAAATACAGG +2 SalI TTTGTCGACGCCAGTTACCTTCGGAAAAA −3 EcoRI AACGAATTCAACGAAGAATCGCTGCAC +4 BamHI TCGCGGATCCTTACCCCTTTTTTGAACACGC −5 BglII GAAGATCTAAGGAAGAAAAATAATGAACAA +6 XbaI GCTCTAGAAGTCGCCGCTTGCGCCGCAG −7 BamHI AAAGGATCCAAGGACCATAGATTATGAAAA +8 XbaI AAATCTAGAAAAATCGAAGAAGGTAAACTG +9 PstI TTTCTGCAGCATTTCACAGCATTACTTGGT −10 Eco47III TTTTAGCGCTCGCTGCACTATTATCGATTT +11 NdeI TTTTTCATATGCCAGGCTTTACACTTTAT −12 SalI ACGTGTCGACCTTGGTGATACGAGTCTGC −13 SalI ACGTGTCGACGCACAGGTTATCAACACGTTT +14 NdeI, SpeI TACTAGTCATATGGTATTAAGAAAGTATGATGG −15 SalI ACGTGTCGACCAGGGCGATATTACTGCAC +16 NdeI, SpeI TACTAGTCATATGCGCGGTTTTATTTCAGCCCC −17 SalI ACGTGTCGACGCTAGCAAAGGAGAAGAACT +18 SpeI ACGTACTAGTTTATTTGTAGAGCTCATCCATG −19 Eco47III TTTTAGCGCTTAATGGTTTCTTAGACGTCA +20 NdeI TTTAACATATGAAAAAACCAGACCGAAAAGC −21 XbaI AAATCTAGAGCTAGCAAAGGAGAAGAAC +2

ppy

r0cwPpwpipotApPcal

FPltfll

2 PstI TAATACTGCAGTTATTTGTAGAGCTCATC −a Restriction sites are underlined.b Orientation of primer annealing: + (forward), − (reverse).

rimers 1 and 2 (Table 2). After cleavage with EcoRI and SalI the PCRroduct was inserted into the EcoRI and SalI sites of pBAD18-Kanielding plasmid pBAD18-KanLppBRP.

Cloning of the expression units for the secretory target proteinsequired multiple steps (see Fig. 1 for a general outline). Initially, a.5 kb fragment from pUC13H1 (Borriss et al., 1989) containing theonstitutive Pbgl promoter of Bacillus amyloliquefaciens �-glucanaseas inserted into the EcoRI and BamHI sites of pUC19 (Yanisch-

erron et al., 1985) by PCR cloning with primers 3 and 4 givinglasmid p55. Further on, the Tat signal sequence of the torA geneas amplified by PCR from the genome of E. coli K12 MG1655 usingrimers 5 and 6 and inserted downstream of the Pbgl promoter

nto the BamHI and XbaI sites of p55 giving plasmid p286. TheUC19 backbones of p55 and p286 were replaced by the backbonef pUK21 upon digestion of p55 and p286 with SspI and SphI andreatment of pUK21 (Vieira and Messing, 1991) with PsiI and SphI.fter subsequent ligation the resulting plasmids were designatedBS15 (derived from p55) and pBS17 (derived from p286). A 1.2 kb

CR fragment encompassing the full length malE (MBP) gene of E.oli was generated using primers 7 and 9 and cloned to the BamHInd PstI sites of pBS15 giving pBS27. Similarly, a malE PCR fragmentacking the native Sec signal sequence was amplified by PCR with

ig. 1. Genetic organization of the pBAD18-Kan derived vectors for constitutive,bgl controlled expression of target proteins and arabinose adjustable, PBAD regu-ated LppBRP expression. MBP, maltose binding protein; SP, signal peptide; TorA,rimethylamine-N-oxide (TMAO) reductase; AP, alkaline phosphatase; GFP, greenuorescent protein. Feature sizes are not true to scale. See Table 3 for a detailed

isting of SP and target protein combinations.

nology 140 (2009) 194–202

primers 8 and 9 and fused to the torA signal sequence of pBS17 byinsertion into the XbaI and PstI sites. The resulting plasmid waspBS27.

For construction of pBAD-LppBRPmalE and pBAD-LppBRPtorAmalE, a 1.7 kb Pbgl-malE PCR fragment from pBS25and a 1.8 kb Pbgl-torA::malE PCR fragment from pBS27, respectively(both amplified using primers 10 and 11), were cloned into theunique Eco47III and NdeI sites of pBAD18-KanLppBRP. Thesevectors were used as a positive control in BRP-mediated MBPsecretion based on the Sec and Tat pathway.

In order to construct expression units for MBP hybrid proteins,the genes of the target proteins were fused to malE and torA::malE,respectively, prior to being cloned into pBAD18-KanLppBRP. Atfirst, similar Pbgl-malE and Pbgl-torA::malE fragments to thosedescribed above were prepared by PCR using primers 10 and12. The target genes were amplified by PCR in parallel usingprimers 13 and 14 for the genes of B. amyloliquefaciens Bar-nase (bar) and its cytoplasmic inhibitor Barstar (barstar) frompMT1002 (Hartley et al., 1996), primers 15 and 16 for the E.coli AP (phoA) gene from pCH40 (Hoffman and Wright, 1985)and primers 17 and 18 for the fluorescence improved A. victoriaGFP (gfp) gene from pBAD-GFP (Crameri et al., 1996). Then, thePbgl-(torA::)malE fragments and the target gene fragments wereligated via the SalI sites introduced by the malE reverse primerand the target gene forward primer. Subsequently, the ligationproduct was enriched by an additional PCR step. The resultingfragments were inserted into the Eco47III and SpeI sites of pBAD-LppBRPmalE leading to the final constructs as follows (expressionunits in brackets): pBAD-LppBRPmalEbar (Pbgl-malE::bar-barstar), pBAD-LppBRPtorAmalEbar (Pbgl-torA::malE::bar-barstar),pBAD-LppBRPmalEphoA (Pbgl-malE::phoA) and pBAD-LppBRPtorAmalEgfp (Pbgl-torA::malE::gfp).

