Extracellular Pectinase from a Novel Bacterium ...downloads.hindawi.com/journals/er/2018/3859752.pdf · KJ437473.1 Chryseobacterium indologenes strain VIT-CMJ1 16S ribosomal RNA gene

Research ArticleExtracellular Pectinase from a Novel BacteriumChryseobacterium indologenes Strain SD and Its Application inFruit Juice Clarification

Karabi Roy Sujan Dey Md Kamal Uddin Rasel Barua andMd Towhid Hossain

Department of Microbiology University of Chittagong Chittagong 4331 Bangladesh

Correspondence should be addressed to Sujan Dey sujanmbiocuacbd

Received 21 September 2017 Revised 24 January 2018 Accepted 11 February 2018 Published 21 March 2018

Academic Editor Denise Freire

Copyright copy 2018 Karabi Roy et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Pectinase is one of the important enzymes of industrial sectors Presentlymost of the pectinases are of plant origin but there are onlya few reports on bacterial pectinasesThe aimof the present studywas to isolate a novel and potential pectinase producing bacteriumas well as optimization of its various parameters for maximum enzyme production A total of forty bacterial isolates were isolatedfrom vegetable dumpwaste soil using standard plate count methods Primary screening was done by hydrolysis of pectin Pectinaseactivity was determined by measuring the increase in reducing sugar formed by the enzymatic hydrolysis of pectin Among thebacterial isolates the isolate K6 exhibited higher pectinase activity in broth medium and was selected for further studies Theselected bacterial isolate K6 was identified as Chryseobacterium indologenes strain SDThe isolate was found to produce maximumpectinase at 37∘C with pH 75 upon incubation for 72 hours while cultured in production medium containing citrus pectin andyeast extract as C and N sources respectively During enzyme-substrate reaction phase the enzyme exhibited its best activity at pHof 80 and temperature of 40∘C using citrus pectin as substrate The pectinase of the isolate showed potentiality on different typesof fruit juice clarification

1 Introduction

Enzymes are biological molecules that accelerate biochemicalreactions Pectinases are the group of enzymes that promptthe degradation of pectic substances through depolymeriza-tion and deesterification reaction [1] Pectinase is also a well-known term for commercial enzyme preparation during fruitjuice clarification This enzyme disunites polygalacturonicacid into mono-galacturonic acid by opening glycosidiclinkages [2]

In the world market it has been reported that pectinaseaccounts for 10 of global industrial enzymes produced[3] Pectinolytic enzymes are produced by many organismslike bacteria fungi yeasts insects nematodes protozoanand plants Among the various pectinases bacterial pecti-nases take more advantages over other pectinases Withthe passage of time many reports have been published onthe optimization of different microbiological parameters

and fermentation strategies for the production of pectinases[4]

Pectinases have immense applications in fruit juice indus-tries to improve fruit juice clarity and yield [5] Pectinases alsohave other various industrial applicationiumlżpounds like scouring ofcotton degumming of plant fibers waste water treatmentand vegetable oil extraction so used in various industries aspulp industry textile industry food industry and so on Theapplication of pectinase enzyme to alter the texture or flavorof fruit juice to increase extraction and clarification and toreduce viscosity has also been described [6]

Keeping all the above advantages of pectinase enzymes inconsideration the aim of the present study was designed toisolate potential pectinolytic microorganisms optimize theircultural conditions for maximum pectinase production andinvestigate different factors involved in maximum pectinaseactivity and also to evaluate its potentiality in different fruitjuice clarification

HindawiEnzyme ResearchVolume 2018 Article ID 3859752 7 pageshttpsdoiorg10115520183859752

2 Enzyme Research

2 Material and Methods

21 Sampling and Screening Pectinase producing bacteriawere isolated from vegetable dump waste soil From the col-lected samples 40 bacterial isolates were isolated and purifiedby following standard plate count techniques described byDubey andMaheshwari [7] Among 40 isolates eight isolateswere found to produce pectinase while grown on yeastextract pectin agar (YEP)medium during primary screeningScreening of pectinase producing bacteria was carried out inYEP agar medium containing yeast extract 1 pectin 1agar 15 and NaCl 05 (pH 70) at 37∘C for 48 hoursof incubation After incubation the colonies showing clearzones upon flooding with iodine-potassium iodide solution(10 g iodine 50 g potassium iodide and 330mL H

2O) were

selected as pectinase producers [8] and the isolate K6with themaximum zone of diameter was preceded for further studies

22 Identification of Selected Bacterial Strain by Pheno-typic and Biochemical Characteristics The selected isolatewas identified by morphological cultural and biochemicalcharacteristics Colony characteristics of the isolate weredetermined on yeast extract-pectin agar slant and cellularmorphology by Gram staining method For biochemicalcharacteristics several tests like citrate test TSI (triple sugariron) test indole test MR-VP motility catalase oxidasestarch hydrolysis and fermentation tests for various sugarssuch as glucose sucrose lactose maltose starch and manni-tol tests were done

