Upload
aaasid
View
219
Download
0
Embed Size (px)
Citation preview
8/7/2019 extracellular phytase 2009
1/13
R E S E A R C H A R T I C L E
Extracellular release of a heterologous phytase from roots of
transgenic plants: does manipulation of rhizosphere biochemistry
impact microbial community structure?
Timothy S. George1, Alan E. Richardson2, Sumei S. Li3, Peter J. Gregory1 & Tim J. Daniell1
1SCRI, Invergowrie, Dundee, UK; 2CSIRO Plant Industry, Canberra, ACT, Australia; and 3ISSCAS, Nanjing, China
Correspondence: Timothy S. George, SCRI,
Invergowrie, Dundee, DD2 5DA, UK. Tel.:
144 1382 562 731; fax: 144 1382 562 426;
e-mail: [email protected]
Received 12 February 2009; revised 14 July
2009; accepted 27 July 2009.
Final version published online 10 September
2009.
DOI:10.1111/j.1574-6941.2009.00762.x
Editor: Kornelia Smalla
Keywords
inositol phosphate; mycorrhizae; phytase;
phosphate; rhizosphere; transgenic plants.
Abstract
To maintain the sustainability of agriculture, it is imperative that the reliance of
crops on inorganic phosphorus (P) fertilizers is reduced. One approach is to
improve the ability of crop plants to acquire P from organic sources. Transgenic
plants that produce microbial phytases have been suggested as a possible means to
achieve this goal. However, neither the impact of heterologous expression ofphytase on the ecology of microorganisms in the rhizosphere nor the impact of
rhizosphere microorganisms on the efficacy of phytases in the rhizosphere of
transgenic plants has been tested. In this paper, we demonstrate that the presence
of rhizosphere microorganisms reduced the dependence of plants on extracellular
secretion of phytase from roots when grown in a P-deficient soil. Despite this, the
expression of phytase in transgenic plants had little or no impact on the microbial
community structure as compared with control plant lines, whereas soil treat-
ments, such as the addition of inorganic P, had large effects. The results
demonstrate that soil microorganisms are explicitly involved in the availability of
P to plants and that the microbial community in the rhizosphere appears to be
resistant to the impacts of single-gene changes in plants designed to alter
rhizosphere biochemistry and nutrient cycling.
Introduction
Organic phosphorus (P) tends to accumulate in soils
predominantly as derivatives of inositol phosphates (pri-
marily as phytate or myo-inositol hexakisphosphate) (An-
derson, 1980; Turner et al., 2002). In order to provide plants
access to P present in soil as phytate, transgenic plants
(Arabidopsis thaliana, Nicotiana tabacum L., Trifolium sub-
terraneum L. and Solanum tuberosum L.) that express
phytase genes from soil microorganisms (Aspergillus sp.,
Bacillus sp.) have been developed and characterized (Ri-
chardson et al., 2001; Mudge et al., 2003; Zimmermann
et al., 2003; George et al., 2004, 2005a; Lung et al., 2005).
These plants exude heterologous phytase into the rhizo-
sphere and, when grown in controlled environments (e.g.
sterile and nonsorbing media such as agar), can accumulate
significantly more P than control lines when supplied solely
with phytate (Richardson et al., 2001; Mudge et al., 2003;
George et al., 2004, 2005a). However, the benefit of exuding
phytase from roots has been shown to be compromised in
soil environments, where transgenic T. subterraneum
showed only small (up to 20%) and inconsistent increases
in P accumulation (George et al ., 2004). Transgenic
N. tabacum showed a more consistent improvement in
P accumulation (up to 50%), but only in soils that were
amended with phytate to increase its availability (George
et al., 2005a). Possible reasons for the relatively poor
capacity of transgenic plants to acquire P from phytate in
soil include low availability of substrate for mineralization
by phytase, inhibitory effects of the soil environment on the
activity of phytase exuded to the rhizosphere and, as
investigated in this paper, the presence of microorganisms
(phytase exuding or otherwise), which may compensate for
the lack of phytase exuded by wild-type plants.
Soil microorganisms are involved in many soil functions
(Dunfield & Germida, 2001; Devare et al., 2004) including
the cycling of nutrients, particularly N and P (Oehl et al.,
2001; George et al., 2006; Bunemann et al., 2008). Their
presence in some cases (i.e. mycorrhizal fungi) is critical in
order for plants to survive under extremely P-deficient
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
MICROB
IOLOGYECOLO
GY
mailto:[email protected]:[email protected]8/7/2019 extracellular phytase 2009
2/13
conditions (Smith & Read, 1997). More specifically, soil
microorganisms are considered to be critical to the mobili-
zation and cycling of P within the rhizosphere (Jakobsen
et al., 2005). For this and other reasons, the impact of
transgenic plants on the presence of individual species of
microorganisms, or the biodiversity and functionality of the
soil microbial biomass itself, has been of some interest(Bruinsma et al., 2003). However, the results have been
mixed, with some studies showing small effects of transgenic
plants on specific components of the microbial community
(Siciliano et al., 1998; Dunfield & Germida, 2001; Gyamfi
et al., 2002; Bruinsma et al., 2003; Sessitsch et al., 2003;
Castaldini et al., 2005; Henault et al., 2006), while others
have demonstrated no impact at all (Heuer & Smalla, 1999;
Heuer et al., 2002; Brusetti et al., 2004; Devare et al., 2004;
Fang et al., 2005; Griffiths et al., 2006, 2007a, b; Philippot
et al., 2006; Lupwayi et al., 2007). Moreover, a number of
recent studies have suggested that differences between
transgenic plants lie within the range of natural variation
that occurs either between genotypes or due to shifts in
agronomic practice (Griffiths et al., 2006, 2007a, b). Most of
these studies, however, have focused on the impact of plants
that have been genetically modified to produce herbicide
tolerance or resistance to insect pests or plant pathogens
(Kowalchuket al., 2003; Liu et al., 2005; Ikeda et al., 2006;
Griffiths et al., 2007b) and not those that directly alter
rhizosphere biochemistry, such as transgenic plants that
exude phytase.
In this paper, we investigate the impact of rhizosphere
microorganisms on the P nutrition of plants and whether
direct manipulation of rhizosphere biochemistry through
genetic engineering had any impact on microbial commu-nity structure. Transgenic tobacco plants that express and
release extracellular microbial phytases from their roots were
used and compared with both a transgenic control line and
wild-type plants. The efficacy of the expression of phytase in
relation to the P nutrition of plants was examined in relation
to the structure of the bacterial community both within the
rhizosphere and associated with the root (surface and
endophytic bacteria), and on arbuscular mycorrhizal (AM)
fungi associated with the roots.
Materials and methods
Transformation of N. tabacum
Nicotiana tabacum plants (var. W38) were independently
transformed with phytase genes (phyA) from Aspergillus
niger (An) and Peniophora lycii (Pl) using Agrobacterium-
mediated transformation. The fungal phytase genes (phyA)
were expressed independently under the control of either
the CaMV 35S promoter or the A. thaliana phosphate
transporter (AtPt) promoter, with all constructs being
modified for extracellular secretion by inclusion of an
extracellular targeting sequence from the carrot extensin
(ex) gene (Richardson et al., 2001; Mudge et al., 2003;
George et al., 2005a). The P. lycii phytase was synthesized
according to the amino acid sequence reported by Lassen
et al. (2001) with codon usage optimized for expression in
tobacco (Geneart, Regensburg, Germany; A.E. Richardson,unpublished data). Primary transformant calli containing
ex
8/7/2019 extracellular phytase 2009
3/13
of soil wash solution per kg soil or 5% (w/w) live soil,
respectively, with sterilized soil in a cement mixer for
30 min.