For the expression/secretion of solitary AP and GFP, the phoA(AP) gene from plasmid pCH40 was isolated using primers 19 and 20and cloned into pBAD18-KanLppBRP (Eco47III/NdeI) giving pBAD-LppBRPphoA. The gfp gene, amplified from pBAD-GFP (primers 21and 22) was first fused to the torA signal sequence via insertion intothe XbaI/PstI sites of pBS17. Then a 1.4 kb fragment containing Pbgland torA::gfp was cloned into the Eco47III and NdeI sites of pBAD18-KanLppBRP after amplification with primers 10 and 11 giving pBAD-LppBRPtorAgfp.

All cloning steps were verified by sequencing the cloned regions.Sequencing was carried out at the Sequencing Core Facility ofCeBiTec, Bielefeld University.

2.3. Culture media, cultivation conditions and harvest

Cultivation of E. coli for cloning purposes was performed onsolid LB medium (Sambrook and Russell, 2001) or in a semi-defined glycerol medium as described previously (Voss et al., 2003).Cultivations for extracellular protein production were carriedout in 1 l (0.15 l working volume) shake flasks using a chem-ically defined medium composed of (per l): 15 g glycerol; 5 g(NH4)2SO4; 6.62 g KH2PO4; 13.53 g K2HPO4; 0.585 g MgSO4; 1.71 gcitric acid; 8.4 mg EDTA; 10.8 mg FeCl3 × 6 H2O; 2.76 mg ZnSO4 × 7H2O; 3.7 mg MnSO4 × H2O; 1.12 mg CoSO4 × 7 H2O; 0.34 mg CuCl2;2.0 mg H3BO3; 5.0 mg Na2MoO4 × 2 H2O (pH 7.0). Cultures wereinoculated to an initial OD600 of 1.0 with over-night preculturesmade from the same medium and incubated at 37 ◦C on a rotaryshaker at an agitation frequency of 160 min−1 (eccentricity 2.5 cm).Final cultures were supplemented with 100 mg l−1 of kanamycin,

precultures with 50 mg l−1 of kanamycin.

Taking into account the cell density, BRP expression was inducedby the addition of an OD600-referred arabinose concentration(specific inducer concentration) of 1 g l−1 (approx. 0.38 g l−1 g−1

arabinose per volume per cell dry mass).

iotech

asd

2

(wv(dd

2

c(1f0stsss4Sroutcc

2

fitaiK

2

m(r[s4otr

2

ewub

B. Sommer et al. / Journal of B

Cell harvest and separation of the culture medium werechieved by centrifugation at 5000 × g and 4 ◦C for 10 min. Theupernatant was further cleared by static microfiltration prior toiafiltration or affinity chromatography (see below).

.4. Determination of cell growth and dry mass

Cell growth was monitored spectrophotometrically at 600 nmOD600) by measuring the absorption of the culture. Cell dry massas determined gravimetrically. In short, the cells of 2 ml culture

olume were harvested by centrifugation in tared reaction tubes5 min; 15,000 × g), washed with 1 ml of 0.9 g l−1 NaCl and vacuumried at 60 ◦C for 24 h. The dry mass was calculated by the massifference.

.5. Subcellular fractionation

Cultures were separated into extracellular, periplasmic andytoplasmic fractions according to the method of Khosla and Bailey1989). In short, 2 ml of culture volume were centrifuged for 5 min at5,000 × g. The supernatant was kept as the extracellular/mediumraction. Cells were resuspended in 2 ml of a solution containing.2 M Tris (pH 8.0), 200 g l−1 sucrose and 0.1 M EDTA. After inclinedhaking incubation for 20 min, cells were harvested by centrifuga-ion for 15 min at 15,000 × g and resuspended in 2 ml of a secondolution containing 10 mM Tris (pH 8.0) and 5 mM MgSO4. Sub-equent to an inclined shaking incubation step on ice for 10 min,pheroplasts were pelleted by centrifugation (10 min; 5000 × g;◦C) and the supernatant was kept as the periplasmic fraction.pheroplasts were dissolved in 2 ml of the second solution and dis-upted by ultrasonication using a Branson Sonifier 450 in cyclesf 20 s sonication and 20 s chilling on ice. The cycles were repeatedntil the solution was transparent. Cell debris was removed by cen-rifugation (10 min; 15,000 × g) and the supernatant was kept as theytoplasmic fraction. Periplasmic and cytoplasmic fractions wereombined as intracellular fraction, where applicable.