23 Molecular Identification of the Bacterial Isolate Using16S rRNA Sequencing Simultaneously this potential isolatewas further identified using the molecular tool of 16S rRNAsequencing In this method PromegaWizardDNA purifi-cation kit was used for the extraction of genomic DNA ofthe selected isolate 16S rRNA gene region was amplifiedwith the universal primers The reaction mixtures were5 120583l of template primers 1120583l of forward primer 27F (51015840AGAGTTTGATCCTGGCTCAG 31015840) 1 120583l of reverse primer1492R (51015840 TACCTTGTTACGACTT 31015840) 6 120583l of assay buffer2 120583l of Taq DNA polymerase and 5120583l of dNTP mix PCRproducts were purified by using the PCR KlenzolTM andit was sequenced with a next-generation DNA sequencingThe sequencing results were then processed using BioEditsoftware The nucleotide sequence analysis was done usingthe Basic Local Alignment Search Tool (BLAST) programon National Center for Biotechnology Information site(httpswwwncbinlmnihgov) The obtained sequence datawere submitted to NCBI GenBank with accession numberKY684254 Phylogenetic analysis was conducted in Molec-ular Evolutionary Genetics Analysis software version 70(MEGA7) [9]

24 Preparation of Inoculum For the production of pectinaseenzyme the inoculum was prepared by inoculating 10mL ofsterilized YEP liquid medium in a test tube with one loop fullof pure culture and incubated at 125 rpm at 37∘C The freshovernight grown pure culture was used as an inoculum forenhanced enzyme production

25 Production of Pectinase Enzyme The inoculum (5vv) was transferred aseptically to 50mL of productionmedium (yeast extract pectate broth showing the followingcomposition yeast extract 1 pectin 1 NaCl 05 anddistilled water 100ml) in 250mL conical flask and incubatedat 37∘C for 72 hours with 125 rpm in a shaking incubator [10]After incubation the production medium was centrifuged at7000 rpm for 15min at 4∘C to obtain cell-free supernatantThe supernatant was used as the crude enzyme for furtherstudies

26 Pectinase Assay The pectinase activity was assayed byestimating the amount of reducing sugars released underassay conditions by the enzymatic degradation of citruspectin The reaction mixture containing 18ml substrate(citrus pectin) solution and 02ml suitably diluted enzymesolution was incubated at 40∘C in water bath for 1 hour Theamount of reducing sugar liberatedwas quantified byNelsonrsquosmodification of Somogyi method [11 12] One unit of enzymeactivity (U) was defined as the amount of enzyme requiredto release 1 120583mol of reducing sugar per ml per minute understandard assay conditions (1 U = 1 120583molminminus1mLminus1) [13]Thecolor intensity was measured at 500 nm in a colorimeter[SpectroT60 (UV-VIS RS)] and compared with a standardcurve prepared with ldquoD-glucoserdquo (25ndash200 micrograms)Control was maintained with uninoculatedmedia and boiledenzyme Relative activity of the enzyme was calculated as thepercentage by using the following formula

Relative Activity

= Activity of the sample

times100

Maximum activity of the sample

(1)

27 Total Protein Estimation The total protein content wasdetermined by Lowrymethod [14]measuring the absorbanceat 600 nm and compared with a standard curve prepared bybovine serum albumin (BSA)

28 Optimization of Different Factors Involved in MaximumPectinase Production

281 Effect of Temperature pH and Incubation Time Thebacterial isolate was subjected to different culture conditionsto derive the optimum conditions for maximum pectinaseproduction Pectinase production was estimated at differenttemperatures (27 30 37 40 and 45∘C) a wide range of pH(50 55 60 65 70 75 80 85 and 90) and differentincubation periods (24 48 72 96 and 120 hours) and thenthe enzyme activity was measured

282 Effect of Carbon and Nitrogen Sources To study theeffect of carbon and nitrogen sources on pectinase produc-tion from the selected isolate various carbon sources (citruspectin glucose sucrose and starch) and nitrogen sources(peptone yeast extract ammonium chloride and potassiumnitrate) were supplemented into production medium at a

Enzyme Research 3

concentration of 05wv and then the pectinase activity wasassayed

29 Optimization of Reaction Parameters for the MaximumPectinase Activity Various reaction parameters were studiedto determine the optimum conditions of the crude pectinaseactivity at different temperature pH reaction time andsubstrate concentration

291 Effect of Temperature and pH The optimum temper-ature and pH of the pectinase enzyme were determined byincubating the reaction mixture having pH 75 at varioustemperatures (30 37 40 and 45∘C) and then a range of pH(60 65 70 75 80 85 and 90) at 40∘C for 1 hour usingdifferent buffers respectively For this purpose substrate (1wv citrus pectin) was prepared at different pH values (pH60ndash90) using 02M citrate-phosphate buffer (pH 60ndash75)and 02M Tris-HCl buffer (pH 80ndash90) Then the pectinaseactivity was assayed by using the standard assay method

292 Effect of Reaction Time For determination of optimumreaction time the enzyme stability was studied by incubatingthe reaction mixture for various time intervals at 10min20min 30min 40min 50min and 60min under optimizedtemperature and pH and then performing the assay forpectinase activity

293 Effect of Substrate Concentration To examine the effectof substrate concentration during enzyme-substrate reactionvarying concentrations of citrus pectin (05 10 15 2025 and 30) were prepared and then enzyme activity wasmeasured