Additions of phosphate were based on the amount of
orthophosphate required to increase plant available P by
10-fold (75 mg P kg1 soil) and was incubated for 28 days
before analysis and plant growth. Incubated soils wereanalysed for pH (1 : 5 w/v deionized H2O), anion exchange
resin-extractable P (resin-P or plant available P) (Saggar
et al., 1990), water-extractable Pi and Po (H2O Pi and Po)
and 0.5 M NaHCO3-extractable inorganic P (Olsen-P) (Olsen
& Sommers, 1982; George et al., 2007). The anion exchange
resin method of Saggar et al. (1990) was modified in that
resins were charged with Na2HCO3 and eluted with HCl.
Growth and P uptake by transgenic plants in soil
Five replicate pots containing 450 g (weight at 80% field
capacity) of each soil treatment were sown with five tobacco
seedlings of each plant line separately, which had beengerminated and grown for 7 days on agar containing
100mg kanamycinL1. Wild-type plants were grown to the
same stage on nutrient agar in the absence of kanamycin.
Because of the impact of these differences in the nursery
conditions on the initial vigour of the transformed plants
and the wild type, it was only possible to compare the plant
growth parameters for transgenic plants against the trans-
genic vector control. Pots were thinned to three plants per
pot after establishment and maintained at $80% field
capacity during growth, by weight. All nutrients except P
were supplied weekly by addition of 5 mL of nutrient
solution [3 mM (NH4)2SO4, 2mM KNO3, 1mM MgSO4,
10 mM Ca(NO3)2, 80mM FeEDTA and micronutrients (B,
Cu, Mn, Zn, Mo and Co)]. Plants were grown in a
randomized design in a glasshouse at 561270N and 031040W
between 14 and 22 1C with an approximate daylight length
of 16 h. Before the plants became pot bound, shoots were
harvested after 28 days of growth and biomass was deter-
mined after oven drying at 65 1C. Shoot materials were
milled and analysed for the total P content after digestion
with a sulphuric acidhydrogen peroxide mix (Heffernan,
1985).
DNA extraction from roots and soil
For each of the five replicate pots, rhizosphere soil that was
closely adhering to roots after shaking of all plants in each
pot was brushed from plants and collected into a microcen-
trifuge tube before freezing in liquid N2. A composite
subsample of the roots from each plant in each pot was also
collected into a microcentrifuge tube and also frozen in
liquid N2; this sample included microorganisms associated
with the root surface but also any endophytic microorgan-
isms such as AM fungi. Roots were freeze-dried and
pulverized by bead beating with 1-mm stainless-steel beads
(Atlas ball, UK) using a Mixer Mill 301 (Retsch GmbH,
Haan, Germany). Total DNA was then extracted from roots
(root bacteria and AM fungi) using a Nucleospins 96 Plant
DNA extraction kit (Macherey-Nagel, Germany) following
the manufacturers procedures. Total DNA was extracted
from the soil (rhizosphere bacteria) according to Deng et al.(2009). Briefly, soil was extracted with 1 : 2 w/v 0.12M
Na2HPO4 in a 1% SDS solution on a bead beater with
DEPC-treated glass beads. Following centrifugation (4960 g
for 5 min), the supernatant was added to an equal volume of
phenol : chloroform : IAA (25 : 24 : 1) and mixed. Following
a further centrifugation (4960 g for 1 min), the supernatant
was added to an equal volume of 0.3 M Na acetate in
isopropanol in clean tubes and frozen ( 20 1C) overnight.
This was then centrifuged (4960 g for 5 min) to pellet the
DNA, which was then washed with ice-cold 70% ethanol
and centrifuged (4960 g for 5 min). Ethanol was removed
and the pellet was allowed to dry before being resuspended
in 50 mL TE; this solution was cleaned by passing
over polyvinylpolypyrrolidone (Sigma) using Multiscreen
HTS HV plates (Millipore) after the polyvinylpolypyrroli-
done was equilibrated by repeated water addition (100mL).
DNA extracted from both roots and rhizosphere soil was
used for PCR amplification and community structure
analysis using terminal-restriction fragment length poly-
morphism (T-RFLP). It should be noted that the different
extraction procedures for the rhizosphere and root DNA
could impact the T-RFLP profile observed and comparison
between these two compartments should be made with
caution.
PCR amplification, T-RFLP and sequencing
The small subunit rRNA gene was used to assess the
community structure of AM fungi and root and rhizosphere
bacteria. Following optimization for template quantity, AM
fungal PCR was performed using 2 mL of the DNA extraction
in a 25-mL volume PCR reaction containing Expand High
Fidelity Buffer with 15 mM MgCl2, 100 nM of each of the
dNTPs, 200 nM of each of the primers NS31 and AM1
(Simon et al., 1992; Helgason et al., 1998), 20mg mL1
bovine serum albumin (BSA) and 0.7 U Expand High
Fidelity enzyme mix (Roche Applied Science, Mannheim,
Germany). NS31 was 5 0 labelled with the fluorophore FAM
and AM1 with VIC (Applied BioSystems, UK). Thermo-
cycling conditions were as follows: 94 1C for 2 min; 10 cycles
of 94 1C for 15s, 58 1C for 30s, 72 1C for 45 s; 20 cycles of
94 1C for 15s, 58 1C for 30s, 72 1C for 4515 s per cycle; and
72 1C for 7 min.
Following optimization for template quantity, bacterial
PCR was performed using 2mL of DNA extracted either
from soil or root. This was amplified in a 25-mL volume PCR
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
435Impact of phytase genes on rhizosphere microorganisms
8/7/2019 extracellular phytase 2009
4/13
reaction containing Platinum Taq buffer with 15mM
MgCl2, 100 nM of each of the dNTPs, 200 nM of each of
the primers 16f27 (AGAGTTTGATCCTGGCTCAG; Amann
et al., 1995) and 1392R (ACGGGCGRTGTGTACA; Black-
wood et al., 2003 modified to include a variable base),
20mgmL1 BSA and 0.725 U of Platinum Taq DNA poly-
merase (Promega UK), 16f27 was 50
labelled with thefluorophore FAM and 1392R with VIC. Before amplifica-
tion, the bacterial PCR mastermix was digested with HhaI
(40min at 37 1C) to remove contaminating bacterial
template, with subsequent heat inactivation (10min at
65 1C) of the endonuclease activity. Thermocycling condi-
tions were as follows: 94 1C for 2 min; 10 cycles of 94 1C for
15 s, 58 1C for 30s, 72 1C for 45 s; 20 cycles of 94 1C for 15 s,
58 1C for 30s, 72 1C for 45s15 s per cycle; and 72 1C for
7min.
All PCR was performed using a DNA Engine PTC Dyad
thermocycler (MJ Research, Reno). The success of PCR
amplification was assessed by agarose gel electrophoresis.