.6. Quantitation of total protein concentration

The total protein concentration was determined by a modi-ed Bradford assay (Bradford, 1976; Zor and Selinger, 1996) usinghe Roti®-Nanoquant solution (Roth GmbH, Karlsruhe, Germany)ccording to the manufacturer’s guidelines. The assay was cal-brated with a BSA standard (Albumin Fraktion V, Roth GmbH,arlsruhe, Germany).

.7. Quantitation of AP activity

AP activity was quantified using a modified protocol of theethod of Torriani and Rothman (1961). 650 �l of reaction buffer

1 M Tris–HCl [pH 8.0]; 1 mM MgCl2) were mixed with 250 �l ofeagent (14.5 mM p-nitrophenyl phosphate [pNPP] in 1 M NaHCO3pH 8.0]). The reaction was started by the addition of 100 �l ofample. pNPP hydrolysis was monitored spectrophotometrically at05 nm. One unit is defined as the amount of AP which hydrolyzesne �mol of pNPP per minute. Host cell AP activity was proveno be below the assay’s detection limit and did not interfere withecombinant AP activity.

.8. Quantitation of Barnase activity

Barnase activity was determined as described previously (Vosst al., 2006) with slight modifications. The hydrolysis of yeast RNAas quantified by the amount of acid soluble nucleotides releasednder defined conditions. In short, 400 �l of 0.1 M sodium acetateuffer (pH 5.0) were mixed with 500 �l of substrate RNA (2.5 g l−1

nology 140 (2009) 194–202 197

yeast RNA). The reaction was started by the addition of 100 �l ofsample and incubated for 15 min at 37 ◦C. The reaction was stoppedby adding 250 �l of an ice-cold solution of 20 mM uranylacetate in30% perchloric acid and incubation for 15 min on ice. Residual RNAwas removed by centrifugation at 15,000 × g for 10 min, and thesupernatant was measured spectrophotometrically at 260 nm. Oneunit of Barnase caused an increase in absorption of 1.0 at 260 nmunder the specified conditions. Host cell RNase activity was belowthe assay’s detection limit and did not interfere with the recombi-nant Barnase activity.

2.9. Quantitation of GFP fluorescence

GFP fluorescence was measured in a Shimadzu RF-551 Fluores-cence HPLC Monitor at an excitation wavelength of 395 nm and anemission wavelength of 509 nm. One millilitre of sample was drawnthrough the measuring cell using a Pharmacia Biotech LKB PumpP-1 operated at maximum velocity. The maximum emission wasrecorded in relative fluorescence units (RFU). Unspecific fluores-cence of cell and media components was compensated using GFP-free reference cultures of a similar E. coli strain, lacking the gfp gene.

2.10. Sodium dodecyl sulphate polyacrylamide gel electrophoresis(SDS-PAGE) and immunoblotting

SDS-PAGE analyses and staining with Coomassie brilliant bluewere performed according to the method of Laemmli (1970). Pro-teins were separated discontinuously under reducing conditionsusing polyacrylamide concentrations of 5% in the stacking gel and12% in the separating gel. The stacking gel comprised 125 mMTris [pH 6.8], 50 g l−1 acrylamide, 1.34 g l−1 bis-acrylamide; 1 g l−1

SDS, 1 g l−1 ammonium persulfate and 2% TEMED, while the sep-arating gel contained 373 mM Tris [pH 8.8], 120 g l−1 acrylamide,3.2 g l−1 bis-acrylamide; 1 g l−1 SDS, 0.5 g l−1 ammonium persul-fate and 2% TEMED. Gels were run in Tris–glycine buffer (25 mMTris [pH 8.3]; 192 mM Glycin; 1 g l−1 SDS). As a molecular massstandard, PageRulerTM Prestained Protein Ladder (Fermentas, St.Leo-Rot, Germany) was used.

Western transfer to a polyvinylidene fluoride membrane (RothGmbH, Karlsruhe, Germany) and immunodetection were carriedout in accordance with standard laboratory methods (Sambrookand Russell, 2001). MBP and MBP hybrid proteins were detectedwith a HRP conjugated Anti-MBP Monoclonal antibody (New Eng-land BioLabs, Ipswich, MA) which was diluted according to themanufacturer’s instructions. For blot development 18 mg of theperoxidase substrate 4-chloro-1-naphtol (Sigma–Aldrich, Munich,Germany) were dissolved in 6 ml of methanol, mixed with 30 ml ofbuffer (1 M Tris–HCl [pH 8.0]; 90 g l−1 NaCl) and 60 �l of 30% (v/v)H2O2. The reaction was stopped by replacing the substrate solutionwith water.

2.11. Diafiltration

Depending on the purification strategy, extracellular proteinswere either transferred from the culture supernatants to the affin-ity chromatography buffer (20 mM Tris–HCl [pH 7.4]; 200 mM NaCl;1 mM EDTA) by diafiltration prior to chromatography or directlypurified from the culture medium. For diafiltration purpose, a vol-

ume was replaced three times with column buffer using a 5 kDaPellicon polyethersulfone membrane (Millipore, Eschborn, Ger-many) that was operated with a peristaltic pump following theguidelines of the membrane manufacturer. After diafiltration atleast 26/27 of the original milieu was replaced.

1 iotechnology 140 (2009) 194–202

2

BaNocdfcmomAtmfr

3

3

eeet(pihdTMtGMo

3

dori(ctp

Beccilrietrb

Fig. 2. Growth of E. coli Ara1655 in shake flasks filled with 15% (v/v) of a chemi-cally defined medium at full induction of BRP coexpression using a specific inducerconcentration of 1 g l−1 arabinose.