210 Crude Pectinase Enzyme in Fruit Juice Clarification Toobserve the effect of crude pectinase on different fruit juiceclarification tubes were labeled as treatment and control10ml of crude pectinase was taken into the test tube (treat-ment) and 10ml of distilled water was taken into the controltest tube Then twenty ml of applegrape juice was added toboth tubes The contents of the tubes were agitated to mixthe enzymes throughout the juice The tubes were kept intothe water bath at 40∘C The tubes were observed at 5-minuteintervals over one-hour period After incubation the solutionwas filtered [15]

3 Results and Discussion

There are only a few reports on bacterial pectinases till now[16] In this study we aimed to find out novel and potentialpectinolytic bacteria to optimize the cultural conditions forenhancing enzyme production and partial characterization ofthe enzyme For this purpose we collected vegetable dumpwaste soil as the source of potential organisms Eight isolateswere primarily selected from 40 bacterial isolates on the basisof their pectinolytic activity as shown in Figure 1 duringscreening and finally the isolate K6 was selected for furtherstudies

K6

Figure 1 Zone of pectin hydrolysis on YEP agar medium of isolateK6 after 48-hour incubation

31 Identification of Selected Bacterial Isolate To identify theselected isolate K6 both traditional microbiological methodsandmodernmolecular technologies were considered On thebasis of observed morphological cultural and biochemicalcharacteristics the selected isolate was compared with thestandard description in Bergeyrsquos Manual of DeterminativeBacteriology [17] and the isolate K6 was provisionally iden-tified as Chryseobacterium indologenes

In NCBI database BLAST showed significant align-ments ofChryseobacterium indologeneswith 95 similaritiesFurther the obtained sequence was compared with otherrelated sequences to find the closest homolog at NCBI usingBLAST The construction of a phylogenetic tree (Figure 2)was made on the basis of 16S rRNA gene sequences ofisolate Chryseobacterium indologenes strain SD and otherstrains of Chryseobacterium species obtained from GenBankdatabase The related 16 nucleotide sequences were used toconstruct the phylogenetic tree using the neighbor-joiningmethod [18] The bootstrap consensus tree inferred from1000 replicates [19] is taken to represent the evolutionaryhistory of the taxa analyzed [19] Branches corresponding topartitions reproduced in less than 50 bootstrap replicatesare collapsed The percentage of replicate trees in whichthe associated taxa clustered together in the bootstrap test(1000 replicates) is shown next to the branches [19] Theevolutionary distances were computed using the MaximumComposite Likelihoodmethod [20] and are in the units of thenumber of base substitutions per site The analysis involved16 nucleotide sequences All positions containing gaps andmissing data were eliminated There were a total of 1323positions in the final dataset Evolutionary analyses wereconducted in MEGA7 [9] Finally the result attained fromthe 16S rRNA analyses inferred that the Chryseobacteriumindologenes strain SD was very close to other Chryseobac-terium indologenes strains

32 Optimization Studies of the Isolate for Pectinase Produc-tion To optimize the culture conditions of this potentialorganism in the production medium different temperature

4 Enzyme Research

KX3501871 Chryseobacterium sp BAB-5797 16S ribosomal RNA gene partial sequenceKP8932871 Chryseobacterium aquifrigidense strain R-21 16S ribosomal RNA gene partial sequenceLC0409531 Chryseobacterium arthrosphaerae gene for 16S ribosomal RNA partial sequenceKX5799641 Chryseobacterium gleum strain EY1 16S ribosomal RNA gene partial sequenceKU0584361 Chryseobacterium joostei strain V4 16S ribosomal RNA gene partial sequenceGU4582651 Chryseobacterium sp HT4B 16S ribosomal RNA gene partial sequenceLN6248012 Chryseobacterium indologenes partial 16S rRNA gene strain HE12NR 0425071 Chryseobacterium indologenes strain LMG 8337 16S ribosomal RNA gene partial sequenceKJ4374731 Chryseobacterium indologenes strain VIT-CMJ1 16S ribosomal RNA gene partial sequenceKF0175801 Chryseobacterium indologenes strain ZYF120413-7 16S ribosomal RNA gene partial sequence

KY6842541 Chryseobacterium indologenes strain SD 16S ribosomal RNA gene partial sequenceKU3592551 Chryseobacterium sp H2(2016) 16S ribosomal RNA gene partial sequenceKU3425961 Chryseobacterium sp strain ERGC09 16S ribosomal RNA gene partial sequenceKP1259761 Chryseobacterium indologenes strain PVL15 16S ribosomal RNA gene partial sequenceKX1464631 Chryseobacterium cucumeris strain GSE06 16S ribosomal RNA gene partial sequenceKC1899011 Chryseobacterium indologenes strain N6 16S ribosomal RNA gene partial sequence

10062

54

24

21

10039

88

90

57

42

14

13

Figure 2 Phylogenetic tree constructed on the basis of 16S rRNA gene sequences of Chryseobacterium indologenes strain SD with otherChryseobacterium sp obtained from GenBank database Their names and respective accession numbers are shown on the tree

Table 1 Effect of temperature on pectinase production fromChryseobacterium indologenes strain SD

Incubationtemperature (∘C)

Enzyme activity(120583molminminus1mLminus1)

Relative activity()