The PCR product was subjected to restriction enzyme
digestion using AluI for bacterial and independent diges-
tions with HinfI and Hsp92I for AM fungal products. In the
restriction enzyme digestion step, 5 mL of PCR product was
digested with 1 mL of restriction enzyme (0.5 U) at 37 1C for
2 h, followed by a 10-min enzyme denaturation step at
65 1C. The digested PCR product was further diluted 1 : 10
with molecular-grade ultrapure water and 1mL mixed with
8.95 mL of formamide and 0.05mL of an internal length
standard (LIZ, Applied Biosystems Inc., Freemont, CA). The
terminal restriction fragments marked with fluorophore
were analysed by electrophoresis using an automated DNA
sequencer (ABI PRISMTM
3730). Blank samples (negativePCR controls from the second-round PCR and water con-
trols) were also digested and analysed. A postrun analysis
was performed using GENEMAPPER (Applied BioSystems, UK)
to allow peak sizing and generation of a peak area for each
identified peak. Peaks that were attributed to plant DNA
(130 bp peak related to chloroplast DNA) were removed
before analysis. A fixed bin width of 5 bp was used as in the
preliminary analysis as this produced uniform and stable
peak identification. Data were then processed in EXCEL
(Microsoft Corporation) to yield peak relative abundance,
with subsequent removal of peaks representing o 1% of the
total fluorescence in each sample. Hellinger transformation
was performed to reduce the effect of dominant peaks
(Blackwood, 2006).
Data presentation and statistical analyses
All data are presented as the mean of five replicates and error
bars represent one SE of the mean. Significant differences
were established using general ANOVA and treatment means
compared by LSD (P= 0.05) (GENSTAT v5; Rothamsted Ex-
periment Station, UK). All data were tested for normality
before analysis and, where required, skewed data were
transformed to natural log values before analysis. The
various microbial community assemblages in the various
compartments of the root soil interface were subjected to
principal component analysis (PCA; GENSTAT v9; Rothamsted
Experiment Station), general ANOVA was used to identify
components that were significantly affected by the experi-mental treatments and relationships between PCs and plant
performance were established using linear regression. The
ShannonWiener index was applied to T-RFLP profiles to
establish diversity that incorporates measures of evenness
and richness.
Results
Soil treatments
The soil treatments affected some soil properties important
to the interpretation of subsequent data: pH varied signifi-
cantly (Po 0.001) with soil treatment, being reduced by0.2U with P addition and increased by 0.3 U with
g-irradiation and 0.4 U when soils were g-irradiated and
reinoculated with either inoculum (Table 1).
Pools of soil P were also changed by the soil treatments
(Table 1). Resin-P was increased (Po 0.001) by both P
addition (25-fold) and g-irradiation (eightfold), although
reinoculation of g-irradiated soil with either inoculum
reduced resin-P to a level not significantly different from
the live soil. Soil treatments also induced similar changes in
Table 1. Characteristics of soil used in experimental treatments
Treatment Live P-fertilized g-Irradiated Reinoculated Bacterial wash LSD (P= 0.05)
pH (H2O) 5.5 (0.0) 5.3 (0.1) 5.8 (0.0) 5.9 (0.0) 5.9 (0.0) 0.2
Resin-Pi (mg g1) 4.3 (0.5) 106.3 (0.9) 33.6 (3.6) 6.7 (0.2) 9.5 (0.8) 5.4
Olsen-Pi (mg g1) 10.8 (2.8) 16.6 (0.1) 20.9 (1.4) 14.9 (1.3) 9.2 (0.5) 4.8
H2O Pi (mg g1) 0.7 (0.3) 46.5 (7.8) 20.4 (2.0) 2.7 (0.2) 10.6 (3.9) 12.7
H2O Po (mg g1) 8.1 (1.2) 43.3 (12.9) 14.5 (4.0) 3.6 (1.2) 7.0 (1.3) 20.6
Soil was a spodosol (010 cm) collected from Tentsmuir Forest, Fife, UK, which was either left live, fertilized with KH 2PO4 (P-fertilized), sterilized by
g-irradiation or sterilized and reinoculated with live soil (5% w/w) (reinoculated) or a bacterial wash. Data represent the mean of five replicates with SEs
in parentheses.
FEMS Microbiol Ecol 70 (2009) 433445c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
436 T.S. George et al.
8/7/2019 extracellular phytase 2009
5/13
Olsen-P, with significantly greater P concentrations in
fertilized and sterilized soil, but not in sterilized soils that
were reinoculated. The addition of P to soils led to a large
increase (Po 0.001) in both the water-extractable Pi (inor-
ganic phosphate) and Po (organic phosphate), and
g-irradiation also increased the water-extractable Pi (29-
fold), but not the organic portion of this pool. In reinocu-lated soils, water extractable Pi and Po were again not
significantly different from live soil.
Plant growth and P accumulation
Shoot growth was significantly (Po 0.001) affected by soil
treatment, whereby plants grown in both the P-fertilized and
the g-irradiated soils were larger than those in the other soil
treatments, which were not different from each other (data
not shown). Plants grown in live soil were the smallest, being
2.8-fold smaller than in the P-fertilized and the g-irradiated
treatments. Plants grown in reinoculated soils were inter-
mediate, with the bacterial wash and live soil inoculumtreatments being 1.8-fold and 1.4-fold larger than plants
grown in live soil, respectively. There was also a significant
main effect of plant line (Po 0.001) on shoot biomass, with
plants that expressed the A. niger phytase generally being
larger than either the P. lycii phytase or the control plants.
There was no significant interaction between plant lines and
soil treatments.
Unlike shoot biomass, there was no significant main effect
due to plant line on P accumulation. However, there was a
significant main effect (Po 0.001) caused by the soil treat-
ments so that plants accumulated more P in all treatments
compared with the live soil, and with all treatments being
significantly different from one another (Fig. 1). The effect
of the soil treatments on plant P-accumulation was best
demonstrated by vector control plants, which, when com-
pared with P accumulation on live soil, accumulated 5.3-
fold more P on g-irradiated soils, 4.1-fold more on P-
fertilized soils, 3.2-fold more on bacterial wash and 1.4-fold
more on live soil inoculum treatments. There was also a
significant interaction (Po 0.001) between plant and soil
treatments so that in g-irradiated soil both of the 35S-
promoted phytase constructs (lines 35SAn and 35SPl)
accumulated more P than either the control plants or those
promoted with the AtPt promoter (Fig. 1). In all other soil
treatments, there were no significant differences betweenplant lines.
Impact on rhizosphere and root-associated
microorganisms
The bacterial community structure of the rhizosphere and
the plant root were significantly (Po 0.001) different when
analysed by PCA, with PC1 accounting for 66.4% of the
variability when the two datasets were pooled (data not
shown). However, it should be noted that this difference
may be an artefact of the different DNA extraction protocols
used for rhizosphere and root-associated communities,
although it has been demonstrated, at least for nematode
community structure, that different extraction methods
yield similar community structure analysis using T-RFLP
(Donn et al., 2008). When considered separately, PC1accounted for 35.5% and 25.2% of the variability for the
rhizosphere and root-associated communities, respectively
(Fig. 2).
The rhizosphere populations showed a significantly dif-
ferent and distinct community structure between soil treat-
ments, with the two live soils (live and P-fertilized) being
more similar to each other than the various g-irradiated
treatments in this dimension (Fig. 2a). There were no
significant differences between plant lines or any interaction
between plant line and soil treatment. There were also
significant differences between treatments in PC2, which
accounted for a further 11.0% of the variation. Again, the
soil treatments were all significantly (Po 0.001) different
from one another, with the exception of the bacterial wash
and live soil treatments. The g-irradiated and P-fertilized
treatments were also more similar to one another in this
dimension, as were the live soil and both reinoculation
treatments. Unlike PC1, there were significant (Po 0.05)
differences between plant treatments in PC2, with the
unplanted control being different from all the other planted
treatments. However, there was no significant difference in
the structure of the rhizosphere community between the
transgenic and the control plant lines.