Fig. 3. Localization of Sec (A) and Tat (B) dependent variants of the solitary MBPbefore and after induced BRP coexpression. Coomassie stained SDS-PAGEs (top) and

98 B. Sommer et al. / Journal of B

.12. Amylose affinity chromatography

For affinity chromatography an XK16/20 column (Pharmaciaiotech, Uppsala, Sweden) was packed with 15 ml of a cross-linkedgarose amylose composite matrix (Amylose Resin High Flow,ew England Biolabs, Ipswich, MA). The column was operatedn a GradiFracTM System with a HighLoad Pump P-50 (Pharma-ia Biotech, Uppsala, Sweden) and connected to a 757 absorbanceetector (Applied Biosystems, USA). Chromatography was per-ormed according to the resin manufacturer’s instructions. Theolumn was equilibrated with 5 column volumes (CV) of chro-atography buffer (cf. Section 2.11) and loaded with 10 CV (150 ml)

f cleared (diafiltered) culture supernatants. Subsequently, theatrix was washed with chromatography buffer until a steady

280 signal was observed and proteins were eluted with elu-ion buffer (chromatography buffer supplemented with 10 mM of

altose). During all process stages fractions were collected forurther analysis, in which the elution peaks were collected sepa-ately.

. Results and discussion

.1. Construction of expression vectors

All expression vectors were derivatives of pBAD18-Kan (Guzmant al., 1995) and encompassed two independent reversely orientedxpression units for LppBRP and target proteins. As shown by Fig. 1xpression of MBP and MBP hybrid proteins was controlled byhe constitutive Pbgl promoter of B. amyloliquefaciens �-glucanaseBorriss et al., 1989). LppBRP expression was regulated by the PBADromoter of the E. coli araBAD operon (Englesberg et al., 1969) and

nduced by the addition of L-arabinose. The combinations of MBPybrid proteins and signal peptides used are listed in Table 3. Twoifferent signal peptides, the Sec specific MBP SP and the Tat specificorA SP of E. coli TMAO reductase were taken into account. SolitaryBP exported by either the Sec or Tat pathway was used as posi-

ive control in BRP-mediated protein release. The solitary AP andFP served for comparison with the secretion of MBP-AP (Sec) andBP-GFP (Tat) in order to evaluate the influence of the MBP domain

n secretion efficiency.

.2. Extracellular production of MBP hybrid proteins

The constructed E. coli strains were cultivated in chemicallyefined medium and BRP expression was induced at different stagesf cultivation by the addition of arabinose, as displayed in Fig. 2. Theapid decline in culture turbidity after induction of BRP expressions a well known concomitant of BRP activity, termed quasi-lysisPugsley, 1984; de Graaf and Oudega, 1986), which is not identi-al with cell lysis (see below). In order to yield maximum biomasshe late BRP expression strategy was chosen for secretory proteinroduction.

Prior to the extracellular production of MBP hybrid proteins theRP induced release of solitary MBP targeted to the periplasm viaither the Sec or the Tat pathway was investigated as a positiveontrol. Fig. 3 shows the localization of MBP in corresponding E.oli cultures before and after induction of BRP coexpression. Beforenduction, both Sec- and Tat-dependent MBP were predominantlyocated in the periplasm. Although a significant amount of Tatelated MBP was found in the cytoplasmic fraction, the size similar-

ty with processed (mature) and purified MBP (lane R) revealed anxtracytoplasmic location for this protein as well. Since neither ofhe MBP precursors was detected in the cytoplasmic fraction, theseesults show an efficient SPase processing during translocation ofoth the Sec- and the Tat-dependent proteins.

Western blots with MBP immunodetection (bottom) are shown. (−) Before BRP coex-pression; (+) 1 h after induction of BRP expression; (++) 3 h after induction of BRPexpression; (R) purified mature MBP as a reference; (C) medium of a non-inducedcontrol culture at 3 h after time-point of induction; (mMBP) mature portion of MBP(after SP cleavage); (preMBP) MBP precursor (before SP cleavage). Molecular massesof the standard S are indicated at the left hand sides.

B. Sommer et al. / Journal of Biotechnology 140 (2009) 194–202 199

Table 3Overview of the target proteins and their plasmid background. Four different MBP hybrid proteins were constructed. Sec- and Tat-routed native MBP served as a control inprotein release. The secretion of Sec-dependent MBP-AP and Tat-related MBP-GFP was placed into comparison with the native proteins lacking the MBP portion.

Protein MBP Fused protein SP Pathway MMa (kDa) Plasmid

MBP (solitary) + – MBP Sec 40.7 pBAD-LppBRPmalEMBP (solitary) + – TorA Tat 40.7 pBAD-LppBRPtorAmalE

MBP-Barnase + Barnase MBP Sec 53.1 pBAD-LppBRPmalEbarMBP-Barnase + Barnase TorA Tat 53.1 pBAD-LppBRPtorAmalEbarMBP-AP + AP MBP Sec 89.6 pBAD-LppBRPmalEphoAMBP-GFP + GFP TorA Tat 67.6 pBAD-LppBRPtorAmalEgfp

AG

foebidailcop

tcta9cspoSB(TMrss

Ft

P (solitary) − AP APFP (solitary) − GFP TorA

a Molecular mass of the mature portion after SP cleavage.