27 036 plusmn 0050 5294

30 045 plusmn 0020 6618

37 068 plusmn 0020 100040 024 plusmn 0021 353

45 018 plusmn 0026 2647

Values are mean plusmn SD of 3 replicates

pH incubation period and various C and N sources wereconsidered Enzyme production went up with the increaseof temperature up to 37∘C and then declined (Table 1) Themaximum production which occurred at this temperaturewas 0679Uml (100 of relative activity) This dramaticallyreduced to nearly 27 at 45∘C temperature In the previousstudy of Aaisha and Barate (2016) [21] the highest pectinaseproduction was observed from some Bacillus species at 37∘Cwhich is similar to our current studyThe same findings werealso reported by the other workers [22] in case of mutagenicstrain of Leuconostoc mesenteroides

The same trend was also observed when this organismwas allowed to grow in the productionmedium at varying pH(Table 2) Maximum production (0564Uml) was recordedat pH 75 This finding is in accordance with other workerswho reported that most of the Bacillus sp produce highamount of pectinase between pH 75 and 8 [21 23] At highlyacidic and alkaline pH enzyme production decreased byalmost 34 and 64 respectively From this result it can beinferred that at very low and very high pH condition growthof the organism slows down

An attempt was made to determine the most favorabletime period for enzyme production by the selected iso-late and the highest enzyme production (0594Uml) wasrecorded at 72 hours of incubation (Table 3) The enzymeproduction gradually decreased to 035 120583molminminus1mLminus1 at120 hours of incubation which is almost 40 less than thatof maximum This might be due to the accumulation of

Table 2 Effect of pH on pectinase production from Chryseobac-terium indologenes strain SD

pH Enzyme activity(120583molminminus1mLminus1) Relative activity ()

50 037 plusmn 0020 6607

55 042 plusmn 0026 7500

60 045 plusmn 0026 8036

65 047 plusmn 0020 8393

70 048 plusmn 0020 8571

75 056 plusmn 0021 100080 040 plusmn 0025 7143

85 033 plusmn 0020 5893

90 021 plusmn 0038 375


Table 3 Effect of incubation period on pectinase production fromChryseobacterium indologenes strain SD

Incubation period(hour)


Relative activity()

24 045 plusmn 0020 7627

48 050 plusmn 0040 8475

72 059 plusmn 0030 100096 052 plusmn 0021 8814

120 035 plusmn 0032 5932


waste products at prolonged incubation time with limitednutrient sources which consequently suppressed the growthof microorganism According to Nawawi et al (2017) [24]maximum pectinase production was determined from theBacillus subtilis ADI1 after 72 hours of incubation which wellagreed with our findings

In this study we also supplemented different types ofcarbon and nitrogen sources to find out the suitable pro-duction medium for pectinase production by Chryseobac-terium indologenes strain SD Among the four C sources theorganism lost almost 50 of production in case of sucrose

Enzyme Research 5

Table 4 Effect of carbon sources on pectinase production fromChryseobacterium indologenes strain SD

Carbon source Enzyme activity(120583molminminus1mLminus1) Relative activity ()

Citrus pectin 067 plusmn 0020 1000Glucose 064 plusmn 0021 9552

Sucrose 038 plusmn 0030 5672

Starch 050 plusmn 0020 7463


Table 5 Effect of nitrogen sources on pectinase production fromChryseobacterium indologenes strain SD

Nitrogen source Enzyme activity(120583molminminus1mLminus1)

Relative activity()

Yeast extract 061 plusmn 0020 1000Peptone 055 plusmn 0020 9016

Potassium nitrate 046 plusmn 0036 7541

Ammonium chloride 042 plusmn 0021 6885


utilization It showed the highest production of 0671Umlwhile citrus pectin was used in the medium as C sourceand almost the same result was found in case of glucosesupplement (Table 4) suggesting that the organism exploitedcitrus pectin more efficiently as compared to other C sourcesPrakash et al (2014) [25] observed the highest production ofpectinase with lactose and glucose and Jayani et al (2010)[26] reported citrus pectin as the best carbon source forpectinase production by Bacillus sphaericus However someresearchers reported the maximum pectinase productionfrom Bacillus subtilis ADI1 using rice brain as carbon source[24]

Likewise the best enzyme production of this isolatewas recorded when yeast extract was used as N source inthe medium and the organism also produced nearly thesame amount of enzyme when peptone was supplementedwhich indicates that this organism preferred yeast extract ascompared to other N sources (Table 5) On top of that ourstudy revealed that organic nitrogen was used as better Nsources by this organism than inorganic sources for enzymeproduction These results are completely aligned with thefindings of the other workers [25 26]

Finally by applying all the optimized parameters theisolate was allowed to produce the enzyme in the productionmedium and we observed little increase in pectinase produc-tion (0689Uml)

33 Total Protein Estimation for Crude Enzyme Proteinconcentration of the crude enzyme was determined by Folin-Lowry method [14]The total protein content was 1320120583gmlin the cell-free supernatant of Chryseobacterium indologenesstrain SD

34 Optimization Studies of Pectinase Activity By growingthe organism in the production medium under optimized

08

06

04

02

00

Enzy

me a

ctiv

ity (U

ml)

30 37 40 45

Temperature (∘C)

Figure 3 Effect of temperature on pectinase activity

Enzy

me

activ

ity (U

ml)