Root-associated bacterial community structure was also
affected by soil treatment, but to a lesser extent than thatobserved in the rhizosphere (Fig. 2b). Soil treatments caused
a significant (Po 0.001) main effect in PC1, which ac-
counted for 25.2% of the variation. In particular, the live
soil treatment was distinct from all other soil treatments and
both the P-fertilized and the g-irradiated treatments were
distinct from the two reinoculated treatments. There was no
significant main effect of the plant line in PC1, but the
interaction between the plant line and the soil treatment was
significant (Po 0.001). Despite this, there were no consis-
tent differences between the transgenic lines and the control,
suggesting that any impact of plants was not consistently
due to the expression of phytase. The next PC to be related
to differences in experimental treatments was PC5, which
explained only 5.5% of the variation. There was a significant
(Po 0.05) impact of soil treatment in this dimension, but
only the live soil and bacterial wash treatments could be
statistically differentiated. There was no significant effect of
plant line in this dimension. As with PC1, statistically
significant (Po 0.05) interactions between treatments
showed no consistent differences between controls and
transgenic plants.
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
437Impact of phytase genes on rhizosphere microorganisms
8/7/2019 extracellular phytase 2009
6/13
The diversity of the dominant members of the rhizo-
sphere and root-associated bacterial populations was as-
sessed by the number of T-RFLP fragments that contributed
to the community analysis (Table 2). It is important to note
that this, however, does not reflect the entire diversity in the
system as rare individual species and groups in the popula-
tion are not counted in this instance (Bent & Forney, 2008).
Across the two sample populations, the bacterial richness of
the dominant members of the population was 48% greater
in the rhizosphere compared with the community associated
with the root. Moreover, within the rhizosphere, the greatest
richness, as measured by this method, occurred in the live
soil, which was significantly richer (Po 0.05) than all other
soil treatments including the fertilized (live) soil (Table 2).
However, no differences were evident between plant lines,
nor were there any significant interactions in either of the
rhizosphere or the root-associated populations. In contrast
to the rhizosphere, the richness of the dominant bacterial
Plant treatment
0
1000
2000
3000
0
1000
2000
3000
Plant treatment
35SAn AtPTAn 35SPl AtPTPl Vt
35SAn AtPTAn 35SPl AtPTPl Vt
PAccumulation(gPperplant)
PAccumulation(gPperplant)
0
1000
2000
3000
0
1000
2000
3000
0
1000
2000
3000
LSD P
8/7/2019 extracellular phytase 2009
7/13
communities associated with the root was not influenced by
soil treatment (Table 2).
The AM fungal community structure associated with
roots was also significantly affected (Po 0.001) by soil
treatment as indicated by PC1, which accounted for 57.9%
of the variation (Fig. 2c). In this dimension, the P-fertilized
treatment was distinct from both the live soil and the
g-irradiated soil that received 5% live soil as inoculum.
Neither the g-irradiated soil nor soil that was reinoculated
with a bacterial wash had amplifiable AM fungal DNA
associated with their roots. Despite the large effect due to
soil treatment, there was no impact of plant line or its
interaction with soil treatment. The next PC that was related
to either plant or soil treatment was PC5, which explained
only 1.3% of the variability. In addition to a significant effect
of soil treatment, this component showed a significant
difference (Po 0.05) between plant lines, with both wild-
type and vector control plants being different from all four
transgenic lines.
Given the large effect of soil treatment on microbial
community structure (Fig. 2), the data were reanalysed
within each soil treatment to establish whether therewas a stronger impact of plant line without the over-riding
variation caused by soil treatment. For both the rhizosphere
and the root-associated bacterial communities, however,
there were no instances where transgenic lines collectively
led to a significant and consistent change in the community
structure relative to the two control lines (e.g. Fig. 3
for the rhizosphere communities). However, there were
instances in live soils when PCs, which explained variation
ranging from 5.0% to 27.5% of the data, showed a signifi-
cant difference (Po 0.05) between the controls and the
35SAn line, which is consistent with this construct being
the most responsive in terms of plant growth in sterilized
soil (Fig. 1).
Despite the lack of any strong effect of plant genotype (i.e.
expression of extracellular phytase) on the rhizosphere
microbial community structure, there was an impact of the
presence of plants (Fig. 3). In four of the soil treatments, a
relatively large proportion (7.020.2%) of the variability
within soil treatments could be attributed to PCs that
showed a significant difference (Po 0.05) between
unplanted controls and the planted treatments.
PC1 (35.5%)
0.4 0.2 0.0 0.2 0.4
PC2(11.0%)
0.3
0.2
0.1
0.0
0.1
0.2
0.3
Bacterial washReinoculated-IrradiatedP-fertilizedLive soil35SAnAtPTAn35SPlAtPTPlNPVtWT
PC1 (25.2%)0.90 0.85 0.80 0.75 0.70 0.65 0.60 0.55
PC5(5.5%)
0.2
0.1
0.0
0.1
0.2
PC1 (57.9%)
0.5 0.4 0.3 0.2 0.1 0.0 0.1 0.2
PC5(1.3%)
0.04
0.02
0.00
0.02
0.04
0.06
Rhizosphere bacteria
Root bacteria
AM fungi
(a)
(b)
(c)
Fig. 2. Mean loadings of PCs derived from (a) rhizosphere bacterialcommunity structure, (b) root-associated bacterial community structure
and (c) the root AM fungal community. In each case, the first two PCs to
be significantly affected by the plant and soil treatments are plotted
against each other. Values in parenthesis for each component indicate
the amount of total variability represented. Filled stars represent the
mean loading for each soil treatment (n = 35); live (cyan); P-fertilized
(pink); sterilized by g-irradiation (red); and sterilized soil reinoculated with
a bacterial wash (green) or with 5% of live soil (blue). The mean effects
of Nicotiana tabacum lines (n = 5) that express phyA from either
Aspergillus niger (An) or Peniophora lycii (Pl) under the control of either
the 35S constitutive (35SAn and 35SPl, respectively) or the Arabidopsis
thaliana AtPT1 phosphate transporter (AtPTAn and AtPTPl, respectively)
promoters and vector (Vt) and wild-type (WT) control lines along with a
no plant control (NP) arealso shown by separate symbols. On each panel,the bars show the LSD (P= 0.05) for the interaction between plant and
soil treatments in both dimensions.
Table 2. Effect of soil treatment on bacterial richness, as measured by
T-RFLP in rhizosphere and root-associated populations
Treatment
Number of T-RFLP peaks scored
Rhizosphere Root associated
Live 36.4 (4.1) 21.1 (3.9)
g-Irradiated 32.0 (2.7) 22.0 (2.6)
Bacterial wash 30.1 (2.2) 21.3 (2.7)
Reinoculated 32.2 (2.6) 22.5 (1.8)
P-fertilized 30.1 (3.6) 21.9 (1.8)
LSD (P40.05) 1.7 n.s.
Data are presented as the mean number of T-RFLP peaks scored (based
on a 1% threshold) foreachsoil treatmentpooled across all sixplantlines
(n = 5 for each plant line). Means are shown with one SD in parentheses
and, where significant, the LSD is provided (P= 0.05).
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
439Impact of phytase genes on rhizosphere microorganisms
8/7/2019 extracellular phytase 2009
8/13
Relationship between rhizosphere community
structure and plant P accumulation
There was a significant relationship (R2= 0.75, Po 0.001)
between rhizosphere community structure (as determined
for PC1; Fig. 1) and shoot P accumulation by the plants (Fig. 4).