After induction of BRP expression the MBP localization shiftedrom the periplasm to the medium, indicating a successful andbviously complete BRP-mediated release of both MBPs to thextracellular environment. A small amount of the native MBP coulde discovered in the medium prior to BRP induction as well as

n the non-induced reference culture, disclosing both, a certainegree of spontaneous secretion of the Sec-dependent MBP variant,nd the negligible efficiency of spontaneous secretion in compar-son to BRP-mediated protein release. Furthermore, the relativelyow amount of host proteins in the medium with respect to theytoplasm emphasizes the separation of MBP from the majorityf contaminating proteins and indicates the potential of secretoryrotein production as an initial product isolation step.

Subsequently, the secretion of the constructed MBP hybrid pro-eins was analysed. The distribution of these proteins betweenells and medium is displayed in Fig. 4 by means of their func-ion (enzymatic activity/fluorescence). For all MBP hybrid proteinsn increase of the extracellular fraction to at least 49% and up to3% of the total amount generated could be observed during BRPoexpression. However, there were considerable differences in theecretion efficiency with respect to the type of protein and theathway chosen for periplasmic targeting. With MBP-Barnase, thenly fusion protein analysed that could be exported via both theec and Tat pathway, a significantly higher degree of spontaneous,RP independent secretion was observed for the Sec substrate43% extracellular fraction in comparison to 4% observed for the

at substrate). These results were similar to those of the solitaryBP lacking a fusion partner (cf. Fig. 3). Moreover, BRP-mediated

elease of the Sec-MBP-Barnase was facilitated, as this protein wasequestered with an extracellular fraction of 93%, whereas the Tatubstrate accessed the medium by only 59% of the total. The Sec

ig. 4. Distribution of different MBP hybrid proteins between cells and medium inhe absence and in the presence of BRP.

Sec 46.3 pBAD-LppBRPphoATat 26.9 pBAD-LppBRPtorAgfp

exported MBP-AP also revealed a relatively high spontaneous secre-tion with an extracellular fraction of 30% but could be releasedby only 59% in the presence of BRP, i.e. with a lower efficiency ascompared to the Sec-MBP-Barnase. Similar to the Tat-MBP-Barnase,the Tat-routed MBP-GFP was not remarkably sequestered to themedium in the absence of BRP either, but released by 49% duringinduced BRP expression.

In comparison to the MBP-AP and MBP-GFP hybrid proteins,both the solitary AP and GFP proteins expressed as separate enti-ties without an N-terminal MBP domain were released with higherfractions of 91% (AP) and 76% (GFP), respectively. Owing to the factthat the solitary MBPs were also found to be efficiently secreted (cf.Fig. 3), both subunits of the hybrid proteins could be excluded fromresponsibility for the reduced secretion efficiency. Accordingly, anexplanation for the incomplete release of these MBP hybrid pro-teins was seen in their comparatively larger size (cf. Table 3), whichmight hamper the diffusive efflux of these proteins through the BRPinduced outer membrane pores.

Since, despite Barnase, different model proteins were used toinvestigate Sec and Tat based protein secretion, a comparison ofboth strategies is somehow precarious. Hence, as documented byFigs. 3 and 4, no clear tendency towards a superior suitability of oneof these export routes can be derived from the data. However, Sec-related proteins were shown to be spontaneously secreted with ahigher fraction in comparison to Tat substrates, such that these pro-teins were found in the medium with 17–43% of the total amount.In contrast, the Tat translocated proteins could be detected by amaximum of 4% outside the cells without induced BRP expression.

Whereas all Sec-related MBP derivatives were efficientlyexported to the periplasm, in a way that the cytoplasmic precursorscould not be detected in Western blots (data not shown), varyingexport efficiencies were observed for the Tat substrates as docu-

mented in Fig. 5. SPase processing is performed at the periplasmicside of the inner membrane, i.e. occurs outside the cytoplasm.Although completely processed, a significant amount of the Tat-related MBP-Barnase and MBP-GFP was found in the cytoplasmicfraction. We believe that these proteins are stuck in or attached

Fig. 5. Localization and SPase processing status of Tat-routed MBP hybrids. (−)Before BRP coexpression; (+) 1 h after induction of BRP expression; (++) 3 h afterinduction of BRP expression; (mMBP hybrids) mature portions of MBP hybrids (afterSP cleavage); (preMBP) MBP hybrid precursors (before SP cleavage).

200 B. Sommer et al. / Journal of Biotechnology 140 (2009) 194–202

F rity ofp , F2–Fa rontin

tdtsMsfac

3

Maiog(pmatmqw

ig. 6. Analysis of the chromatographic purification and estimation of product purevious diafiltration) and (E) MBP-GFP. M, medium; D, retentate from diafiltrationfter washing with 3 CV of column buffer; E2, elution fraction (peak); E1/E3, peak f

o the inner membrane Tat pores, due to the comparably poorriving force of this export machinery and, hence, incompletelyransported to the periplasm. This could also explain the marginalpontaneous secretion observed for all of the Tat-routed proteins.BP-GFP was the only protein of which the cytoplasmic precur-

or could be detected as well. The solitary presence of its processedorm in the periplasmic fraction and culture medium indicated thatlytic release from the cytoplasm did not occur as a result of BRP

oexpression.