08

06

04

02

0060 65 70 75 80 85 90

pH

Figure 4 Effect of pH on pectinase activity

conditions the crude was collected by centrifugation todetermine optimumconditions of the pectinase activityThenthe collected crude enzymewas allowed to reactwith differentsubstrate concentrations (citrus pectin) at a wide range oftemperatures pH and reaction time

In this research work the crude enzyme obtained fromChryseobacterium indologenes strain SD showed maximumactivity at 40∘C (Figure 3) whereas the organism showedthe highest production at 37∘C This result is approximatelysimilar to the result of other studies [27] However somestudies reported [28] that pectinases from various Bacillusspecies were most active at 50∘C and 60∘C From our study itcan be inferred that pectinase enzyme produced by the isolateis a moderately thermophilic enzyme

Enzyme activity also depends on the pH of the reactionmixture In our study crude enzyme showed the highestactivity at slightly alkaline pH 8 (Figure 4) and the organismalso showed its maximum production at pH 75 Thereforethis enzyme can be used for vegetable purees and otherpreparations which need neutral to slightly alkaline pH [29]This finding is in accordance with the reports of previousstudies [28] So the result of our study indicates that thiscrude enzyme might be alkaline in nature

6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)

Figure 5 Effect of reaction time on pectinase activity

0 1 2 3 400

02

04

06

08

Substrate concentration ()

Enzy

me a

ctiv

ity (U

ml)

Figure 6 Effect of substrate (citrus pectin) concentration onpectinase activity

As incubation time affects the activity of the enzyme thecrude enzyme was allowed to react with 1 of citrus pectinas substrate at optimized pH and temperature for differenttime intervals to determine its optimum reaction time Inour study enzyme activity increased with the increase ofincubation time up to 40min and then remained stable inthe subsequent incubation period (Figure 5) This result is ina good agreement with other studies [30]

The enzyme assay using different concentrations of sub-strate (citrus pectin) was observed and found that the enzymeactivity augmented up to 2 of pectin and then it showeddownward trend before being leveled off at 98 of relativeactivity in the subsequent increase of substrate concentration(Figure 6) This might be due to complete saturation ofenzyme by the substrate

35 Application of Crude Pectinase Enzyme in Fruit JuiceClarification The effect of crude pectinase of the bacterialisolate Chryseobacterium indologenes strain SD was studiedfor applegrape juice clarification The crude enzyme of theselected isolate showed good activities by clarifying the juicesas compared to control (Figure 7)

Control Treated(a)

Control Treated(b)

Figure 7 Application of pectinase in apple juice (a) and grape juice(b) clarification

4 Conclusion

Nowadays the need of industrially important enzymes hasincreased rapidly Pectinase enzymehas taken great attractionin the field of juice clarification and other commercial appli-cations In this study Chryseobacterium indologenes strainSD was found as a potential pectinase producer and it is thefirst report on Chryseobacterium indologenes strain SD Inthis investigation the crude enzyme was found to be slightlyalkaline in nature and best active at 40∘C for 40 minutesof incubation Further studies can be done for completecharacterization and purification of the crude enzyme andpurified enzymes can be used in various types of fruit juiceclarification

Conflicts of Interest

The authors declare no conflicts of interest

Acknowledgments

The financial support from the Ministry of Science andTechnology and University Grant Commission (UGC)Bangladesh is thankfully acknowledged

References

[1] D B Pedrolli A C Monteiro E Gomes and E C CarmonaldquoPectin and pectinases production characterization and indus-trial application of microbial pectinolytic enzymesrdquo The OpenBiotechnology Journal vol 3 no 1 pp 9ndash18 2009

[2] O A Oyewole S B Oyeleke B E N Dauda and S EmiadeldquoProduction of Amylase and Protease Enzymes by Aspergillusniger and Penicillium frequestans Isolated from Abattoir Efflu-entrdquo Journal of Microbiology vol 1 no 5 pp 174ndash180 2011

[3] F Stutzenberger ldquoPectinase Productionrdquo in Encyclopedia ofMicrobiology J Lederberg Ed vol 3 pp 327ndash337 Academypress New York NY USA 1992

Enzyme Research 7

[4] S Kaur H P Kaur B Prasad and T Bharti ldquoProductionand Optimization of Pectinase by Bacillus sp Isolated FromVegetableWaste Soilrdquo Indo American Journal of PharmaceuticalResearch vol 6 no 1 pp 4185ndash4190 2016

[5] I Alkorta C Garbisu J M Llama and J L Serra ldquoA ReviewrdquoProcessBiochemistry vol 17 pp 35ndash41 1982

[6] K Prathyusha and V Suneetha ldquoBacterial pectinases and theirpotent biotechnological application in fruit processingJuiceproduction industry A reviewrdquo Journal of Phytology vol 3 no6 pp 16ndash19 2011

[7] R C Dubey andD KMaheshwari ldquoPracticalMicrobiologyrdquo inS Chand and Co P Ltd p 413 ISBN New Delhi 2nd edition

[8] L K Janani G Kumar and K V Bhaskara Rao ldquoProductionand Optimization of Pectinase from Bacillus sp MFW7 usingCassavaWasterdquo Asian Journal of Biochemical and Pharmaceuti-cal Research vol 1 no 2 pp 329ndash336 2011