However, a major shift in microbial community structure
was not required in order to achieve an increase in shoot P
accumulation, as demonstrated by the P-fertilized treat-
ment. Likewise, it was also evident that a large change in
the structure of the microbial community did not necessa-
rily change the ability of the plant to accumulate P asdemonstrated by the comparison between live soil and
the various inoculum treatments of sterilized soil. While
g-irradiation caused the largest change in both the commu-
nity structure and increase in the availability of P, the soil
inoculated with a bacterial wash appeared to transform the
microbial community back towards that of the live soil, and
reduced the availability of P as measured in both soil extracts
(Table 1) and by uptake of P by plants (Fig. 4). Moreover,
the sterilized soil that was reinoculated with 5% live soil
shifted the community structure even further toward that of
the live soil and further reduced the availability of soil P for
plant uptake.
Discussion
This study demonstrates that the heterologous expression of
a microbial phytase gene in plants had no detectable impact
on the community structure of microorganisms in the
rhizosphere or those associated with the root, given the
known limits of the methodology applied. This was despite
these plant lines previously being shown to have a clear
effect on the biochemistry of the rhizosphere (George et al.,
2005b, 2007). In contrast, soil treatments aimed at perturb-
ing the soil microbiology or altering the P status of the soil
had a significant effect on microbial community structure.The effects of soil treatment were particularly evident on
mycorrhizal associations with roots and on the structure of
the bacterial community in rhizosphere soil as compared
with that associated with roots. Furthermore, and despite
the lack of impact of the expression of phytase in different
transgenic lines on soil microorganisms, it was apparent that
PC1(20.2%)
0.2
0.1
0.0
0.1
0.2
Plant treatment
35SAn
AtPTAn
35SPl
AtPTPl
NP V
t
WT
PC4
(7.0%)
0.10
0.05
0.00
0.05
0.10
PC1(16.7%)
0.1
0.0
0.1
Live
Bacterial wash
P-fertilized
PC3(10.9%
)
0.05
0.00
0.05
0.10
0.15
-Irradiated
LSD (P
8/7/2019 extracellular phytase 2009
9/13
the presence of microorganisms themselves had an influence
on the efficacy of the expression of phytase in plants on their
growth, and subsequently, the ability to acquire additional
phosphate from soil.
Impact of rhizosphere microorganisms on the
efficacy of heterologous expression of phytase
Plants that constitutively expressed either the A. nigeror the
P. lycii phytase accumulated more P than control plants
when grown in g-irradiated soils, but not in any of the live
soil treatments (either unamended or P-fertilized) or in
either of the reinoculation treatments. While not knowing
exactly the effectiveness of the g-irradiation treatment in
sterilizing the soil, the dose was considered to be sufficient
to eliminate most soil microorganisms (McNamara et al.,
2003), and was effective for the removal of mycorrhizal
fungi. No attempt was made, however, to maintain sterility
in the soil, which was allowed to recolonize naturally over 28
days of incubation and a subsequent period of 28 days of
plant growth. While it is tempting to suggest that the
presence of mycorrhizal fungi might be responsible for
compensating plants for the inherent lack of phytase expres-
sion in all treatments except for the sterilized soils, this was
not supported by the results (i.e. mycorrhizal fungi were also
absent from the bacterial-wash treatment and no differences
were observed between the various plant lines). This sug-
gests that the presence of some other component of the
microbial biomass, or the general presence of microorgan-
isms themselves in the rhizosphere, renders the expression
of phytase in plants ineffective relative to control lines. This
could be for a number of reasons, which include (1)
microbial decomposition or inactivation of the phytase
when exuded into the rhizosphere, although we have shown
previously that the enzyme can remain active in live soils(George et al., 2007), (2) that the microbial biomass
indirectly mediates the availability of inositol phosphates
for mineralization by phytase (LAnnunziata, 1975;
Bunemann et al., 2008) and (3) that the presence of
phosphatase and phytase-exuding microorganisms in the
rhizosphere themselves compensates directly for the inabil-
ity of plants to utilize P from inositol phosphates. Indeed, a
wide range of soil fungi and bacteria that exhibit phytase
activity have been reported (Tarafdar & Claassen, 1988; Hill
& Richardson, 2007; Sakurai et al., 2008) and, in some
instances, have been shown to be more prominent in the
rhizosphere (Unno et al., 2005). Other studies have sug-
gested that shifts in rhizosphere microbial community
structure are correlated with a more effective mineralizing
environment (Acosta-Martinez et al., 2003; Marschner et al.,
2006; Renalla et al., 2006). However, this was not evident in
the present study and it is important to note that under
certain conditions of enhanced availability of inositol phos-
phates, plants exuding phytase do have an advantage even in
live soils (George et al., 2005a).
The g-irradiation treatment also had a major effect on the
growth of all plant lines, with both transgenic and control
lines producing larger biomass and accumulating more P
than when grown in the unamended soil. This response may
be due to either a relief of pathogenesis or due to theincreased availability of P. For the former, it was evident
that reduced growth and P accumulation occurred in both
the reinoculation treatments and less growth and P accu-
mulation was evident in the P-fertilized soil, despite the P-
rate being considered to be sufficient for maximum plant
growth. An alternative explanation is that the irradiation
treatment resulted in a large release of P (Table 1), which
occurred presumably with the removal of any microorgan-
isms that may exert a deleterious effect on plant growth. The
lack of growth response of the transgenic lines that had
targeted expression of the phytase (i.e. from the AtPT1
promoter) may have also been affected by the availability of
P in these treatments, as it would be expected that the
expression of the phytase from this promoter would be
suppressed under such conditions (Mudge et al., 2003). The
impact of reinoculation on reduced plant growth might also
be attributed to a rapid immobilization of available P back
into microbial biomass and thus increased competition with
plants for access to this P (Jakobsen et al., 2005). The release
of cell contents other than inorganic P with g-irradiation,
i.e. monoester forms of P such as inositol phosphates
Shoot P accumulation (g P per plant)
0 1000 2000 3000 4000 5000
PC1
(35.5%)
0.6
0.4
0.2
0.0
0.2
0.4
0.6
Bacterial washReinoculated
-IrradiatedLive soilP-fertilized
Fig. 4. Relationships between shoot P accumulation (mg P per plant) of
plants grown in different soil treatments and the PC1 derived from the
rhizosphere bacterial community structure. Two separate relationships
fitted by an exponential function (y= a1b (1 exp(cx)) are shown along
with R2 values and the significance (P-value) of the relationships as
established by regression analysis. Data points represent individual
observations for all plant lines within soil treatments and include data
from live (unamended) (cyan), P-fertilized (pink) and g-irradiated (red)
soils and sterilized soil that was reinoculated with either a bacterial wash
(green) or 5% live soil (blue).
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
441Impact of phytase genes on rhizosphere microorganisms
8/7/2019 extracellular phytase 2009
10/13
(LAnnunziata, 1975; Bunemann et al., 2008) and easily
mineralized compounds (Oehl et al., 2001), is entirely
possible, and might also go some way towards explaining
the response of the phytase-exuding transgenic plants over
the controls.