.3. Affinity purification of MBP hybrid proteins

Subsequent to the extracellular production and cell removal,BP hybrid proteins were purified from the culture medium by

ffinity separation. Prior to chromatography, diafiltration was usedn order to transfer the proteins to the column buffer and provideptimal conditions for column binding. MBP adsorption to �-1,4-lucans requires physiological conditions, especially a neutral pHFerenci and Randall, 1979). Such requirements were already dis-layed by the culture medium so that a direct capture from theedium without a preconditioning diafiltration step was addition-

lly and exemplarily tested by means of the MBP-AP protein. Inhis case, overall process time was no longer than 1 h. The chro-

atographic purification of all MBP hybrid proteins was analysedualitatively by SDS-PAGE as shown in Fig. 6. All target proteinsere prominently represented in the medium (lanes M) but accom-

(A) MBP-Barnase (Sec), (B) MBP-Barnase (Tat), (C) MBP-AP, (D) MBP-AP (without10, flow through fractions according to 2–10 column volumes loaded; W3, fractiong/tailing. Molecular masses of the standard S are indicated at the left hand sides.

panied by other proteins due to the semi-specific character ofBRP-mediated protein release. The absence of MBP hybrid proteinswithin the early flow through fractions documents the binding tothe column (lanes F2–F10). Elution resulted in intensive bands forall MBP hybrid proteins (lanes E2). Within the elution fractionsall contaminating proteins were removed, except for the chro-mosomally encoded host MBP, which was co-purified due to theautologous affinity. Apart from the host MBP, all MBP hybrid pro-teins were purified to qualitative homogeneity in a single step.It should be emphasized, that no significant differences could beobserved for the purification of MBP-AP including and omittingdiafiltration. Skipping the diafiltration step did qualitatively neithercause reduced binding nor early breakthrough.

The purification results were quantitatively compared as listedby Table 4. For all proteins examined the initial volumes could bereduced by a factor of 10.0–15.0, with the Tat-related MBP-Barnaseand MBP-GFP showing the highest purification factors due to thelower initial abundance of these proteins in the medium (cf. Fig. 6).The (enzymatic) activities of the relevant fractions of MBP fusionproteins were raised by similar factors of 8.3–10. Recovery ratesof 83.6–89.6% highlighted a low product loss during purification,

especially for the Sec substrates MBP-Barnase and MBP-AP.

A comparably slight increase of specific activity by factorsof 2.9–4.4 for the Sec substrates MBP-Barnase and MBP-AP wasobserved. This was based on the prominence of the MBP hybridproteins in the culture medium and revealed the potential of

B. Sommer et al. / Journal of Biotechnology 140 (2009) 194–202 201

Table 4Results of the affinity chromatographic purification of MBP hybrid proteins.

Protein Fraction Volume (ml) Activitya �Pb (mg l−1) Spec. activityc Ra

d (%) SP/Xe

MBP-Barnase (Sec)Medium 150 120 539.4 222.5Elution fraction 15 1075 1089.9 986.3 89.6 36.6

Purification factorf 10.0 9.0 2.0 4.4

MBP-Barnase (Tat)Medium 150 13.5 597.6 22.6Elution fraction 12 111.8 549.0 203.6 66.3 15.1

Purification factorf 12.5 8.3 0.9 9.0

MBP-AP (with diafiltration)Medium 150 20.6 611.2 33.7Elution fraction 15 172.3 1572.2 109.6 83.6 47.9

Purification factorf 10.0 8.4 2.6 3.3

MBP-AP (without diafiltration)Medium 150 20.6 611.2 33.7Elution fraction 15 173.3 1745.7 99.3 84.1 53.2

Purification factorf 10.0 8.4 2.9 2.9

MBP-GFPMedium 150 2420 315.8 7663.1Elution fraction 10 24200 466.3 51897.9 66.7 11.1

Purification factorf 15 10 1.5 6.8

a MBP-Barnase: RNase activity (U ml−1); MBP-AP: AP activity (U ml−1); MBP-GFP: fluorescence (RFU).b Total protein concentration.c Activity related to the protein concentration. MBP-Barnase: specific RNase-activity (U mg−1); MBP-AP: specific AP activity (U mg−1); SPTorA-mMBP-GFP: specific fluores-

c −1

edium.

ecMfbpppB

fcwpaw

rioe

4

tadBobe

c1p

ence (RFU mg ml).d Recovery rate. Quotient of recovered (elution fraction) and applied (untreated me Process selectivity. Amount of purified protein related to cell dry mass (mg g−1)f Elution fraction related to the untreated medium.

xtracellular protein production in terms of an initial removal ofontaminating host proteins. The Tat-dependent MBP-Barnase andBP-GFP, in this context, showed significantly higher purification

actors of 6.8 and 9.0, respectively, which may again be explainedy the lower initial protein concentrations. As an indicator for therocess performance, the process selectivities, i.e. the amounts ofroduct obtained from the biomass, were in the order of 50 mg g−1

urified protein per cell dry mass for the Sec-dependent MBP-arnase and MBP-AP.

Differences in the purification factors were observed especiallyor the Sec- and Tat-dependent proteins. Owing to the lower initialoncentration of the Tat substrates, the increases in specific activityere considerably higher, as relatively more contaminating hostrotein was removed during affinity purification. On the other hand,comparatively low process selectivity of merely 11.1–15.1 mg g−1

as obtained with the Tat substrates.Negligible variations were documented for all relevant crite-

ia of MBP-AP purification with and without previous diafiltration,ndicating that preconditioning of the medium is redundant andmitting this step may considerably facilitate and accelerate thentire purification process.