[9] S Kumar G Stecher and K Tamura ldquoMEGA7 MolecularEvolutionary Genetics Analysis version 70 for bigger datasetsrdquoMolecular Biology and Evolution vol 33 no 7 pp 1870ndash18742016

[10] D R Kashyap S Chandra A Kaul and R Tewari ldquoProductionpurification and characterization of pectinase from a Bacillussprdquo World Journal of Microbiology amp Biotechnology vol 16 pp277ndash282 2000

[11] N Nelson ldquoA photometric adaptation of the Somogyi methodfor the determination of glucoserdquo The Journal of BiologicalChemistry vol 153 pp 375ndash380 1944

[12] M Somogyi ldquoNotes on sugar determinationrdquo The Journal ofBiological Chemistry vol 195 no 1 pp 19ndash23 1952

[13] D Silva E S Martins R Silva and E Gomes ldquoPectinaseproduction by Penicillium viridicatum RFC3 by solid state fer-mentation using agro-industrial by-productsrdquo Brazilian Journalof Microbiology vol 33 pp 318ndash324 2002

[14] O H Lowry N J Rosebrough A L Farr and R J RandallldquoProtein measurement with Folin phenol reagentrdquo The Journalof Biological Chemistry vol 193 pp 265ndash275 1951

[15] S AMehta RMitali S Nilofer and P Nimisha ldquoOptimizationof physicological parameters for pectinase production from soilisolates and its applications in fruit juice clarificationrdquo Journalof Environmental Research and Development vol 7 no 4 pp1539ndash1546 2013

[16] R S Jayani S Saxena and R Gupta ldquoMicrobial pectinolyticenzymes a reviewrdquo Process Biochemistry vol 40 no 9 pp 2931ndash2944 2005

[17] R E Buchannan and N E Gibbson Bergeyrsquos manual of deter-minative Bacteriology Williams and Wilkins Co BaltimoreMaryland USA 8th edition 1974

[18] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987

[19] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 pp 783ndash791 1985

[20] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Acadamy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004

[21] G Aaisha and D Barate ldquoIsolation and Identification ofPectinolytic Bacteria from Soil Samples of Akola Region IndiardquoInternational Journal of Current Microbiology and Applied Sci-ences vol 5 no 1 pp 514ndash521 2016

[22] A B Saanu ldquoPectinolytic Activity of Mutagenic Strain ofLeuconostoc Mesenteroides Isolated From Orange and BananaFruit Wasterdquo Journal of Applied Microbiology and Biochemistryvol 1 no 27 pp 1ndash6 2017

[23] O J Oumer and D Abate ldquoCharacterization of Pectinase fromBacillus subtilis Strain Btk 27 and Its Potential Application inRemoval ofMucilage fromCoffee Beansrdquo Enzyme Research vol2017 Article ID 7686904 7 pages 2017

[24] M H Nawawi R Mohamad P M Tahir and W Z SaadldquoExtracellular Xylanopectinolytic Enzymes by Bacillus subtilisADI1 from EFBrsquos Compostrdquo International Scholarly ResearchNotices vol 2017 Article ID 7831954 7 pages 2017

[25] S Prakash R Karthik M T Venthan B Sridhar and PG Bharath ldquoOptimization and Production of Pectinase fromBacillus subtilis (mtcc 441) by using Orange Peel as a SubstraterdquoInternational Journal of Recent Scientific Research vol 5 no 6pp 1177ndash1179 2014

[26] R S Jayani S K Shukla and R Gupta ldquoScreening of bacterialstrains for polygalacturonase activity its production by bacillussphaericus (MTCC 7542)rdquo Enzyme Research vol 2010 ArticleID 306785 5 pages 2010

[27] A Thakur R Pahwa S Singh and R Gupta ldquoProductionpurification and characterization of polygalacturonase frommucor circinelloides ITCC 6025rdquo Enzyme Research vol 2010Article ID 170549 7 pages 2010

[28] N Torimiro and R E Okonji ldquoA comparative study of pecti-nolytic enzyme production by Bacillus speciesrdquo African Journalof Biotechnology vol 12 no 46 pp 6498ndash6503 2013

[29] M M C N Soares R Da Silva and E Gomes ldquoScreening ofbacterial strains for pectinolytic activity Characterization of thepolygalacturonase produced by Bacillus sprdquo Brazilian Journal ofMicrobiology vol 30 no 4 pp 299ndash303 1999

[30] I G Khan and D L Barate ldquoEffect of various parameters onactivity of pectinase enzymerdquo International Journal of AdvancedResearch vol 4 no 1 pp 853ndash862 2016

Hindawiwwwhindawicom

International Journal of

Volume 2018

Zoology

Hindawiwwwhindawicom Volume 2018

Anatomy Research International

PeptidesInternational Journal of



Journal of Parasitology Research

GenomicsInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom

The Scientific World Journal

Volume 2018


BioinformaticsAdvances in

Marine BiologyJournal of



Neuroscience Journal


BioMed Research International

Cell BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawiwwwhindawicom Volume 2018