Impact of the heterologous expression of
phytase in plants on the microbial community
structure in the rhizosphere and that associated
with roots
Despite the apparent interaction of rhizosphere microor-
ganisms and ability of the heterologous phytase to improve
the P nutrition of plants, there was little impact of the
different plant lines on the structure of the bacterial or
AM fungal communities. However, the presence of the
plants did have a major influence on selecting a community
structure that was different between the rhizosphere and
that associated with roots, with the latter showing less
richness of dominant members of the population and being
affected to a lesser extent by soil treatment. Other studies
have similarly shown differing community structure of
bacteria with increasing proximity to plant roots as opposed
to that in the rhizosphere (Brusetti et al., 2004; Crecchio
et al., 2007).
The different plant lines used in the study, though, did
not explain any significant variability in the structure of the
rhizosphere bacterial community, even when soil treatment
was removed as a variable, with the only consistent effect
being the presence or absence of a plant (Fig.3). The
influence of the presence of a plant compared with anunplanted control has commonly been observed and is
considered to be a major driver of microbial community
structure in soil and within the rhizosphere (Dunfield &
Germida, 2003; Philippot et al., 2006).
In contrast, soil treatment had large effects on the rhizo-
sphere microbial community structure, with a major com-
ponent of this variability being explained by the effect of
both g-irradiation and P availability. Irradiation of the soil
significantly reduced the richness of the bacterial population
as measured by T-RFLP and, although the change in micro-
bial biomass and the structural basis for this population shift
was not investigated, it was evident that reinoculation of the
sterilized soil shifted the bacterial community structure back
towards that of the unamended soil. This observation was
apparent in both the bacterial wash and addition of 5% fresh
soil treatments, with the latter having a more pronounced
effect (Fig. 4). While this may be a direct consequence of the
reintroduction of specific groups of microorganisms and
their interaction with plant roots, it may also be a result of
interactions of the microbial population with other aspects
of the soil environment.
Indeed, there was a relationship between changes in the
community structure of the rhizosphere bacteria and the
availability of P to plants as measured by their P accumula-
tion (Fig. 4). However, whether the community structure
was reacting to the availability of P, or whether the avail-
ability of P was a consequence of the soil treatments only,
remains uncertain. The fact that P availability could beincreased without a significant change in the community
structure, as in the P-fertilized treatment, and with large
differences in community structure occurring between cer-
tain treatments without a major change in the availability of
P, suggests that this relationship is not straightforward.
What is of interest, though, is that despite g-irradiation
releasing less inorganic P than that added in the P-fertilized
treatment (as measured by standard P-extractions; Table 1),
the P released from the biomass appeared to be more
available for plant uptake, which hints at the importance of
the microbial biomass as a source of available P to plants
(Seeling & Zasoski, 1993; Bunemann et al., 2008) and their
important role in the soil P-cycle.
Soil treatment also had a significant effect on the bacterial
community structure associated with roots, although this
was less marked than that observed in the rhizosphere. This
suggests that the plant exerts a strong influence on the
composition of the root-associated bacterial community
structure, which, to a large extent, had an over-riding
influence over the effects due to soil treatment affecting the
more distant rhizosphere. As with the rhizosphere bacterial
community structure, there were no significant main effects
due to the expression of the phytase gene in transgenic
plants. This observation is similar to that of Rasche et al.
(2006), who demonstrated that any impacts of a transgenictrait on bacterial endophytes were small in comparison with
other variables including plant genotype and soil type.
However, other studies have suggested a significant impact
of heterologous traits on the community structure of both
rhizosphere and root-associated bacteria (Siciliano et al.,
1998; Siciliano & Germida, 1999), despite these transgenic
traits not being targeted to the rhizosphere.
AM fungal community structure was also affected by the
soil treatment where g-irradiation was effective in removing
AM fungi from the soil. Consequently, no amplifiable AM
fungal DNA was present in the roots of plants grown in
either the irradiated soil or the irradiated soil that was
reinoculated with the bacterial wash. Of the other treat-
ments where AM was identified, the AM fungal community
structure in P-fertilized soil was significantly different from
the nonfertilized treatments. This suggests that P availability
not only affects the strength of mycorrhizal symbiosis but
also the community structure. Such a possibility has simi-
larly been demonstrated by others (Frey et al., 2004;
Vogelsang et al., 2006). In addition, plant line changed the
AM fungal community structure such that the control lines
FEMS Microbiol Ecol 70 (2009) 433445c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
442 T.S. George et al.
8/7/2019 extracellular phytase 2009
11/13
had a community structure different from the transgenic
lines. However, this difference only explained 1.3% of the
variability in the data and further resolution showed that
this was only seen in the live soil inoculum treatment. Other
studies have shown a significant impact of a transgenic trait
(e.g. expression of Bt genes in maize) on the AM fungal
infection of roots (Castaldini et al., 2005; OCallaghan et al.,2005). However, our data suggest that any impact of the
heterologous expression of phytase on the AM fungal
community structure was only evident following disruption
of the microbial community structure by sterilization of the
soil.
Overall, there was little evidence for any impact of the
transgenic plant lines on the structure of microbial commu-
nities either within the rhizosphere or on the root surface.
While it is not possible to suggest whether this would be the
case in other soils with different community structures, the
weak sorption environment of this spodosol is likely to allow
the greatest impact of the heterologous protein, which has
been shown to be strongly adsorbed in other stronger
sorbing soils (George et al., 2005b, 2007). Other studies
have similarly reported little impact of transgenic plants on
rhizosphere microbial community structure (Heuer & Smal-
la, 1999; Heuer et al., 2002; Brusetti et al., 2004; Devare et al.,
2004; Fang et al., 2005; Griffiths et al., 2006, 2007a, b).
Importantly, there was no major impact on functionally
important microbial groups here, for example AM fungi,
which have been designated as indicators of environmental
perturbation (Bruinsma et al., 2003; Kowalchuket al., 2003).
This is the first study of the impacts on rhizosphere and
root-associated microbial community structure of the ex-
pression and extracellular release of a heterologous trans-gene designed to specifically alter the biochemistry and
cycling of nutrients in the rhizosphere. Our data suggest
that while soil microorganisms appear to be involved in the
availability of P to plants, the microbial community in the
rhizosphere appears to be resistant to the impact of single-
gene changes in plants designed to alter root biochemistry
and nutrient cycling in the rhizosphere. In this case, a
transgenic technology aimed at improving the sustainability
of agriculture by altering rhizosphere biochemistry appears
to have little impact with regard to the ecology of the
microbial community and thus the wider ecology of the
agricultural system.
Acknowledgements
This research was supported by the European Commission
under a Marie Curie Outgoing International Fellowship
(T.S.G.) and the contents of the paper reflect the opinion of
the authors and not that of the European Commission. The
research in the paper was also contributed to by the Royal
Society (London) through funding for a ChinaUK Science
Network between SCRI and ISSCAS (S.S.L.) and by a travel
grant from the Australian Academy of Science, International
Science Linkages Program (A.E.R.). SCRI is supported by a
grant-in-aid from the Scottish Government RERAD. The
authors thank L. Brown for technical assistance.
References
Acosta-Martinez V, Zobeck TM, Gill TE & Kennedy AC (2003)
Enzyme activities and microbial community in semi arid
agricultural soils. Biol Fert Soils 38: 216227.
Amann RI, Ludwig W & Schleifer KH (1995) Phylogenetic
identification and in-situ detection of individual microbial
cells without cultivation. Microbiol Rev59: 143169.
Anderson G (1980) Assessing organic phosphorus in soil. The
Role of Phosphorus in Agriculture (Khasawneh FE, Sample EC &
Kamprath EJ, eds), pp. 411431. American Society of
Agronomy, St. Louis.