. Conclusions and remarks

A combined utilization of MBP as an affinity partner and carriero the periplasmic space, together with a BRP as a permeabilizinggent for the outer membrane accounted for an extracellular pro-uction and purification of the three distinct model proteins AP,arnase and GFP. Using different signal peptides, the compatibilityf the system with both the Sec, and the Tat exports routes coulde shown for different MBP hybrid proteins, although at varying

fficiencies.

Tat-dependent proteins were released to lower extracellularoncentrations, resulting in an overall process selectivity of approx.0–15 mg g−1 of cell dry mass, whereas for the Sec substrates, therocess selectivity was in the range of 50 mg g−1. Secretion effi-

) activity.

ciency was obviously influenced by the protein size, with largerMBP hybrid proteins revealing reduced relocation to the culturemedium under BRP coexpression.

Extracellular production allowed affinity chromatographicpurification of all MBP hybrid proteins. Despite chromosoma-lly encoded host MBP, contaminating proteins were qualitativelyremoved and from 66% up to 90% of the secreted product wasrecovered after purification. E. coli strains with inactivated MBP(malE) genes should be used for production in future work, inorder to avoid the co-purification of host MBP. Negligible differ-ences were determined for purification with and without previousdiafiltration at the example of MBP-AP. Since preconditioning of thesecreted proteins was dispensable, a rapid, single-step purificationcould be achieved. To our knowledge, this is the first biotechno-logical approach of producing secretory MBP hybrid proteins withE. coli. In previous work, MBP hybrids were basically purified fromthe periplasm (Bedouelle and Duplay, 1988; Maina et al., 1988),necessitating at least partial cell disruption. This attempt not onlyaccounts for efficient release of MBP hybrid proteins, especiallywhen exported via the Sec pathway, but also allows a direct purifi-cation from the medium without any preparative treatment of cellsor medium required.

Since BRP activity strongly influences microbial growth, expres-sion of these potential cytotoxic proteins necessitates stringentcontrol. Strong induction of BRP expression at final biomass con-centrations was found to be favoured over fine-tuned constitutiveBRP expression, especially in long-term high cell density cultivation(Sommer, 2008). Basically, the data presented in this paper wereobtained from shake-flask cultivation. In other work, fed-batch cul-tivations were performed in bioreactors using a similar medium,strain and vector background and generating biomass concentra-

tions of approx. 70 g l−1 (Sommer, 2008). Theoretically transferringthe process selectivity of approx. 50 mg of MBP hybrid protein pergram of cell dry mass to high cell density culture, 5 g of purifiedproduct obtained from 1 l of culture medium should be feasible,even without further strain improvement.

2 iotech

A

(sBPT

R

B

B

B

B

B

B

C

C

d

E

E

F

F

G

H

H

H

Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning vectorsand host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene

02 B. Sommer et al. / Journal of B

cknowledgements

This work was funded by the German Research FoundationDeutsche Forschungsgemeinschaft, DFG; project FR 837/3). Theirupport is gratefully acknowledged. LppBRP DNA was a kind gift of. Oudega from the Vrije Universiteit Amsterdam, The Netherlands.lasmids p55 and p286 were constructed and donated by G. Miksch.he authors appreciate the generous provision of these plasmids.

eferences

edouelle, H., Duplay, P., 1988. Production in Escherichia coli and one-step purifica-tion of bifunctional hybrid proteins which bind maltose Export of the Klenowpolymerase into the periplasmic space. Eur. J. Biochem. 171, 541–549.

erks, B.C., Palmer, T., Sargent, F., 2005. Protein targeting by the bacterial twin-arginine translocation (Tat) pathway. Curr. Opin. Microbiol. 8, 174–181.

lattner, F.R., Plunkett 3rd, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick,H.A., Goeden, M.A., Rose, D.J., Mau, B., Shao, Y., 1997. The complete genomesequence of Escherichia coli K-12. Science 277, 1453–1474.

laudeck, N., Kreutzenbeck, P., Freudl, R., Sprenger, G.A., 2003. Genetic analysis ofpathway specificity during posttranslational protein translocation across theEscherichia coli plasma membrane. J. Bacteriol. 185, 2811–2819.

orriss, R., Olsen, O., Thomsen, K.K., von Wettstein, D., 1989. Hybrid Bacillus endo-(1-3,1-4)-beta-glucanases: construction of recombinant genes and molecularproperties of the gene products. Carlsberg Res. Commun. 54, 41–54.

radford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72, 248–254.

hoi, J.H., Lee, S.Y., 2004. Secretory and extracellular production of recombinantproteins using Escherichia coli. Appl. Microbiol. Biotechnol. 64, 625–635.

rameri, A., Whitehorn, E.A., Tate, E., Stemmer, W.P., 1996. Improved green fluores-cent protein by molecular evolution using DNA shuffling. Nat. Biotechnol. 14,315–319.

e Graaf, F.K., Oudega, B., 1986. Production and release of cloacin DF13 and relatedcolicins. Curr. Top. Microbiol. Immunol. 125, 183–205.

conomou, A., 1999. Following the leader: bacterial protein export through the Secpathway. Trends Microbiol. 7, 315–320.