Genetics Research International


Advances in

Virolog y Stem Cells International



Enzyme Research



MicrobiologyHindawiwwwhindawicom

Nucleic AcidsJournal of

Volume 2018

Submit your manuscripts atwwwhindawicom

2 Enzyme Research

2 Material and Methods

21 Sampling and Screening Pectinase producing bacteriawere isolated from vegetable dump waste soil From the col-lected samples 40 bacterial isolates were isolated and purifiedby following standard plate count techniques described byDubey andMaheshwari [7] Among 40 isolates eight isolateswere found to produce pectinase while grown on yeastextract pectin agar (YEP)medium during primary screeningScreening of pectinase producing bacteria was carried out inYEP agar medium containing yeast extract 1 pectin 1agar 15 and NaCl 05 (pH 70) at 37∘C for 48 hoursof incubation After incubation the colonies showing clearzones upon flooding with iodine-potassium iodide solution(10 g iodine 50 g potassium iodide and 330mL H

2O) were

selected as pectinase producers [8] and the isolate K6with themaximum zone of diameter was preceded for further studies

22 Identification of Selected Bacterial Strain by Pheno-typic and Biochemical Characteristics The selected isolatewas identified by morphological cultural and biochemicalcharacteristics Colony characteristics of the isolate weredetermined on yeast extract-pectin agar slant and cellularmorphology by Gram staining method For biochemicalcharacteristics several tests like citrate test TSI (triple sugariron) test indole test MR-VP motility catalase oxidasestarch hydrolysis and fermentation tests for various sugarssuch as glucose sucrose lactose maltose starch and manni-tol tests were done

23 Molecular Identification of the Bacterial Isolate Using16S rRNA Sequencing Simultaneously this potential isolatewas further identified using the molecular tool of 16S rRNAsequencing In this method PromegaWizardDNA purifi-cation kit was used for the extraction of genomic DNA ofthe selected isolate 16S rRNA gene region was amplifiedwith the universal primers The reaction mixtures were5 120583l of template primers 1120583l of forward primer 27F (51015840AGAGTTTGATCCTGGCTCAG 31015840) 1 120583l of reverse primer1492R (51015840 TACCTTGTTACGACTT 31015840) 6 120583l of assay buffer2 120583l of Taq DNA polymerase and 5120583l of dNTP mix PCRproducts were purified by using the PCR KlenzolTM andit was sequenced with a next-generation DNA sequencingThe sequencing results were then processed using BioEditsoftware The nucleotide sequence analysis was done usingthe Basic Local Alignment Search Tool (BLAST) programon National Center for Biotechnology Information site(httpswwwncbinlmnihgov) The obtained sequence datawere submitted to NCBI GenBank with accession numberKY684254 Phylogenetic analysis was conducted in Molec-ular Evolutionary Genetics Analysis software version 70(MEGA7) [9]

24 Preparation of Inoculum For the production of pectinaseenzyme the inoculum was prepared by inoculating 10mL ofsterilized YEP liquid medium in a test tube with one loop fullof pure culture and incubated at 125 rpm at 37∘C The freshovernight grown pure culture was used as an inoculum forenhanced enzyme production

25 Production of Pectinase Enzyme The inoculum (5vv) was transferred aseptically to 50mL of productionmedium (yeast extract pectate broth showing the followingcomposition yeast extract 1 pectin 1 NaCl 05 anddistilled water 100ml) in 250mL conical flask and incubatedat 37∘C for 72 hours with 125 rpm in a shaking incubator [10]After incubation the production medium was centrifuged at7000 rpm for 15min at 4∘C to obtain cell-free supernatantThe supernatant was used as the crude enzyme for furtherstudies

26 Pectinase Assay The pectinase activity was assayed byestimating the amount of reducing sugars released underassay conditions by the enzymatic degradation of citruspectin The reaction mixture containing 18ml substrate(citrus pectin) solution and 02ml suitably diluted enzymesolution was incubated at 40∘C in water bath for 1 hour Theamount of reducing sugar liberatedwas quantified byNelsonrsquosmodification of Somogyi method [11 12] One unit of enzymeactivity (U) was defined as the amount of enzyme requiredto release 1 120583mol of reducing sugar per ml per minute understandard assay conditions (1 U = 1 120583molminminus1mLminus1) [13]Thecolor intensity was measured at 500 nm in a colorimeter[SpectroT60 (UV-VIS RS)] and compared with a standardcurve prepared with ldquoD-glucoserdquo (25ndash200 micrograms)Control was maintained with uninoculatedmedia and boiledenzyme Relative activity of the enzyme was calculated as thepercentage by using the following formula

Relative Activity

= Activity of the sample

times100

Maximum activity of the sample

(1)

27 Total Protein Estimation The total protein content wasdetermined by Lowrymethod [14]measuring the absorbanceat 600 nm and compared with a standard curve prepared bybovine serum albumin (BSA)

28 Optimization of Different Factors Involved in MaximumPectinase Production

281 Effect of Temperature pH and Incubation Time Thebacterial isolate was subjected to different culture conditionsto derive the optimum conditions for maximum pectinaseproduction Pectinase production was estimated at differenttemperatures (27 30 37 40 and 45∘C) a wide range of pH(50 55 60 65 70 75 80 85 and 90) and differentincubation periods (24 48 72 96 and 120 hours) and thenthe enzyme activity was measured