Bent SJ & Forney LJ (2008) The tragedy of the uncommon:understanding limitations in the analysis of microbial
diversity. ISME J2: 689695.
Blackwood CB (2006) Analysing microbial community structure
by means of terminal restriction length polymorphism (T-
RFLP). Molecular Approaches to Soil, Rhizosphere and Plant
Microorganism Analysis (Cooper J & Rao JR, eds), pp. 8498.
CABI Publishing, Wallingford, Oxfordshire, UK.
Blackwood CB, Marsh T, Kim S-H & Paul EA (2003) Terminal
restriction fragment length polymorphism data analysis for
quantitative comparison of microbial communities. Appl
Environ Microb 69: 926932.
Bruinsma M, Kowalchuk GA & Van Veen JA (2003) Effects of
genetically modified plants on microbial communities andprocesses in soil. Biol Fert Soils 37: 329337.
Brusetti L, Francia P, Bertolini C et al. (2004) Bacterial
communities associated with the rhizosphere of the transgenic
Bt 176 maize (Zea mays) and its non transgenic counterpart.
Plant Soil266: 1121.
Bunemann EK, Smernik RJ, Marschner P & McNeill AM (2008)
Microbial synthesis of organic and condensed forms of
phosphorus in acid and calcareous soils. Soil Biol Biochem 40:
932946.
Castaldini M, Turrini A, Sbrana C et al. (2005) Impact of Bt corn
on rhizospheric and soil eubacterial communities and on
beneficial mycorrhizal symbiosis in experimental microcosms.
Appl Environ Microb 71: 67196729.Crecchio C, Curci M, Pellegrino A, Ricciuti P, Tursi N &
Ruggierio P (2007) Soil microbial dynamics and genetic
diversity in soil under monoculture wheat grown in different
long-term management systems. Soil Biol Biochem 39:
13911400.
Deng H, Zhang B, Yin R, Wang HL, Mitchell SM, Griffiths BS &
Daniell TJ (2009) Long-term effect of re-vegetation on the
microbial community of a severely eroded soil in sub-tropical
China. Plant Soil, DOI: 10.1007/S11104-009-0124-9.
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
443Impact of phytase genes on rhizosphere microorganisms
http://10.0.3.239/S11104-009-0124-9http://10.0.3.239/S11104-009-0124-98/7/2019 extracellular phytase 2009
12/13
Devare MH, Jones CM & Thies JE (2004) Effect of Cry3Bb
transgenic corn and tefluthrin on the soil microbial
community: biomass, activity and diversity. J Environ Qual33:
837843.
Donn S, Griffiths BS, Neilson R & Daniell TJ (2008) DNA
extraction from soil nematodes for multi-sample community
studies. Appl Soil Ecol38
: 2026.Dunfield KE & Germida JJ (2001) Diversity of bacterial
communities in the rhizosphere and root interior of field-
grown genetically modified Brassica napus. FEMS Microbiol
Ecol38: 19.
Dunfield KE & Germida JJ (2003) Seasonal changes in the
rhizosphere microbial communities associated with field-
grown genetically modified canola (Brassica napus). Appl
Environ Microb 69: 73107318.
Fang M, Kremer RJ, Motavalli PP & Davis G (2005) Bacterial
diversity in rhizospheres of nontransgenic and transgenic
corn. Appl Environ Microb 71: 41324136.
Frey SD, Knorr M, Parrent JL & Simpson RT (2004) Chronic
nitrogen enrichment affects the structure and function of thesoil microbial community in temperate hardwood and pine
forests. Forest Ecol Manag196: 159171.
George TS, Richardson AE, Hadobas P & Simpson RJ (2004)
Characterisation of transgenic Trifolium subterraneum L.
which expresses phyA and releases extracellular phytase:
growth and P nutrition in laboratory media and soil. Plant Cell
Environ 27: 13511361.
George TS, Richardson AE, Hadobas PA & Simpson RJ (2005a)
Expression of a fungal phytase gene in Nicotiana tabacum
improves phosphorus nutrition in soil grown plants. Plant
Biotechnol J3: 129140.
George TS, Richardson AE & Simpson RJ (2005b) Behaviour of
plant-derived extracellular phytase upon addition to soil. SoilBiol Biochem 37: 977978.
George TS, Turner BL, Gregory P, Cade-Menun B & Richardson
AE (2006) Depletion of organic phosphorus from oxisols in
relation to phosphatase activities in the rhizosphere. Eur J Soil
Sci 57: 4757.
George TS, Simpson RJ, Gregory PJ & Richardson AE (2007)
Differential interactions ofAspergillus nigerand Peniophora
lycii phytase with soil particles affects the hydrolysis of inositol
phosphates. Soil Biol Biochem 39: 793803.
George TS, Brown LK, Gregory PJ, Simpson RJ & Richardson AE
(2009) Heterologous expression of microbial phytases in
plants: a potential way to improve the efficiency and
environmental impact of agricultural enterprises which rely onanimal manures for fertilisation. Nature, in press.
Griffiths BS, Caul S, Thompson J, Birch ANE, Scrimegour C,
Cortet J, Foggo A, Hackett CA & Krogh PH (2006) Soil
microbial and faunal community responses to Bt maize and
insecticide in two soils. J Environ Qual35: 734741.
Griffiths BS, Caul S, Thompson J, Birch ANE, Cortet J, Andersen
MN & Krogh PH (2007a) Microbial and microfaunal
community structure in cropping systems with genetically
modified plants. Pedobiologia 51: 195206.
Griffiths BS, Heckmann L-H, Caul S, Thompson J, Scrimegour C
& Krogh PH (2007b) Varietal effect of eight paired lines of
transgenic Bt maize and near-isogenic non-Bt maize on soil
microbial and nematode community structure. Plant
Biotechnol J5: 6068.
Gyamfi S, Pfeifer U, Stierschneider M & Sessitsch A (2002) Effects
of transgenic glufosinate-tolerant oilseed rape (Brassica napus)and the associated herbicide application on eubacterial and
Pseudomonas communities in the rhizosphere. FEMS Microb
Ecol41: 181190.
Heffernan B (1985) A Handbook of the Methods of Inorganic
Chemical Analysis for Forest Soils, Foliage and Water, pp. 4951.
CSIRO Division of Forest Research, Canberra, Australia.
Helgason T, Daniell TJ, Husband R, Fitter AH & Young JPW
(1998) Ploughing up the wood-wide web? Nature 394: 431.
Henault C, English LC, Halpin C, Andreux F & Hopkins DW
(2006) Microbial community structure in soils with
decomposing residues from plants with genetic modifications
to lignin biosynthesis. FEMS Microbiol Lett263: 6875.
Heuer H & Smalla K (1999) Bacterial phyllosphere communitiesofSolanum tuberosum L. and T4-lysozyme-producing
transgenic variants. FEMS Microbiol Ecol28: 357371.
Heuer H, Kroppenstedt RM, Lottmann J, Berg G & Smalla K
(2002) Effects of T4 lysozyme release from transgenic potato
roots on bacterial rhizosphere communities are negligible
relative to natural factors. Appl Environ Microb 68: 13251335.
Hill J & Richardson AE (2007) Isolation and assessment of
microorganisms that utilise phytate. Inositol Phosphates:
Linking Agriculture and the Environment (Turner BL,
Richardson AE & Mullaney EJ, eds), pp. 6177. CABI
Publishing, Oxford, UK.