nglesberg, E., Squires, C., Meronk Jr., F., 1969. The L-arabinose operon in Escherichiacoli B-r: a genetic demonstration of two functional states of the product of aregulator gene. Proc. Natl. Acad. Sci. U.S.A. 62, 1100–1107.

erenci, T., Klotz, U., 1978. Affinity chromatographic isolation of periplasmic maltosebinding-protein of Escherichia coli. FEBS Lett. 94, 213–217.

erenci, T., Randall, L.L., 1979. Precursor maltose-binding protein is active in bindingsubstrate. J. Biol. Chem. 254, 9979–9981.

uzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation,and high-level expression by vectors containing the arabinose PBAD promoter. J.Bacteriol. 177, 4121–4130.

amilton, C.M., Aldea, M., Washburn, B.K., Babitzke, P., Kushner, S.R., 1989. Newmethod for generating deletions and gene replacements in Escherichia coli. J.Bacteriol. 171, 4617–4622.

artley, R.W., Both, V., Hebert, E.J., Homerova, D., Jucovic, M., Nazarov, V., Rybajlak,

I., Sevcik, J., 1996. Barstar inhibits extracellular ribonucleases of Streptomycesand allows their production from recombinant genes. Protein Peptide Lett. 3,225–231.

offman, C.S., Wright, A., 1985. Fusions of secreted proteins to alkaline phosphatase:an approach for studying protein secretion. Proc. Natl. Acad. Sci. U.S.A. 82,5107–5111.

nology 140 (2009) 194–202

Kellermann, O., Szmelcmann, S., 1974. Active-transport of maltose in Escherichia coliK12—involvement of a periplasmic maltose binding-protein. Eur. J. Biochem. 47,139–149.

Khosla, C., Bailey, J.E., 1989. Evidence for partial export of vitreoscilla hemoglobininto the periplasmic space in Escherichia coli—implications for protein function.J. Mol. Biol. 210, 79–89.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the headof bacteriophage T4. Nature 227, 680–685.

Luirink, J., Duim, B., de Gier, J.W., Oudega, B., 1991. Functioning of the stable signalpeptide of the pCloDF13-encoded bacteriocin release protein. Mol. Microbiol. 5,393–399.

Maina, C.V., Riggs, P.D., Grandea 3rd., A.G., Slatko, B.E., Moran, L.S., Tagliamonte, J.A.,McReynolds, L.A., Guan, C.D., 1988. An Escherichia coli vector to express and purifyforeign proteins by fusion to and separation from maltose-binding protein. Gene74, 365–373.

Miksch, G., Fiedler, E., Dobrowolski, P., Friehs, K., 1997a. The kil gene of the ColE1plasmid of Escherichia coli controlled by a growth-phase-dependent promotermediates the secretion of a heterologous periplasmic protein during the station-ary phase. Arch. Microbiol. 167, 143–150.

Miksch, G., Neitzel, R., Fiedler, E., Friehs, K., Flaschel, E., 1997b. Extracellular produc-tion of a hybrid beta-glucanase from Bacillus by Escherichia coli under differentcultivation conditions in shaking cultures and bioreactors. Appl. Microbiol.Biotechnol. 47, 120–126.

Pugsley, A.P., 1984. The ins and outs of colicins. 1. Production, and translocationacross membranes. Microbiol. Sci. 1, 168–175.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

Shokri, A., Sanden, A.M., Larsson, G., 2003. Cell and process design for targeting ofrecombinant protein into the culture medium of Escherichia coli. Appl. Microbiol.Biotechnol. 60, 654–664.

Sommer, B. (2008). Novel strategies for the extracellular production of recombinantproteins with Escherichia coli. Ph.D. thesis, Bielefeld University.

Thomas, J.D., Daniel, R.A., Errington, J., Robinson, C., 2001. Export of active green fluo-rescent protein to the periplasm by the twin-arginine translocase (Tat) pathwayin Escherichia coli. Mol. Microbiol. 39, 47–53.

Torriani, A., Rothman, F., 1961. Mutants of Escherichia coli constitutive for alkalinephosphatase. J. Bacteriol. 81, 835–836.

van der Wal, F.J., Koningstein, G., ten Hagen, C.M., Oudega, B., Luirink, J., 1998.Optimization of bacteriocin release protein (BRP)-mediated protein release byEscherichia coli: random mutagenesis of the pCloDF13-derived BRP gene touncouple lethality and quasi-lysis from protein release. Appl. Environ. Microbiol.64, 392–398.

van der Wal, F.J., Luirink, J., Oudega, B., 1995. Bacteriocin release proteins: modeof action, structure, and biotechnological application. FEMS Microbiol. Rev. 17,381–399.

Vieira, J., Messing, J., 1991. New pUC-derived cloning vectors with different selectablemarkers and DNA replication origins. Gene 100, 189–194.

Voss, C., Lindau, D., Flaschel, E., 2006. Production of recombinant RNase Ba and itsapplication in downstream processing of plasmid DNA for pharmaceutical use.Biotechnol. Prog. 22, 737–744.

Voss, C., Schmidt, T., Schleef, M., Friehs, K., Flaschel, E., 2003. Production of super-coiled multimeric plasmid DNA for biopharmaceutical application. J. Biotechnol.105, 205–213.

33, 103–119.Zor, T., Selinger, Z., 1996. Linearization of the Bradford protein assay increases its

sensitivity: theoretical and experimental studies. Anal. Biochem. 236, 302–308.