282 Effect of Carbon and Nitrogen Sources To study theeffect of carbon and nitrogen sources on pectinase produc-tion from the selected isolate various carbon sources (citruspectin glucose sucrose and starch) and nitrogen sources(peptone yeast extract ammonium chloride and potassiumnitrate) were supplemented into production medium at a

Enzyme Research 3









K6





4 Enzyme Research



10062

54

24

21

10039

88

90

57

42

14

13





Relative activity()

27 036 plusmn 0050 5294

30 045 plusmn 0020 6618

37 068 plusmn 0020 100040 024 plusmn 0021 353

45 018 plusmn 0026 2647







50 037 plusmn 0020 6607

55 042 plusmn 0026 7500

60 045 plusmn 0026 8036

65 047 plusmn 0020 8393

70 048 plusmn 0020 8571

75 056 plusmn 0021 100080 040 plusmn 0025 7143

85 033 plusmn 0020 5893

90 021 plusmn 0038 375





Relative activity()

24 045 plusmn 0020 7627

48 050 plusmn 0040 8475

72 059 plusmn 0030 100096 052 plusmn 0021 8814

120 035 plusmn 0032 5932




Enzyme Research 5









Relative activity()










08

06

04

02

00

Enzy

me a

ctiv

ity (U

ml)

30 37 40 45

Temperature (∘C)


Enzy

me

activ

ity (U

ml)

08

06

04

02

0060 65 70 75 80 85 90

pH





6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)


0 1 2 3 400

02

04

06

08


Enzy

me a

ctiv

ity (U

ml)





Control Treated(a)

Control Treated(b)


4 Conclusion




Acknowledgments


References




Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


Enzyme Research 3









K6





4 Enzyme Research



10062

54

24

21

10039

88

90

57

42

14

13





Relative activity()

27 036 plusmn 0050 5294

30 045 plusmn 0020 6618

37 068 plusmn 0020 100040 024 plusmn 0021 353

45 018 plusmn 0026 2647







50 037 plusmn 0020 6607

55 042 plusmn 0026 7500

60 045 plusmn 0026 8036

65 047 plusmn 0020 8393

70 048 plusmn 0020 8571

75 056 plusmn 0021 100080 040 plusmn 0025 7143

85 033 plusmn 0020 5893

90 021 plusmn 0038 375





Relative activity()

24 045 plusmn 0020 7627

48 050 plusmn 0040 8475

72 059 plusmn 0030 100096 052 plusmn 0021 8814

120 035 plusmn 0032 5932




Enzyme Research 5









Relative activity()










08

06

04

02

00

Enzy

me a

ctiv

ity (U

ml)

30 37 40 45

Temperature (∘C)


Enzy

me

activ

ity (U

ml)

08

06

04

02

0060 65 70 75 80 85 90

pH





6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)


0 1 2 3 400

02

04

06

08


Enzy

me a

ctiv

ity (U

ml)





Control Treated(a)

Control Treated(b)


4 Conclusion




Acknowledgments


References




Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


4 Enzyme Research



10062

54

24

21

10039

88

90

57

42

14

13





Relative activity()

27 036 plusmn 0050 5294

30 045 plusmn 0020 6618

37 068 plusmn 0020 100040 024 plusmn 0021 353

45 018 plusmn 0026 2647







50 037 plusmn 0020 6607

55 042 plusmn 0026 7500

60 045 plusmn 0026 8036

65 047 plusmn 0020 8393

70 048 plusmn 0020 8571

75 056 plusmn 0021 100080 040 plusmn 0025 7143

85 033 plusmn 0020 5893

90 021 plusmn 0038 375





Relative activity()

24 045 plusmn 0020 7627

48 050 plusmn 0040 8475

72 059 plusmn 0030 100096 052 plusmn 0021 8814

120 035 plusmn 0032 5932




Enzyme Research 5









Relative activity()










08

06

04

02

00

Enzy

me a

ctiv

ity (U

ml)

30 37 40 45

Temperature (∘C)


Enzy

me

activ

ity (U

ml)

08

06

04

02

0060 65 70 75 80 85 90

pH





6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)


0 1 2 3 400

02

04

06

08


Enzy

me a

ctiv

ity (U

ml)





Control Treated(a)

Control Treated(b)


4 Conclusion




Acknowledgments


References




Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


Enzyme Research 5









Relative activity()










08

06

04

02

00

Enzy

me a

ctiv

ity (U

ml)

30 37 40 45

Temperature (∘C)


Enzy

me

activ

ity (U

ml)

08

06

04

02

0060 65 70 75 80 85 90

pH





6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)


0 1 2 3 400

02

04

06

08


Enzy

me a

ctiv

ity (U

ml)





Control Treated(a)

Control Treated(b)


4 Conclusion




Acknowledgments


References




Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


6 Enzyme Research

0 20 40 60 8004

05

06

07

Reaction time (min)

Enzy

me a

ctiv

ity (U

ml)


0 1 2 3 400

02

04

06

08


Enzy

me a

ctiv

ity (U

ml)





Control Treated(a)

Control Treated(b)


4 Conclusion




Acknowledgments


References




Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


Enzyme Research 7






























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018




Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


Documents

Extracellular Pectinase from a Novel Bacterium ...downloads.hindawi.com/journals/er/2018/3859752.pdf · KJ437473.1 Chryseobacterium indologenes strain VIT-CMJ1 16S ribosomal RNA gene