Ikeda S, Ytow N, Ezura H, Minamisawa K & Fujimura T (2006)
Soil microbial community analysis in the environmental risk
assessment of transgenic plants. Plant Biotechnol23: 137151.
Jakobsen I, Leggett ME & Richardson AE (2005) Rhizosphere
microorganisms and plant phosphorus uptake. Phosphorus,
Agriculture and the Environment(Sims JT & Sharpley AN, eds),
pp. 437494. American Society for Agronomy, Madison.
Koide RT & Li M (1989) Appropriate controls for
vesiculararbuscular mycorrhiza research. New Phytol111:
3544.
Kowalchuk GA, Bruinsma M & van Veen JA (2003) Assessing
responses of soil microorganisms to GM plants. Trends Ecol
Evol18: 403410.
LAnnunziata MF (1975) The origin and transformations of thesoil inositol phosphate isomers. Soil Sci Soc Am J39: 377379.
Lassen SF, Breinholt J, Ostergaard PR, Brugger R, Bischoff A,
Wyss M & Fuglsang CC (2001) Expression, gene cloning and
characterisation of five novel phytases from four
basidiomycete fungi: Peniophora lycii, Agrocybe pediades, a
Ceripori sp., and Trametes pubescens. Appl Environ Microb 67:
47014707.
Liu B, Zeng Q, Yan F, Xu H & Xu C (2005) Effects of transgenic
plants on soil microorganisms. Plant Soil271: 113.
FEMS Microbiol Ecol 70 (2009) 433445c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
444 T.S. George et al.
8/7/2019 extracellular phytase 2009
13/13
Lung S-C, Chan W-L, Yip W, Wang L, Yeung EC & Lim BL (2005)
Secretion of beta-propeller phytase from tobacco and
Arabidopsis roots enhances phosphorus utilisation. Plant Sci
169: 341349.
Lupwayi NZ, Hanson KG, Harker KN, Clayton GW, Blackshaw
RE, ODonovan JT, Johnson EN, Gan Y, Irvine RB & Monreal
MA (2007) Soil Microbial biomass, functional diversity andenzyme activity in glyphosate-resistant wheatcanola
rotations under low-disturbance direct seeding and
conventional tillage. Soil Biol Biochem 39: 14181427.
Marschner P, Solaiman Z & Rengel Z (2006) Rhizosphere
properties ofPoaceae genotypes under P-limiting conditions.
Plant Soil283: 1124.
McNamara NP, Black HIJ, Beresford NA & Parekh NR (2003)
Effects of acute g irradiation on chemical, physical and
biological properties of soils. Appl Soil Ecol24: 117132.
Mudge SR, Smith FW & Richardson AE (2003) Root-specific and
phosphate-regulated expression of phytase under the control
of a phosphate transporter promoter enables Arabidopsis to
grow on phytate as a sole phosphorus source. Plant Sci 165:871878.
OCallaghan M, Glare TR, Burgess EPJ & Malone LA (2005)
Effects of plants genetically modified for insect resistance on
nontarget organisms. Annu Rev Entomol50: 271292.
Oehl F, Oberson A, Sinaj S & Frossard E (2001) Organic
phosphorus mineralization studies using isotopic dilution
techniques. Soil Sci Soc Am J65: 780787.
Olsen SR & Sommers LE (1982) Phosphorus. Methods of Soil
Analysis, Part 2. Chemical and Microbiological Properties (Page
AL, Miller RH & Keeney DR, eds), pp. 403430. American
Society for Agronomy, Madison.
Philippot L, Kuffner M, Cheneby D, Depret G, Lauguerre G &
Martin-Laurent F (2006) Genetic structure and activity of the
nitrate reducers community in the rhizosphere of different
cultivars of maize. Plant Soil287: 177186.
Rasche F, Velvis H, Zachow C, Berg G, van Elsas JD & Sessitsch A
(2006) Impact of transgenic potatoes expressing anti-bacterial
agents on bacterial endophytes is comparable with the effects
of plant genotype, soil type and pathogen infection. J Appl Ecol
43: 555566.
Renalla G, Landi L, Ascher J, Ceccherini MT, Pietramellara G &
Nannipieri P (2006) Phosphomonoesterase production and
persistence and composition of bacterial communities during
plant material decomposition in soils with different pH values.
Soil Biol Biochem 38: 795802.Richardson AE, Hadobas PA & Hayes JE (2001) Extracellular
secretion ofAspergillus phytase from Arabidopsis roots
enables plants to obtain phosphorus from phytate. Plant J25:
641649.
Saggar S, Hedley MJ & White RE (1990) A simplified resin
membrane technique for extracting phosphorus from soils.
Fert Res 24: 173180.
Sakurai M, Wasaki J, Tomizawa Y, Shinanoi T & Osaki M (2008)
Analysis of bacterial communities on alkaline phosphatase
genes in soil supplied with organic matter. Soil Sci Plant Nutr
54: 6271.
Schunmann PHD, Llewellyn DJ, Surin B, Boevink P, De Feyter RC
& Waterhouse PM (2003) A suite of novel promoters and
terminators for plant biotechnology. Func Plant Biol30:
443452.
Seeling B & Zasoski RJ (1993) Microbial effects in maintaining
organic and inorganic solution phosphorus concentrations in
grassland topsoil. Plant Soil148: 277284.
Sessitsch A, Kan F-Y & Pfeifer U (2003) Diversity and community
structure of culturable Bacillus spp. Populations in the
rhizospheres of transgenic potatoes expressing the lytic
peptide cecropin B. Appl Soil Ecol22: 149158.
Siciliano SD & Germida JJ (1999) Taxonomic diversity of bacteria
associated with the roots of field-grown transgenic Brassica
napus cv. Quest, compared to the non-transgenic B. napus cv
Excel and B. rapa cv. Parkland. FEMS Microbiol Ecol29:
263272.
Siciliano SD, Theoret CM, de Freitas JR, Hucl PJ & Germida JJ
(1998) Differences in the microbial communities associated
with the roots of different cultivars of canola and wheat. Can J
Microbiol44: 844851.
Simon L, Lalonde M & Bruns TD (1992) Specific amplification of
18S fungal ribosomal genes from VA endomycorrhizal fungi
colonising roots. Appl Environ Microb 58: 291295.
Smith SE & Read DJ (1997) Mycorrhizal Symbiosis. Academic
Press, San Diego.
Tarafdar JC & Claassen N (1988) Organic phosphorus
compounds as a phosphorus source for higher plants throughthe activity of phosphatases produced by plant roots and
microorganisms. Biol Fert Soils 5: 308312.
Turner BL, Paphazy MJ, Haygarth PM & McKelvie ID (2002)
Inositol phosphates in the environment. Philos T R Soc B 357:
449469.
Unno Y, Okubo K, Wasaki J, Shinano T & Osaki M (2005) Plant
growth promotion abilities and microscale bacterial dynamics
in the rhizosphere of Lupin analysed by phytate utilisation
ability. Environ Microbiol7: 396404.
Vogelsang KM, Reynolds HL & Bever JD (2006) Mycorrhizal
fungal identity and richness determine the diversity and
productivity of a tallgrass prairie system. New Phytol172:
554562.Zimmermann P, Zardi G, Lehmann M, Zelder C, Amrhein N,
Frossard E & Bucher M (2003) Engineering the rootsoil
interface via targeted expression of a synthetic phytase gene in
trichoblasts. Plant Biotechnol J1: 353360.
FEMS Microbiol Ecol 70 (2009) 433445 c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
445Impact of phytase genes on rhizosphere microorganisms